The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kohler, R. E.
Right arrow Articles by McColl, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kohler, R. E.
Right arrow Articles by McColl, S. R.
The Journal of Immunology, 2003, 170: 6298-6306.
Copyright © 2003 by The American Association of Immunologists

A Role for Macrophage Inflammatory Protein-3{alpha}/CC Chemokine Ligand 20 in Immune Priming During T Cell-Mediated Inflammation of the Central Nervous System1

Rachel E. Kohler*, Adriana C. Caon*, David O. Willenborg{dagger}, Ian Clark-Lewis2,{ddagger} and Shaun R. McColl3,*

* Department of Molecular Biosciences, University of Adelaide, Adelaide, South Australia, Australia; {dagger} Neurosciences Research Unit, Canberra Hospital, Canberra, Australian Capital Territory, Australia; and {ddagger} Biomedical Research Center, University of British Columbia, Vancouver, British Columbia, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Chemokines are a family of cytokines that exhibit selective chemoattractant properties for target leukocytes and play a significant role in leukocyte migration. In this study, we have investigated the role of the C-C chemokine, macrophage inflammatory protein (MIP)-3{alpha}/CC chemokine ligand 20, in the pathogenesis of experimental autoimmune encephalomyelitis (EAE), a model of T cell-dependent inflammation. Expression in the CNS of MIP-3{alpha}, as determined by RT-PCR, increased in a time-dependent manner such that peak expression correlated with peak clinical disease. Similarly, levels of immunoreactive MIP-3{alpha} in the draining lymph nodes increased up to 10-fold 9 days postimmunization and remained elevated for up to 21 days postimmunization. The increased production of MIP-3{alpha} coincided with onset of clinical disease. Treatment of mice with specific neutralizing anti-MIP-3{alpha} Abs significantly reduced the severity of both clinical EAE and neuroinflammation by inhibiting the sensitization of lymphocytes to the specific Ag and release of lymphocytes from the draining lymph nodes. In contrast, adoptive transfer experiments indicated that MIP-3{alpha} was not essential for the effector phase of EAE. Together, these data demonstrate that MIP-3{alpha} plays a critical role in the sensitization phase of EAE.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Lymphocyte trafficking is critical for effective immunity. At the molecular level, the process of T lymphocyte trafficking into lymph nodes and peripheral tissues appears to follow a multistep extravasation paradigm mediated by several classes of molecules including selectins, integrins, cell adhesion molecules, and various members of the chemokine gene superfamily (1, 2). Chemokines are low m.w. cytokines that are almost exclusively secreted and act as extracellular messengers (3, 4, 5). Assignment of molecules to the chemokine gene superfamily is based on homology at the primary amino acid sequence level and the presence of a highly conserved cysteine signature motif. Based on the organization of the cysteine motif, at least four subfamilies have been identified: the C-X-C, C-C, C, and C-X3-C subfamilies. The chemokines can also be subdivided according to expression patterns that loosely relate to function (6, 7, 8). The majority of chemokines are induced under inflammatory conditions while others are expressed constitutively. Those expressed during inflammation are involved in immune effector cell trafficking to peripheral tissues and organs while the constitutive chemokines are involved in homeostasis in the immune system, including lymphocyte recirculation and lymphocyte and dendritic cell (DC)4 entry into afferent lymphatics (6, 7, 8). In contrast, chemokine involvement in the exit of lymphocytes from the lymph nodes has not yet been investigated.

Macrophage inflammatory protein (MIP)-3{alpha}/CC chemokine ligand (CCL)20 is a CC chemokine that demonstrates in vitro chemotactic activity toward immature dendritic cells (9, 10), B lymphocytes, and activated and memory CD4+ and CD8+ T cells (11). MIP-3{alpha} is also able to trigger rapid adhesion of memory CD4+ T cells to ICAM-1-coated glass and TNF-{alpha}-stimulated endothelial cells (12) suggesting an important role in lymphocyte extravasation. MIP-3{alpha} demonstrates a hybrid expression pattern, being expressed constitutively in gastrointestinal tissue and inducibly in a range of peripheral tissues, including the liver, skin, and lymphoid tissues (13, 14, 15, 16). CCR6 is presently the only known receptor for MIP-3{alpha}, although it has also recently been shown to bind {beta}-defensins with high affinity (17). CCR6 mRNA and/or protein have been found in lymphoid tissues, the pancreas, T and B lymphocytes (18), CD34+ DCs (9), and monocyte-derived DCs (10). Deletion of CCR6 via homologous recombination leads to impaired leukocyte homeostasis at mucosal surfaces and altered hypersensitivity responses, although whether these effects are due to lack of activation of CCR6 by MIP-3{alpha}, {beta}-defensins, or other as yet unidentified ligands is not known (16, 19).

Taken together, these findings suggest that MIP-3{alpha} may play an important role in immune priming by functioning as a chemoattractant for immature DCs at sites of infection, and also in the effector phase by regulating the trafficking of activated T cells to inflamed tissue. However, this remains to be proven. To determine such a role for MIP-3{alpha} in vivo, we have examined the expression and function of MIP-3{alpha} in murine experimental autoimmune encephalomyelitis (EAE), an animal model of T cell-dependent CNS inflammation. Our results demonstrate that MIP-3{alpha} expression is up-regulated in both the CNS and in the draining lymph nodes during clinical disease and that disease severity is reduced by the administration of neutralizing anti-MIP-3{alpha} Abs at the time of disease induction. Further studies revealed MIP-3{alpha} to be playing a role in sensitization of naive lymphocytes to myelin Ags and in the exit of lymphocytes from the draining lymph nodes rather than in effector T cell migration into the CNS.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents

The anti-MIP-3{alpha} Abs used in this study were protein A-Sepharose purified from polyclonal antisera raised in rabbits against full-length synthetic MIP-3{alpha}. MIP-3{alpha} was synthesized as previously described (20). As determined by direct ELISA, the anti-MIP-3{alpha} Abs failed to cross-react with any of a range of other chemokines tested (murine (m) monocyte chemoattractant protein-1 (MCP-1), mRANTES, mMIP-1{alpha}, murine IFN-{gamma}-inducible protein (IP)-10, mMIP-3{beta}, murine secondary lymphoid-tissue chemokine (SLC), mMIP-1{beta}, and mMIP-2).

Ags used were either mouse spinal cord homogenate (MSCH) or proteolipid protein (PLP) peptide139–151 (HSLGKWLGHPDKF). MSCH was prepared from allogeneic spinal cord as a mix of four parts spinal cord and one part saline. Following homogenization, it was freeze-dried and stored in a desiccator at 4°C. CFA contained 0.5 mg/ml Mycobacterium butyricum (Difco, Detroit, MI) plus Mycobacterium tuberculosis H37Ra (Difco) at 4 mg/ml. The bacteria were ground using a mortar and pestle in IFA. Pertussigen, a crude extract of Bordetella pertussis cells, was a gift from Dr. J. Munoz (National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD). It was received in desiccated form and reconstituted to 100 µg/200-µl aliquots in endotoxin-free PBS then stored at -70°C.

