The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Poynter, M. E.
Right arrow Articles by Janssen-Heininger, Y. M. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Poynter, M. E.
Right arrow Articles by Janssen-Heininger, Y. M. W.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 2003, 170: 6257-6265.
Copyright © 2003 by The American Association of Immunologists

A Prominent Role for Airway Epithelial NF-{kappa}B Activation in Lipopolysaccharide-Induced Airway Inflammation1

Matthew E. Poynter2,*, Charles G. Irvin* and Yvonne M. W. Janssen-Heininger{dagger}

Vermont Lung Center and Departments of * Medicine and {dagger} Pathology, University of Vermont, Burlington, VT 05405


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To reveal the causal role of airway epithelial NF-{kappa}B activation in evoking airway inflammation, a transgenic mouse was created expressing a mutant version of the inhibitory protein I-{kappa}B{alpha}. This I-{kappa}B{alpha} superrepressor (I-{kappa}B{alpha}SR) acts to repress NF-{kappa}B activation exclusively in airway epithelial cells, under the transcriptional control of the rat CC10 promoter (CC10-I-{kappa}B{alpha}SR). Compared with transgene-negative littermates, intranasal instillation of LPS did not induce nuclear translocation of NF-{kappa}B in airway epithelium of CC10-I-{kappa}B{alpha}SR transgenic mice. Consequently, the influx of neutrophils into the airways and secretion of the NF-{kappa}B-regulated neutrophilic chemokine, macrophage-inflammatory protein-2, and the inflammatory cytokine, TNF-{alpha}, were markedly reduced in CC10-I-{kappa}B{alpha}SR mice relative to the transgene-negative mice exposed to LPS. Despite an inability to activate NF-{kappa}B in airway epithelium, resident alveolar macrophages from transgene-positive mice were capable of activating NF-{kappa}B in a manner indistinguishable from transgene-negative mice. These findings demonstrate that airway epithelial cells play a prominent role in orchestrating the airway inflammatory response to LPS and suggest that NF-{kappa}B signaling in these cells is important for modulating innate immune responses to microbial products.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Epithelial cells were once considered to act simply as structural bystanders within the airways. More recently, however, the airway epithelium has become appreciated to serve a number of essential functions within the respiratory tract, as part of the innate immune system (1). For example, examination of bronchial biopsies and isolated airway epithelial cells in culture has revealed that many inflammatory cascades become activated within this cell type (2). These intracellular signaling cascades could lead to the generation of inflammatory responses that aid in the elimination of infectious agents, but that may also contribute to the development of respiratory disease (2, 3). Although anti-inflammatory strategies have been shown to limit inflammation in certain chronic inflammatory lung diseases (i.e., asthma, chronic obstructive pulmonary disease, cystic fibrosis), and delivery of anti-inflammatory mediators via adenoviral gene transfer has been suggested to selectively affect bronchiolar epithelial cells (4), these agents also target other cell types. Consequently, these regimens have failed to unequivocally demonstrate a causal role of airway epithelium in the induction or orchestration of airway inflammation.

Of the many signaling cascades activated by airway epithelium in response to stimulation, NF-{kappa}B has been implicated as one of the most important for the regulation of inflammation (5, 6). NF-{kappa}B becomes activated in response to cytokines, mitogens, physical and oxidative stress, infection, and microbial products (7). NF-{kappa}B activity is tightly controlled by the inhibitory protein, I-{kappa}B{alpha}, that is normally present in the cytosol complexed to NF-{kappa}B dimers, thereby preventing the nuclear localization of NF-{kappa}B and ensuring low basal transcriptional activity. Upon cellular stimulation, I-{kappa}B{alpha} becomes phosphorylated at serines 32 and 36 by the I-{kappa}B kinase (IKK)3 complex. I-{kappa}B{alpha} is subsequently ubiquitinated, and degraded through the 26S proteasome pathway. I-{kappa}B{alpha} degradation exposes the nuclear localization sequence of NF-{kappa}B, allowing its entry into the nucleus, facilitating DNA binding and the transcriptional up-regulation of genes downstream of the {kappa}B motif.