Mice

Female BALB/c mice (H-2d) were obtained from the Central Animal House (Adelaide University, Adelaide, South Australia). Female SJL/J mice (H-2s) were purchased from the Animal Resource Center (Perth, Western Australia). Mice were aged 6–9 wk at the initiation of experiments. Animals were housed in conventional mouse rooms at Adelaide University where they were provided with food and water ad libitum. Severely paralyzed mice were hand-fed and watered.

Induction of active EAE

SJL/J mice were immunized with 6 mg of MSCH in CFA. The emulsion contained equal volumes of MSCH (6 mg in 60 µl of endotoxin-free PBS) and CFA, and each mouse received 120 µl of the emulsion. Fifty microliters of the emulsion were injected s.c. into each hind footpad, and 20 µl were injected s.c. into the nape of the neck. Two hours before and 2 days after the injection of MSCH emulsion, the mice received an i.v. injection of 5 µg of pertussigen in 250 µl of PBS. For immunization with PLP peptide139–151, 50 µg were injected per mouse in a volume of 100 µl of CFA emulsion. Fifty microliters of the emulsion were injected s.c. into each hind flank, and mice were treated with pertussigen as above. Mice were evaluated daily until day 21 and scored for severity of clinical disease on a scale of 0–5, as follows: 0, no clinically detectable signs of EAE; 0.5, early symptoms of movement dysfunction; 1, slight weakness in the tail; 2, definite tail and partial hind limb paralysis or inability to turn over when placed on back; 3, complete hindquarter paralysis; 3.5, complete hindquarter paralysis with partial forelimb paralysis; 4, complete hindquarter and forelimb paralysis; 5, moribund.

Collection of lymphoid and CNS tissue

Mice were euthanized by CO2 asphyxiation and perfused through the left ventricle with ice-cold PBS. The draining lymph nodes were removed by blunt dissection using scissors. The spinal cord was extracted from the spinal column using scissors to cut the vertebrae and a scalpel to remove the cord. Samples of tissue were then snap-frozen in liquid nitrogen (for ELISA) or in TRIzol reagent (Life Technologies, Melbourne, Australia) (for RNA extraction) and stored at -70°C before analysis, or stored in formalin (for sectioning). For analysis by ELISA, weighed snap-frozen tissue were homogenized in 500 µl of ice-cold PBS then centrifuged at 4°C and 5000 rpm for 10 min. The supernatant was then transferred to a fresh tube and samples were stored at -20°C before analysis. Formalin-fixed tissues were embedded, sectioned, then stained with H&E at the Department of Neuropathology (Institute of Medical and Veterinary Sciences, Adelaide, South Australia).

Priming of donor lymphocytes, cell culture, and transfer of EAE

Donor SJL/J mice were primed by s.c. immunization with 25 µg of PLP139–151 emulsified in CFA. Ten days later, the mice were euthanized as described above. The draining lymph node cells were pooled and cultured in vitro for 96 h in complete RPMI 1640 (Institute of Medical and Veterinary Science) containing 50 µM 2-ME (Sigma-Aldrich, Castle Hill, New South Wales, Australia); 2 mM L-glutamine, 10 mM HEPES, and penicillin and gentamicin supplement (all from Institute of Medical and Veterinary Science); and 10% heat-inactivated FCS (Trace Scientific, Noble Park, Victoria, Australia) at 4 x 106 viable cells/ml in the presence of 50 µg/ml PLP139–151. Cells were incubated at 37°C in a humidified atmosphere containing 5% CO2. The cells were harvested after 96 h of culture, washed, and 5 x 107 viable cells were transferred i.v. into normal SJL/J recipients.

RNA extraction and RT-PCR

Extraction of RNA was performed on spinal cord tissue from mice using TRIzol total RNA isolation reagent and the protocol recommended by the manufacturer (Life Technologies). All reagents used were chilled to 4°C before use, and sample tissue was kept on ice or at 4°C at all stages. RNA (5 µg) was treated with RNase-free DNase 1 (Promega, Madison, WI) according to the manufacturer’s instructions, and 2.5 µg were used in first-strand cDNA synthesis, priming with random hexamer primers (Amersham Life Sciences, Arlington Heights, IL) and using the SuperScript II preamplification system (Life Technologies). PCR was performed using AmpliTaq Gold (PerkinElmer, Wellesley, MA) following the manufacturer’s instructions. PCR cycling conditions were 95°C for 10 min, 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, with steps two to four repeated 35 times. This number of cycles was chosen as amplification of both products was in the linear range. Primer sequences were as follows: mMIP-3{alpha} forward, caagcgtctgctcttccttg, mMIP-3{alpha} reverse tggatcagcgcacacagatt; GAPDH forward, tccttggaggccatgtaggccat, GAPDH reverse, tgatgacatcaagaaggtggtgaag. PCR products were resolved on 2% agarose gels, stained with SYBR-gold (Molecular Probes, Eugene, OR), and visualized/analyzed using a Molecular Imager FX (Bio-Rad, Hercules, CA). The band intensity values for MIP-3{alpha} were expressed as a ratio relative to band intensity for the GAPDH PCR product amplified from the same template.

In vitro chemotaxis assay

Splenocytes from BALB/c mice were purified through a cell dissociation sieve (60 mesh) (Sigma-Aldrich, St. Louis, MO). Cells were collected by centrifugation and resuspended in RPMI 1640 supplemented with 10% FCS and 10 µg/ml LPS. Following 48 h of culture, cells were fluorescently labeled by incubating with calcein-AM (2 µM final concentration in RPMI 1640/0.5% BSA) for 30 min at 37°C. Cells were resuspended to 1 x 107 viable cells/ml in RPMI 1640-BSA and subjected to Transwell chemotaxis assays (6.5-mm diameter filter, 5-µm pore size; Corning, Corning, NY). Briefly, 600 µl of chemotaxis medium (RPMI 1640 containing 0.5% BSA (w/v)) containing either diluent or the indicated concentration of MIP-3{alpha} were added to the lower chambers of a Transwell plate. After adding 100 µl of labeled cells to the upper chambers, the assay was conducted for 3 h at 37°C and cells were collected from the lower chamber. The cells in the lower chamber were quantified by transferring to a 96-well microtiter tray and measuring fluorescence. The percent migration of cells was calculated by inserting the fluorescence value from each chamber into the following formula: (100 x (Y - Ymin)/(Ymax))), where Ymin was the value obtained in the absence of chemokine, Ymax was the value obtained for 100 µl of cells added directly to the lower chamber of the Transwell and Y was the value obtained from the experimental sample.

MIP-3{alpha} ELISA

Costar high-binding 96-well trays (Corning) were coated with 100 µl of polyclonal capture Ab, diluted in 0.1 M NaHCO3. Plates were incubated at 4°C overnight, then washed twice with PBS/Tween and blocked with 200 µl of PBS/3% BSA for 2 h at 37°C. The plates were washed twice as before and chemokine standards or samples were added (100 µl per well) and incubated for 90 min at 37°C. The plates were washed twice with PBS/Tween and incubated with biotin-conjugated anti-MIP-3{alpha} diluted in PBS/1% BSA and incubated for 45 minutes at room temperature, then washed four times with PBS/Tween. One hundred microliters of streptavidin-HRP conjugate (diluted 1/20,000 in PBS/1% BSA) were then added to each well. The plates were incubated for 30 min at room temperature, then washed five times with PBS/Tween. The peroxidase reaction was developed by adding 200 µl of Fast OPD substrate prepared as per manufacturer’s recommendations (Sigma-Aldrich). The reaction was allowed to develop for up to 15 min in the dark, and was stopped by the addition of 50 µl of 3 M HCl to each well. Absorbance was then measured at 485 nm using a Biolumin-960 96-well plate reader, using Xperiment software (Molecular Dynamics, Melbourne, Victoria, Australia).

Lymphocyte proliferation assay

Mice immunized with PLP peptide139–151 were euthanized 12 days postimmunization and the draining inguinal lymph nodes were taken for proliferation assays using a modification of previously published protocols (21, 22, 23). Briefly, single cell suspensions (2 x 107 viable cells/ml) were prepared and cells were fluorescently labeled by incubating with CFSE (Molecular Probes) (2.5 µM final concentration in RPMI 1640/0.1% BSA) for 10 min at 37°C. Following the incubation, the staining reaction was quenched by the addition of a large volume of complete medium for 5 min at room temperature. The cells were then washed twice and resuspended at a concentration of 2 x 106 viable cells/ml. In a final volume of 200 µl, 2 x 105 cells were cultured in 96-well round bottom plates with added peptide at a concentration of 5.0 or 50.0 µg/ml, or with 1.0 µg/ml Con A. After 4 days of culture, the cells were harvested, labeled for CD4 (BD PharMingen, San Diego, CA) and analyzed by flow cytometry using a BD FACScan and Cell Quest Pro software (BD Biosciences, San Jose, CA). Cell division (proliferation) was determined as a progressive halving in CFSE fluorescence intensity.

Statistical analysis

A two-tailed Student’s t test was used for all statistical analysis. Results were considered significant if the p value was 0.05 or lower.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of MIP-3{alpha}/CCL20 is elevated in the CNS and draining lymph nodes during the pathogenesis of EAE

To determine whether MIP-3{alpha}/CCL20 is expressed during the induction of EAE, SJL/J mice were immunized with MSCH and pertussigen (as described in Materials and Methods). Following immunization, mice showed clinical disease, characterized by ascending paralysis 10–16 days following immunization (Fig. 1A), with a mean day of onset of clinical disease around day 10 postimmunization. The paralysis peaked around 12–13 days postimmunization. Clinical disease had completely subsided by 20 days postimmunization in all experiments.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 1. Up-regulation of MIP-3{alpha} expression in the spinal cord and draining lymph nodes during EAE. SJL/J mice were injected s.c. with 6 mg of MSCH or PBS in CFA. Two hours before and 2 days after the injection of MSCH emulsion, the mice received 5 µg of pertussigen (i.v.). A, Typical EAE disease course (n = 6). At days 9, 13, and 21 postimmunization, the mice were killed and perfused with cold PBS and popliteal lymph nodes and spinal cord were collected. B, Total RNA was extracted from the spinal cords, reverse-transcribed, and the resultant cDNAs were used as a template in PCR using MIP-3{alpha}- or GAPDH- specific primers. Data are presented as the ratio of MIP-3{alpha} band intensity relative to GAPDH. C, The protein fraction was extracted from the lymph nodes and tested for the presence of MIP-3{alpha} using a two-site ELISA. Data shown are representative of two independent experiments. Data are presented as mean ± SEM (n = 4). *, Significantly different from day 0 at p < 0.05; **, significantly different from day 0 and PBS/CFA-immunized value at the same time point (p < 0.01).

 
Following induction of EAE with MSCH, groups of mice were sacrificed at time points corresponding to no disease (day 0), preclinical disease (day 9 postimmunization), acute disease (day 13 postimmunization), and remission (day 21 postimmunization), and perfused as described in Materials and Methods; spinal cords and the draining lymph nodes (popliteal, axial, and brachial) were removed and processed for analysis of MIP-3{alpha} expression. Initially, attempts were made to assess the level of MIP-3{alpha} in the spinal cord tissue by sandwich ELISA. However, high background was observed in these samples and RT-PCR was therefore used. Analysis of the spinal cords collected at the above time points indicated a low level of basal expression of MIP-3{alpha} in normal spinal cord (day 0; Fig. 1B). Immediately before onset of clinical disease in the MSCH-immunized animals, there was a strong up-regulation of MIP-3{alpha} expression, with the peak expression of MIP-3{alpha} in the CNS correlating with the peak of clinical disease. As the animals entered remission, MIP-3{alpha} expression in the CNS returned to basal levels. In contrast, there was no alteration of MIP-3{alpha} expression evident in the CNS of PBS/CFA-immunized animals.

The draining lymph nodes were also removed, pooled, and a two-site ELISA was used to determine the level of MIP-3{alpha} protein present. Low levels of MIP-3{alpha} (2.6 ± 0.1 pg/ml) were detected in the lymph nodes in control mice (day 0; Fig. 1C) and significantly (p < 0.05) higher levels of immunoreactive MIP-3{alpha} were detected in the draining lymph nodes of mice following induction of EAE with MSCH/CFA. Of the time points examined, MIP-3{alpha} production was highest at 9 days postimmunization when the lymph node content of MIP-3{alpha} protein increased over 10-fold (p < 0.01). The MIP-3{alpha} levels rapidly declined after day 9, but remained significantly elevated (p < 0.05) for up to 21 days postimmunization. Immunization with PBS/CFA also elicited a significant increase in the level of MIP-3{alpha} protein in the lymph nodes, however, the increase was no greater than 5-fold that of the day 0 value.

Anti-mMIP-3{alpha} Abs inhibit lymphocyte migration toward MIP-3{alpha} in vitro

To determine whether MIP-3{alpha} expression played a causal role in EAE, neutralizing polyclonal anti-MIP-3{alpha} Abs were produced. Rabbits were immunized with full-length synthetic mMIP-3{alpha}, anti-mMIP-3{alpha}-positive sera were collected and the anti-mMIP-3{alpha} IgG fraction was purified by protein A-Sepharose column chromatography. The Abs were then tested for their ability to neutralize mMIP-3{alpha} chemotactic activity in vitro using LPS-activated splenocytes. Previous experiments indicated that exposure of splenocytes to LPS for 48 h enhanced responsiveness to MIP-3{alpha} (unpublished data). Maximal chemotaxis of these cells in response to MIP-3{alpha} was observed between 0.1 and 1.0 µg/ml (Fig. 2A). Based on these dose-response data, the ability of anti-MIP-3{alpha} or control Abs to neutralize MIP-3{alpha}-induced chemotaxis of splenocytes was tested using a suboptimal dose (60 ng/ml) of MIP-3{alpha} as a stimulus. Control (normal rabbit IgG (NRIgG)) IgG failed to inhibit MIP-3{alpha}-induced chemotaxis, whereas anti-MIP-3{alpha} Abs dose-dependently inhibited migration of the splenocytes in response to MIP-3{alpha} (Fig. 2B). Complete inhibition was observed with 100 µg/ml anti-MIP-3{alpha}.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 2. Anti-MIP-3{alpha} Abs inhibit the chemotactic responsiveness of splenocytes to MIP-3{alpha} in vitro. Splenocytes were purified from BALB/c mice and incubated with 10 µg/ml LPS in RPMI 1640. Following 48 h of culture, cells were stained with 2 µM calcein-AM and subjected to Transwell chemotaxis assays. A, Dose-response curve to MIP-3{alpha}. B, The effect of anti-MIP-3{alpha} Abs on the chemotactic response to MIP-3{alpha}. The percentage of total cells migrated was determined as described in Materials and Methods. Data are presented as mean ± SEM (A, n = 8; B, n = 4).