Activation of NF-{kappa}B causes enhanced expression of genes encoding inflammatory cytokines, acute phase proteins, immunoreceptors, and chemokines important in the recruitment of neutrophils, eosinophils, macrophages, and lymphocytes. For example, eotaxin (8), IL-6 (9), IL-8 (10), macrophage-inflammatory protein-2 (MIP-2) (11), GM-CSF (12), inducible NO synthase (13), ICAM-1 (14), cyclooxygenase-2 (15), and TNF-{alpha} (16, 17) all have NF-{kappa}B-binding sequences in their promoter regions, which are critical to their transcriptional activation. Thus, the induction of NF-{kappa}B by proinflammatory stimuli may be a critical signal in evoking an inflammatory response in the lung during the pathogenesis of pulmonary infectious disease and following the inhalation of bacterial products, allergens, particles, and oxidant gases (1). It has recently been demonstrated that airway epithelial NF-{kappa}B activation, induced by adenoviral-mediated gene transfer of constitutively active mutants of IKK, is sufficient to promote neutrophilic airway inflammation, implying that these cells are capable of inducing the expression of genes to initiate an inflammatory signaling cascade (18).

Numerous investigations have implicated a role for NF-{kappa}B in the response to inhaled LPS, a structural component of Gram-negative bacterial cell walls. LPS is capable of activating NF-{kappa}B and induces an inflammatory response in which neutrophils are recruited to the airways (19) to participate in the process of eliminating the bacteria responsible for its production. Activation of NF-{kappa}B in the lung following inhalation of Escherichia coli LPS induces degradation of I-{kappa}B{alpha} and I-{kappa}B{beta} as well as DNA binding of p50- and RelA-containing NF-{kappa}B dimers (20). Studies performed using mice deficient in the NF-{kappa}B subunit RelA have demonstrated that NF-{kappa}B activation is crucial to the initiation of airway inflammation in response to inhaled endotoxin, as pulmonary chemokine and adhesion molecule expression as well as neutrophil inflammation were inhibited in these mice (21). Although resident alveolar macrophages have long been considered to be the major cell type in the lung that is responsive to inhaled LPS (22), it remains unresolved whether the airway epithelium plays a passive or an active role in the response to endotoxin. It has been demonstrated, however, that airway epithelial cells express CD14 and Toll-like receptor 4, which are necessary for the recognition of LPS, and activate NF-{kappa}B in response to LPS stimulation (23).

The objective of the present study was to address the causal role of airway epithelial NF-{kappa}B activation in the initiation of airway inflammation in an experimental model of LPS inhalation. Our approach to address this objective was to generate a transgenic mouse expressing an I-{kappa}B{alpha} mutant, also referred to as I-{kappa}B{alpha} superrepressor (I-{kappa}B{alpha}SR), which is resistant to phosphorylation-induced degradation, thereby preventing NF-{kappa}B activation. By placing this transgene under the transcriptional control of the CC10 promoter, NF-{kappa}B activation was inhibited selectively in airway epithelial cells. Through the use of this new transgenic mouse, we demonstrate that in response to intranasal instillation of LPS, the airway epithelium is an important site of NF-{kappa}B activation and the expression of NF-{kappa}B-dependent inflammatory mediators. Whereas NF-{kappa}B activation in epithelium was impaired, macrophages remained fully responsive to NF-{kappa}B activation evoked by TNF-{alpha} in vitro, illustrating that NF-{kappa}B activation within airway epithelium is necessary to fully induce the recruitment of neutrophils to the airways in response to LPS.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of CC10-I-{kappa}B{alpha}SR transgenic mice