 
Effect of neutralization of MIP-3{alpha} on the development of EAE

Passive immunization of mice with 500 µg of IgG-purified anti-MIP-3{alpha} Abs 1 day before immunization with MSCH (Fig. 3, A–C) significantly inhibited development of EAE in three separate experiments, although the manifestation of inhibition was different in each experiment. The dose of Ab administered was based on the results of experiments undertaken to determine the pharmacokinetic distribution of rabbit IgG in mice. These experiments indicated that the Abs were retained at high levels in the peripheral blood and lymph nodes, as well as in the spinal cords of mice in which EAE had been induced (data not shown). In experiment one (Fig. 3A; Table I), mean clinical disease score was significantly lower in the anti-MIP-3{alpha}-treated mice on the first day of disease expression (day 10) and while the mean clinical disease score in the anti-MIP-3{alpha}-treated group remained lower than the control group, the two treatment groups eventually followed the same disease course. In contrast, the anti-MIP-3{alpha}-treated group in experiments two and three (Fig. 3, B and C) followed a different pattern. In experiment two (Fig. 3B; Table I), mice in the anti-MIP-3{alpha}-treated group achieved a lower maximal disease score and recovered significantly more rapidly than the control group. In experiment three (Fig. 3C; Table I), disease scores in the anti-MIP-3{alpha}-treated group were always lower than the control group, with the anti-MIP-3{alpha}-treated group exhibiting a significantly lower maximal disease score and entering remission more rapidly than the control group. Furthermore, in experiment three, significantly fewer mice developed disease in the anti-MIP-3{alpha}-treated group compared with the control group (Table I). Experiments using PLP139–151 (the immunodominant peptide of MSCH; Ref.24) as an encephalitogen yielded essentially the same results as those described above (Fig. 3D; Table I). Disease severity was significantly lower in the anti-MIP-3{alpha}-treated animals on all days on which mice displayed clinical signs of disease except days 10, 14, 19, and 20 postimmunization.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 3. Effects of in vivo antichemokine treatment on the development of clinical disease in EAE. SJL/J mice were injected s.c. with 6 mg of MSCH (A–C) or 50 µg of PLP139–151 (D) in CFA. Two hours before and 2 days after the injection of emulsion, the mice received 5 µg of pertussigen (i.v.). One day before immunization, 500 µg of anti-MIP-3{alpha} or control IgG (NRIgG) were injected into the peritoneal cavity. Mice were monitored for disease symptoms over a period of 25 days postimmunization. A–D, Data obtained in four independent experiments. Data are presented as mean clinical disease score ± SEM as a function of days after immunization (A, n = 12; B, n = 6; C, n = 10; D, n = 7). *, Significantly different from NRIgG group at p < 0.05.

 

View this table:
[in this window]
[in a new window]
 
Table I. Effect of depletion of MIP-3{alpha} on the development of clinical EAE

 
Reduction of histopathology in the CNS by anti-MIP-3{alpha} treatment

Mononuclear cell migration into the CNS precedes the development of disease symptoms in EAE (25). To determine whether anti-MIP-3{alpha} treatment affected the infiltration of mononuclear inflammatory cells in the CNS, mice in the anti-MIP-3{alpha} and NRIgG treatment groups were killed for histological examination 14 days postimmunization. Mice that had received no treatment were also killed to provide background control tissue. The spinal cord was perfused and longitudinal or transverse sections were cut. Sections were stained with H&E and evaluated for the extent of mononuclear cell infiltration into the meninges, perivascular areas, and parenchyma. Representative photomicrographs of transverse sections of thoracic/lumbar regions of the spinal cord of NRIgG- and anti-MIP-3{alpha}-treated mice are shown in Fig. 4. Very few mononuclear cells were observed in the spinal cords of control mice (data not shown). Spinal cord sections from NRIgG-treated mice showed extensive meningeal, perivascular, and parenchymal mononuclear cell infiltration (Fig. 4A). Moreover, there was extensive mononuclear cell infiltration at spinal nerve entries (data not shown). In contrast, spinal cord sections from anti-MIP-3{alpha}-treated mice showed little or no meningeal, perivascular, or parenchymal mononuclear cell infiltration (Fig. 4B). These spinal cords were consistent in appearance with those observed in control (day 0) mice. These histopathological data were quantified and, as shown in Table II, the anti-MIP-3{alpha}-treated mice lacked mononuclear cell infiltration and had significantly fewer lesions per section compared with the NRIgG-treated mice.



View larger version (80K):
[in this window]
[in a new window]
 
FIGURE 4. Effect of administration of anti-MIP-3{alpha} Abs on the histopathology of EAE in the CNS. SJL/J mice were injected s.c. with 6 mg of MSCH in CFA. Two hours before and 2 days after the injection of MSCH emulsion, the mice received 5 µg of pertussigen (i.v.). Representative photomicrographs of H&E-stained spinal cord sections from (A) mice pretreated with NRIgG or (B) anti-MIP-3{alpha}-treated mice were assessed for mononuclear cell infiltration in the meninges and white and gray matter. Spinal cords were removed at 14 days postimmunization. These photomicrographs are representative of 21 sections from at least three mice. At the time of sacrifice, the disease score from the representative NRIgG-treated mouse was 2.5, and the disease score from the representative anti-MIP-3{alpha}-treated mouse was 1.0. Magnification, x4.

 

View this table:
[in this window]
[in a new window]
 
Table II. Decreased CNS histopathological lesions in anti-MIP-3{alpha}-treated mice

 
Effect of neutralization of MIP-3{alpha} on the effector and sensitization phases of EAE

Inhibition of EAE by neutralizing endogenous MIP-3{alpha} could occur by several mechanisms including inhibition of the effector and/or sensitization phases of EAE. To determine whether MIP-3{alpha} is involved in the effector phase of EAE, recipient SJL/J mice were treated with 500 µg of anti-MIP-3{alpha} or NRIgG and injected with 5 x 107 PLP139–151-reactive lymphocytes. The PLP model was used for these experiments as MSCH was found to be toxic to sensitized T cells in vitro and could therefore not be used to restimulate the cells (unpublished observations). The results of a representative adoptive transfer experiment are shown in Fig. 5. No significant difference between the two groups was observed with respect to any of the disease parameters measured in three separate experiments.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 5. Effect of MIP-3{alpha} depletion in recipients on adoptive transfer of EAE. Donor mice were immunized s.c. with 25 µg of PLP139–151 in CFA and two doses of pertussigen. Ten days postimmunization, draining lymph node cells were harvested, stimulated for 4 days in the presence of 50 µg/ml PLP139–151, and 5 x 107 cells were transferred into naive recipients that had been treated with either anti-MIP-3{alpha} (500 µg) or control IgG (500 µg) on the day of transfer. Data are presented as mean clinical disease score ± SEM as a function of days after transfer (n = 6). The experiment shown is representative of three others performed with similar results.

 
Because MIP-3{alpha} appeared to play no significant role in the effector phase of EAE, we then examined the effect of blocking MIP-3{alpha} at the level of specific Ag priming. Twelve days postimmunization with PLP139–151, the draining lymph nodes were removed, weighed, and the total number of cells present was enumerated. The weight of the lymph nodes removed from the anti-MIP-3{alpha}-treated mice was significantly greater than those removed from the NRIgG-treated mice (Fig. 6A) and this enlargement was accompanied by an increase in the number of viable nucleated cells (Fig. 6B). Flow cytometric analysis of the cells in these lymph nodes demonstrated that 55.4 ± 1.5% of the cells were CD4+, 22.7 ± 0.8% of the cells were CD8+, 10.6 ± 0.9% of the cells expressed surface Ig, and 1.2 ± 0.1% of the cells were positive for CD11c (n = 6). There was no significant difference between NRIgG- and anti-MIP-3{alpha}-treated mice with respect to these values (data not shown).



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 6. Effect of MIP-3{alpha} depletion on sensitization of T cells to encephalitogenic peptides and lymph node morphology. SJL/J mice were immunized with 50 µg of PLP139–151 peptide in CFA and given pertussigen as described in Materials and Methods. One day before immunization, 500 µg of anti-MIP-3{alpha} or control IgG (NRIgG) were injected into the peritoneal cavity. Mice from both treatment groups were killed on day 12 postimmunization, and the draining lymph nodes were collected and assayed for proliferation or weighed, and the nucleated cells were enumerated and analyzed by flow cytometry. A, Effect of treatment with anti-MIP-3{alpha} Abs on lymph node weight. B, Effect of treatment with anti-MIP-3{alpha} Abs on the number of viable nucleated cells recovered from the nodes for each treatment group. C, Effect of treatment with anti-MIP-3{alpha} Abs on lymphocyte division upon restimulation in vitro. Data in A–B are presented as mean ± SEM (n = 8). Data in C are presented as mean ± SD (n = 4) and are representative of three independent experiments performed with similar results. *, Significantly different from NRIgG group at p < 0.05; **, significantly different from NRIgG group at p < 0.01.

 
Following removal of the lymph nodes and dissociation into single cell suspensions, the lymphocytes were restimulated with different amounts of PLP139–151 in the presence of CFSE and the proliferative response was assessed by flow cytometry using the CFSE dye dilution technique (21, 23). In these experiments, the majority of divided cells were CD4+CD3+ (between 78–83%). CD4+ lymphocytes from anti-MIP-3{alpha}-treated mice exhibited a significantly (p < 0.01) lower proliferative response than lymphocytes from NRIgG-treated mice when restimulated with 5.0 µg/ml and 50 µg/ml PLP139–151 (Fig. 6C). This inhibitory action was specific as no significant difference with respect to proliferation between lymphocytes from NRIgG- or anti-MIP-3{alpha}-treated mice was observed in response to the mitogen Con A.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this article, we present several novel pieces of information concerning the biology of the CC chemokine MIP-3{alpha}/CCL20. Using the CNS autoimmune disease EAE as a model system, we provide the first unequivocal in vivo evidence for the involvement of MIP-3{alpha} in the pathogenesis of T lymphocyte-dependent inflammation. MIP-3{alpha}/CCL20 expression was up-regulated in the spinal cord and the draining lymph nodes in both the preclinical phase of EAE as well as at the height of clinical disease, and disease severity and histopathology were significantly reduced by administration of anti-MIP-3{alpha} Abs at the time of disease induction. Finally, we demonstrated that MIP-3{alpha} is required for sensitization of T cells to Ag and for release of T cells from lymph nodes during the course of an immune response.

An increase in expression of MIP-3{alpha} in the spinal cord has previously been observed in PLP-induced EAE in the mouse (26) and in S100{beta}- and myelin oligodendrocyte glycoprotein-induced experimental autoimmune panencephalomyelitis in the rat (27). However, quantitation of MIP-3{alpha}/CCL20 expression was not conducted in either of these previous studies. In the present study, an increase in MIP-3{alpha} expression was observed in both the lymph nodes draining the site of immunization and in the spinal cord over the course of EAE. Statistically significant elevation of MIP-3{alpha} expression in the spinal cord was observed by day 9 postimmunization and peak expression was reached by day 13, the same day as peak disease was achieved, indicating a close correlation between expression of MIP-3{alpha} in the spinal cord and disease symptoms. Previous findings also suggest that immunoreactive MIP-3{alpha}/CCL20 is present in the spinal cord during the acute phase of EAE and is localized to inflammatory cell infiltrates, with very few MIP-3{alpha}+ cells being found in the surrounding parenchyma (26). Based on colocalization with glial fibrillary acidic protein, the major resident cellular source of MIP-3{alpha}+ in the spinal cord during EAE relapses appears to be astrocytes (26).

In the context of previous studies on chemokine gene expression in EAE, at the onset of acute disease, both C-X-C and C-C chemokine expression has been observed in the spinal cord at time points correlating with disease symptoms (28). As we show for MIP-3{alpha}/CCL20, expression of IP-10 and MCP-1 in the CNS correlates with the clinical course of EAE in SJL/J mice (29, 30, 31, 32). However, while previous studies indicate that astrocytes surrounding inflammatory foci are the major cellular source of IP-10 and MCP-1, astrocytes and infiltrating inflammatory cells appear to be the major source of MIP-3{alpha}/CCL20 (26). MIP-1{alpha}, MIP-1{beta}, and RANTES mRNA expression has also been observed in the CNS before the onset of clinical disease and the levels of mRNA for these chemokines remained elevated throughout the course of clinical disease (25, 30). However, these transcripts were found to be expressed within inflammatory foci by leukocytes rather than astrocytes. Unlike MIP-3{alpha}/CCL20 (present study and Ref.16), none of these chemokines were expressed at a basal level in normal CNS tissue. The fact that MIP-3{alpha}/CCL20 is constitutively expressed in CNS tissue, and is also up-regulated during inflammation of the CNS, is consistent with the notion that this chemokine spans the constitutive and inducible classes (11, 16).

Abundant MIP-3{alpha} protein was also detected in the draining lymph nodes following immunization. The level of MIP-3{alpha} peaked 9 days postimmunization at levels ~10 times higher than those observed in draining lymph nodes from the nonimmunized control animals. MIP-3{alpha} protein expression in the lymph nodes remained significantly elevated throughout peak clinical disease and into remission. Most previous studies examining chemokine gene expression during EAE have focused on the spinal cord or the CNS (25, 31, 32, 33), and to our knowledge, our data provide the first indication of expression of a chemokine in the draining lymph nodes during the sensitization phase of EAE, consistent with MIP-3{alpha}/CCL20 playing an important role in the sensitization phase of EAE. Expression of other inflammatory chemokines has been observed in lymph nodes in conditions other than EAE. For instance, MIP-1{alpha} and MIP-1{beta} have been detected in draining lymph nodes following cutaneous administration of dinitrofluorobenzene (34), as well as in lymph nodes from a range of pathologies (35, 36). Further studies will be required to identify the sources of MIP-3{alpha}/CCL20 in the lymph node. Although it is possible that activated T lymphocytes are an important source of MIP-3{alpha} in the lymph node, previous data from our laboratory and those of others suggest that the most significant source of MIP-3{alpha} in most tissues is resident cells such as keratinocytes and fibroblasts in skin and epithelial cells in the gut (16, 37, 38). Therefore, it seems likely that endothelial cells in the lymph node may express MIP-3{alpha}/CCL20 which would be consistent with the results of previous studies showing expression of MIP-3{alpha} by endothelial cells lining blood and lymphatic microvessels (39). Furthermore, MIP-3{alpha} production by endothelial cells associated with efferent lymphatic vessels is consistent with our observation that treatment with anti-MIP-3{alpha} Abs led to retention of cells within the lymph nodes (discussed in more detail below). It is also possible that stromal cells in the lymph nodes produce MIP-3{alpha} under inflammatory conditions as these cells have been shown to constitutively express the related chemokines MIP-3{beta} and SLC (40).

Administration of a single dose of anti-MIP-3{alpha} Abs inhibited disease severity (as determined by clinical disease score) at the peak of clinical disease in four independent experiments and reduced accumulation of mononuclear cells in the CNS as determined histologically. The fact that MIP-3{alpha} expression was increased in both the draining lymph nodes and the spinal cord during the pathogenesis of EAE suggested that MIP-3{alpha} may play a role in both the sensitization and the effector phase of EAE. However, treatment of recipient mice with anti-MIP-3{alpha} Abs failed to prevent passive transfer of EAE using encephalitogenic T cells, indicating that MIP-3{alpha} is not essential for the effector phase of this immune response. This is in contrast to recent data that demonstrate a role for CCR6 in T cell trafficking to peripheral tissue during the effector phase of delayed-type hypersensitivity (DTH) reactions (19), suggesting either that MIP-3{alpha} is not the CCR6 ligand mediating CCR6+ T cell trafficking in DTH, or that the involvement of the MIP-3{alpha}/CCR6 axis in effector T cell trafficking depends on the nature of the Ag and/or the site to which the cells are trafficking. The failure of anti-MIP-3{alpha} Abs to prevent passive transfer of EAE is also in contrast to the situation observed with other chemokines including IP-10 and MIP-1{alpha} (25, 29). In both those cases, prior treatment of recipients with neutralizing antiserum significantly suppressed disease transfer, indicating that, unlike the case with MIP-3{alpha}, the documented expression of these chemokines in the CNS is vital for the recruitment of effector cells.

To determine whether the observed decrease in clinical disease severity and CNS mononuclear cell infiltration was attributed to a reduction in Ag-specific priming, the proliferative response of PLP-specific lymphocytes was analyzed using bulk lymphocyte cultures. CD4+ T lymphocytes from anti-MIP-3{alpha}-treated mice proliferated less robustly in response to PLP139–151 compared with lymphocytes from NRIgG-treated mice indicating that the decrease in disease severity is associated with a decreased PLP-specific CD4+ T cell response. This is again in contrast to observations made using a DTH model in CCR6-deficient mice where the level of sensitization to alloantigen in wild-type and CCR6-/- mice was equivalent (19).

Importantly, the reduced proliferation was not due to a general defect in T lymphocyte receptor signaling because there was no difference between T cells isolated from the draining lymph nodes of mice treated with NRIgG and anti-MIP-3{alpha} with respect to a proliferative response to the mitogen Con A. As T lymphocyte sensitization involves the efficient presentation of Ag by DCs to Ag-specific T lymphocytes in the peripheral lymph nodes (41), the decreased sensitization of T lymphocytes in anti-MIP-3{alpha}-treated mice could be attributed to less efficient Ag presentation by DCs. Hence, during MIP-3{alpha} neutralization, immature DCs expressing CCR6 (9, 10) are unable to respond to MIP-3{alpha} produced at the site of immunization (9) which in turn, is likely to reduce the overall number of mature DCs migrating to the lymph node to present Ag to T lymphocytes over the course of the sensitization phase. Efficient activation of T lymphocytes also requires serial TCR triggering mediated by multiple interactions between the T cells and APCs (42, 43). As MIP-3{alpha} is a chemotactic and activating factor for lymphocytes (12, 14, 44), its neutralization may decrease the number of interactions between the T cells and the APCs thereby reducing efficient activation.

Our data also provide the first evidence implicating MIP-3{alpha} (or any chemokine) in the exit of T lymphocytes from the lymph nodes. The draining lymph nodes from anti-MIP-3{alpha}-treated animals were significantly larger than those from NRIgG-treated animals and this enlargement was accompanied by an increase in the number of nucleated cells in the nodes. This observation suggests that when MIP-3{alpha} activity is neutralized during the sensitization phase of the immune response, a reduced number of lymphocytes, including Ag-specific lymphocytes, exit the lymph nodes. Thus, fewer Ag-specific lymphocytes enter the CNS resulting in reduced expression of EAE. Very little information is presently available concerning the molecular cues that regulate lymphocyte exit from peripheral lymph nodes. Our data suggest that expression of MIP-3{alpha}, perhaps by endothelial cells lining the efferent lymphatics, plays an important role in lymphocyte release from the nodes. A synonymous role for SLC in lymphocyte and DC entry into the afferent lymphatics has been described (39). Moreover, the notion that the MIP-3{alpha}/CCR6 system may play an important role in lymphocyte trafficking within the lymph nodes is supported by our observation that MIP-3{alpha} expression is increased in lymph nodes following immunization (present study), and by our recent data demonstrating that compared with naive cells, the expression of CCR6 is increased on CD4+ T lymphocytes activated by Ag in vitro (45).

Overall, the findings of this study raise several important questions. First, will neutralization/antagonism of CCR6 cause a similar inhibition of EAE pathogenesis? Second, what is the precise mechanism by which anti-MIP-3{alpha} Abs reduce sensitization to the encephalitogen? Is it due to a reduction in the number of immature DCs servicing the site of immunization, or is it due to modulation of trafficking of naive T cells in the draining lymph nodes, or a combination of both? Third, how does neutralization of MIP-3{alpha} lead to an increase in the size and cellularity of the draining lymph nodes? These issues will be addressed in future studies.


    Acknowledgments
 
We gratefully acknowledge the excellent assistance and advice of Dr. Maria Staykova and Sue Fordham.


    Footnotes
 
1 This work was supported by the National and Medical Research Council of Australia and the National Multiple Sclerosis Society of Australia. R.E.K. was the recipient of an Australian Postgraduate Award. Back

2 The coauthors would like to dedicate this manuscript to the memory of Prof. Ian Clark-Lewis who passed away during the completion of this work. Back

3 Address correspondence and reprint requests to Dr. Shaun R. McColl, Head, Chemokine Biology Laboratory, School of Molecular and Biomedical Science, University of Adelaide, Adelaide, South Australia, Australia 5005. E-mail address: shaun.mccoll{at}adelaide.edu.au Back

4 Abbreviations used in this paper: DC, dendritic cell; MIP, macrophage inflammatory protein; CCL, CC chemokine ligand; EAE, experimental autoimmune encephalomyelitis; m, murine; IP, IFN-{gamma}-inducible protein; SLC, secondary lymphoid tissue chemokine; MSCH, mouse spinal cord homogenate; PLP, proteolipid protein; DTH, delayed-type hypersensitivity; NRIgG, normal rabbit IgG; MCP-1, monocyte chemoattractant protein-1. Back

Received for publication May 8, 2002. Accepted for publication April 14, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Butcher, E. C.. 1991. Leukocyte-endothelial cell recognition: three (or more) steps to specificity and diversity. Cell 67:1033.[Medline]
  2. Springer, T. A.. 1994. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell 76:301.[Medline]
  3. Rollins, B. J.. 1997. Chemokines. Blood 90:909.[Free Full Text]
  4. Gale, L. M., S. R. McColl. 1999. Chemokines: extracellular messengers for all occasions?. BioEssays 21:17.[Medline]
  5. Mackay, C. R.. 2001. Chemokines: immunology’s high impact factors. Nat. Immunol. 2:95.[Medline]
  6. Baggiolini, M.. 1998. Chemokines and leukocyte traffic. Nature 392:565.[Medline]
  7. Sallusto, F., A. Lanzavecchia, C. R. Mackay. 1998. Chemokines and chemokine receptors in T-cell priming and Th1/Th2-mediated responses. Immunol. Today 19:568.[Medline]
  8. Moser, B., P. Loetscher. 2001. Lymphocyte traffic control by chemokines. Nat. Immunol. 2:123.[Medline]
  9. Dieu, M. C., B. Vanbervliet, A. Vicari, J. M. Bridon, E. Oldham, S. Ait-Yahia, F. Briere, A. Zlotnik, S. Lebecque, C. Caux. 1998. Selective recruitment of immature and mature dendritic cells by distinct chemokines expressed in different anatomic sites. J. Exp. Med. 188:373.[Abstract/Free Full Text]
  10. Yang, D., O. M. Howard, Q. Chen, J. J. Oppenheim. 1999. Cutting edge: immature dendritic cells generated from monocytes in the presence of TGF-{beta}1 express functional C-C chemokine receptor 6. J. Immunol. 163:1737.[Abstract/Free Full Text]
  11. Tanaka, Y., T. Imai, M. Baba, I. Ishikawa, M. Uehira, H. Nomiyama, O. Yoshie. 1999. Selective expression of liver and activation-regulated chemokine (LARC) in intestinal epithelium in mice and humans. Eur. J. Immunol. 29:633.[Medline]
  12. Liao, F., R. L. Rabin, C. S. Smith, G. Sharma, T. B. Nutman, J. M. Farber. 1999. CC-chemokine receptor 6 is expressed on diverse memory subsets of T cells and determines responsiveness to macrophage inflammatory protein 3{alpha}. J. Immunol. 162:186.[Abstract/Free Full Text]
  13. Rossi, D. L., A. P. Vicari, K. Franz-Bacon, T. K. McClanahan, A. Zlotnik. 1997. Identification through bioinformatics of two new macrophage proinflammatory human chemokines: MIP-3{alpha} and MIP-3{beta}. J. Immunol. 158:1033.[Abstract]
  14. Varona, R., A. Zaballos, J. Gutierrez, P. Martin, F. Roncal, J. P. Albar, C. Ardavin, G. Marquez. 1998. Molecular cloning, functional characterization and mRNA expression analysis of the murine chemokine receptor CCR6 and its specific ligand MIP-3{alpha}. FEBS Lett. 440:188.[Medline]
  15. Krzysiek, R., E. A. Lefevre, J. Bernard, A. Foussat, P. Galanaud, F. Louache, Y. Richard. 2000. Regulation of CCR6 chemokine receptor expression and responsiveness to macrophage inflammatory protein-3{alpha}/CCL20 in human B cells. Blood 96:2338.[Abstract/Free Full Text]
  16. Cook, D. N., D. M. Prosser, R. Forster, J. Zhang, N. A. Kuklin, S. J. Abbondanzo, X. D. Niu, S. C. Chen, D. J. Manfra, M. T. Wiekowski, et al 2000. CCR6 mediates dendritic cell localization, lymphocyte homeostasis, and immune responses in mucosal tissue. Immunity 12:495.[Medline]
  17. Yang, D., O. Chertov, S. N. Bykovskaia, Q. Chen, M. J. Buffo, J. Shogan, M. Anderson, J. M. Schroder, J. M. Wang, O. M. Howard, J. J. Oppenheim. 1999. {beta}-Defensins: linking innate and adaptive immunity through dendritic and T cell CCR6. Science 286:525.[Abstract/Free Full Text]
  18. Baba, M., T. Imai, M. Nishimura, M. Kakizaki, S. Takagi, K. Hieshima, H. Nomiyama, O. Yoshie. 1997. Identification of CCR6, the specific receptor for a novel lymphocyte-directed CC chemokine LARC. J. Biol. Chem. 272:14893.[Abstract/Free Full Text]
  19. Varona, R., R. Villares, L. Carramolino, I. Goya, A. Zaballos, J. Gutierrez, M. Torres, A. C. Martinez, G. Marquez. 2001. CCR6-deficient mice have impaired leukocyte homeostasis and altered contact hypersensitivity and delayed-type hypersensitivity responses. J. Clin. Invest. 107:R37.[Medline]
  20. Clark-Lewis, I.. 2000. Synthesis of chemokines. Methods Mol. Biol. 138:47.[Medline]
  21. Lyons, A. B., C. R. Parish. 1994. Determination of lymphocyte division by flow cytometry. J. Immunol. Methods 171:131.[Medline]
  22. Foulds, K. E., L. A. Zenewicz, D. J. Shedlock, J. Jiang, A. E. Troy, H. Shen. 2002. Cutting edge: CD4 and CD8 T cells are intrinsically different in their proliferative responses. J. Immunol. 168:1528.[Abstract/Free Full Text]
  23. Lyons, A. B.. 2000. Analysing cell division in vivo and in vitro using flow cytometric measurement of CFSE dye dilution. J. Immunol. Methods 243:147.[Medline]
  24. Kennedy, M. K., L. J. Tan, M. C. Dal Canto, V. K. Tuohy, Z. J. Lu, J. L. Trotter, S. D. Miller. 1990. Inhibition of murine relapsing experimental autoimmune encephalomyelitis by immune tolerance to proteolipid protein and its encephalitogenic peptides. J. Immunol. 144:909.[Abstract]
  25. Karpus, W. J., N. W. Lukacs, B. L. McRae, R. M. Strieter, S. L. Kunkel, S. D. Miller. 1995. An important role for the chemokine macrophage inflammatory protein-1{alpha} in the pathogenesis of the T cell-mediated autoimmune disease, experimental autoimmune encephalomyelitis. J. Immunol. 155:5003.[Abstract]
  26. Serafini, B., S. Columba-Cabezas, F. Di Rosa, F. Aloisi. 2000. Intracerebral recruitment and maturation of dendritic cells in the onset and progression of experimental autoimmune encephalomyelitis. Am. J. Pathol. 157:1991.[Abstract/Free Full Text]
  27. Utans-Schneitz, U., H. Lorez, W. E. Klinkert, J. da Silva, W. Lesslauer. 1998. A novel rat CC chemokine, identified by targeted differential display, is upregulated in brain inflammation. J. Neuroimmunol. 92:179.[Medline]
  28. Karpus, W. J., R. M. Ransohoff. 1998. Chemokine regulation of experimental autoimmune encephalomyelitis: temporal and spatial expression patterns govern disease pathogenesis. J. Immunol. 161:2667.[Abstract/Free Full Text]
  29. Fife, B. T., K. J. Kennedy, M. C. Paniagua, N. W. Lukacs, S. L. Kunkel, A. D. Luster, W. J. Karpus. 2001. CXCL10 (IFN-{gamma}-inducible protein-10) control of encephalitogenic CD4+ T cell accumulation in the central nervous system during experimental autoimmune encephalomyelitis. J. Immunol. 166:7617.[Abstract/Free Full Text]
  30. Kennedy, K. J., R. M. Strieter, S. L. Kunkel, N. W. Lukacs, W. J. Karpus. 1998. Acute and relapsing experimental autoimmune encephalomyelitis are regulated by differential expression of the CC chemokines macrophage inflammatory protein-1{alpha} and monocyte chemotactic protein-1. J. Neuroimmunol. 92:98.[Medline]
  31. Godiska, R., D. Chantry, G. N. Dietsch, P. W. Gray. 1995. Chemokine expression in murine experimental allergic encephalomyelitis. J. Neuroimmunol. 58:167.[Medline]
  32. Glabinski, A. R., M. Tani, R. M. Strieter, V. K. Tuohy, R. M. Ransohoff. 1997. Synchronous synthesis of {alpha}- and {beta}-chemokines by cells of diverse lineage in the central nervous system of mice with relapses of chronic experimental autoimmune encephalomyelitis. Am. J. Pathol. 150:617.[Abstract]
  33. Ransohoff, R. M., T. A. Hamilton, M. Tani, M. H. Stoler, H. E. Shick, J. A. Major, M. L. Estes, D. M. Thomas, V. K. Tuohy. 1993. Astrocyte expression of mRNA encoding cytokines IP-10 and JE/MCP-1 in experimental autoimmune encephalomyelitis. FASEB J. 7:592.[Abstract]
  34. Tedla, N., H. W. Wang, H. P. McNeil, N. Di Girolamo, T. Hampartzoumian, D. Wakefield, A. Lloyd. 1998. Regulation of T lymphocyte trafficking into lymph nodes during an immune response by the chemokines macrophage inflammatory protein (MIP)-1{alpha} and MIP-1{beta}. J. Immunol. 161:5663.[Abstract/Free Full Text]
  35. Tedla, N., P. Palladinetti, M. Kelly, R. K. Kumar, N. DiGirolamo, U. Chattophadhay, B. Cooke, P. Truskett, J. Dwyer, D. Wakefield, A. Lloyd. 1996. Chemokines and T lymphocyte recruitment to lymph nodes in HIV infection. Am. J. Pathol. 148:1367.[Abstract]
  36. Tedla, N., P. Palladinetti, D. Wakefield, A. Lloyd. 1999. Abundant expression of chemokines in malignant and infective human lymphadenopathies. Cytokine 11:531.[Medline]
  37. Coates, N. J., S. R. McColl. 2001. Production of chemokines in vivo in response to microbial stimulation. J. Immunol. 166:5176.[Abstract/Free Full Text]
  38. Vanbervliet, B., B. Homey, I. Durand, C. Massacrier, S. Ait-Yahia, O. de Bouteiller, A. Vicari, C. Caux. 2002. Sequential involvement of CCR2 and CCR6 ligands for immature dendritic cell recruitment: possible role at inflamed epithelial surfaces. Eur. J. Immunol. 32:231.[Medline]
  39. Kriehuber, E., S. Breiteneder-Geleff, M. Groeger, A. Soleiman, S. F. Schoppmann, G. Stingl, D. Kerjaschki, D. Maurer. 2001. Isolation and characterization of dermal lymphatic and blood endothelial cells reveal stable and functionally specialized cell lineages. J. Exp. Med. 194:797.[Abstract/Free Full Text]
  40. Luther, S. A., H. L. Tang, P. L. Hyman, A. G. Farr, J. G. Cyster. 2000. Coexpression of the chemokines ELC and SLC by T zone stromal cells and deletion of the ELC gene in the plt/plt mouse. Proc. Natl. Acad. Sci. USA 97:12694.[Abstract/Free Full Text]
  41. Ingulli, E., A. Mondino, A. Khoruts, M. K. Jenkins. 1997. In vivo detection of dendritic cell antigen presentation to CD4+ T cells. J. Exp. Med. 185:2133.[Abstract/Free Full Text]
  42. Lanzavecchia, A., F. Sallusto. 2001. Regulation of T cell immunity by dendritic cells. Cell 106:263.[Medline]
  43. Jenkins, M. K., A. Khoruts, E. Ingulli, D. L. Mueller, S. J. McSorley, R. L. Reinhardt, A. Itano, K. A. Pape. 2001. In vivo activation of antigen-specific CD4 T cells. Annu. Rev. Immunol. 19:23.[Medline]
  44. Liao, F., R. Alderson, J. Su, S. J. Ullrich, B. L. Kreider, J. M. Farber. 1997. STRL22 is a receptor for the CC chemokine MIP-3{alpha}. Biochim. Biophys. Acta 236:212.
  45. Ebert, L. M., S. R. McColl. 2002. Up-regulation of CCR5 and CCR6 on distinct subpopulations of antigen-activated CD4+ T lymphocytes. J. Immunol. 168:65.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
R.-N. E. Dogan, A. Elhofy, and W. J. Karpus
Production of CCL2 by Central Nervous System Cells Regulates Development of Murine Experimental Autoimmune Encephalomyelitis through the Recruitment of TNF- and iNOS-Expressing Macrophages and Myeloid Dendritic Cells
J. Immunol., June 1, 2008; 180(11): 7376 - 7384.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Schiffer, R. Bethunaickan, M. Ramanujam, W. Huang, M. Schiffer, H. Tao, M. M. Madaio, E. P. Bottinger, and A. Davidson
Activated Renal Macrophages Are Markers of Disease Onset and Disease Remission in Lupus Nephritis
J. Immunol., February 1, 2008; 180(3): 1938 - 1947.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J. S. Tzartos, M. A. Friese, M. J. Craner, J. Palace, J. Newcombe, M. M. Esiri, and L. Fugger
Interleukin-17 Production in Central Nervous System-Infiltrating T Cells and Glial Cells Is Associated with Active Disease in Multiple Sclerosis
Am. J. Pathol., January 1, 2008; 172(1): 146 - 155.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Med.Home page
K. Hirota, H. Yoshitomi, M. Hashimoto, S. Maeda, S. Teradaira, N. Sugimoto, T. Yamaguchi, T. Nomura, H. Ito, T. Nakamura, et al.
Preferential recruitment of CCR6-expressing Th17 cells to inflamed joints via CCL20 in rheumatoid arthritis and its animal model
J. Exp. Med., November 26, 2007; 204(12): 2803 - 2812.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Facco, I. Baesso, M. Miorin, M. Bortoli, A. Cabrelle, E. Boscaro, C. Gurrieri, L. Trentin, R. Zambello, F. Calabrese, et al.
Expression and role of CCR6/CCL20 chemokine axis in pulmonary sarcoidosis
J. Leukoc. Biol., October 1, 2007; 8