The rat CC10 promoter was obtained as a kind gift from J. Whitsett (Cincinnati Children’s Hospital Medical Center, Cincinnati, OH) (24) and inserted into the HindIII site of pBluescriptII (Stratagene, La Jolla, CA). Orientation of CC10 was confirmed using DraIII diagnostic digests. The human I{kappa}B{alpha}SR, Ser32/36Ala mutant, obtained from P. Baeuerle (Micromet, Martinsried, Germany) (25, 26, 27), was PCR amplified with primers to introduce a 5' SmaI site and a 3' BamHI site using cloned Pfu polymerase (Stratagene, La Jolla, CA). Forward, 5'-cagtcccgggatgttccaggcggccgagcg-3', and reverse, 5'-atcgggatcctcataacgtcagacgctggc-3', primers were synthesized by Operon Technologies (Alameda, CA). Following restriction enzyme digestion, the 963-bp PCR product was inserted into the SmaI/BamHI sites of pBluescript-CC10. Orientation of I-{kappa}B{alpha}SR was confirmed using XhoI diagnostic digests. The human growth hormone polyadenylation sequence (hGHpoly(A)) was excised from p1017 (28) and inserted into the BamHI/NotI sites of pBluescript-CC10-I-{kappa}B{alpha}SR to create pBluescript-CC10-I-{kappa}B{alpha}SR-hGHpoly(A). The I-{kappa}B{alpha}SR was sequenced to verify retention of the Ser32/36Ala mutations following PCR. The CC10-I-{kappa}B{alpha}SR-hGHpoly(A) transgene was excised using SalI and NotI, resolved on a 1% agarose gel, and purified using Elutip-D minicolumns, according to manufacturer’s instructions (Schleicher & Schuell, Keene, NH). The transgene was further purified by three rounds of dialysis against injection buffer (29) using 0.22-µm membranes (Millipore, Bedford, MA) and microinjected into fertilized (C57BL/6 x C3H/HeN)F2 eggs. Transgenic mice were generated, as previously described (29). Transgene integration was analyzed by slot blot using a 502-bp fragment from the human growth hormone sequence. Two transgenic founders were obtained, and lines from these founders were backcrossed for four to five generations into BALB/c mice (The Jackson Laboratory, Bar Harbor, ME) and housed in the University of Vermont Animal Facility. The Institutional Animal Care and Use Committee granted approval for all studies.

Analysis of transgene expression

To obtain alveolar macrophages, bronchoalveolar lavage (BAL) was performed by instillation and recovery of 800 µl of saline five times through a tracheal cannula. BAL cells were collected by centrifugation and determined by staining of cytospin preparations to be >99% macrophages. From these alveolar macrophage preparations or from tissues excised from euthanized mice, RNA was extracted using a modified protocol of Chomczynski (30). RNA was DNase treated and reverse transcribed using random hexamers with SuperScriptII reverse transcriptase, according to manufacturer’s instructions (Life Technologies, Rockville, MD). PCR primers were synthesized (Operon Technologies), and 0.4 µg cDNA was amplified using Platinum PCR Supermix (Life Technologies) for 35 cycles on a PTC-150HB MiniCycler (MJ Research, Incline Village, NV). Controls were performed using nonreverse-transcribed RNA as template, from which no products were detected following PCR. The following primers were used to amplify the transgene: 5'-cacattacaacatcagcccacatc-3' and 5'-ctggttggtgatcacagccaagtg-3', and the housekeeping gene GAPDH: 5'-acgaccccttcattgacctc-3' and 5'-ttcacacccatcacaaacat-3', generating products of 407 and 307 bp, respectively.

Laser capture microdissection (LCM) and real time PCR

An Arcturus Engineering (Mountain View, CA) PixCell II LCM was used to selectively enrich airway or alveolar epithelium (31). Unfixed, frozen lung tissues were sectioned at 10 µm thickness, placed onto uncoated glass slides, and dehydrated through a series of ethanols and xylenes. Dehydrated sections were placed onto the stage of the microdissector system and captured by multiple pulses of the laser (~500). The thermoplastic film of the cap containing the captured cells was then inverted onto a microcentrifuge tube, and total RNA was extracted using a modified method of Chomczynski (30). RNA was DNase treated and reverse transcribed into cDNA using SuperscriptII, according to instructions by the manufacturer (Life Technologies). During TaqMan analysis, copy number of cDNA targets was quantified by the point during cycling when the PCR product was first detected above levels of control samples containing no template by the ABI Prism 7700 Sequence Detection System (Perkin-Elmer, Foster City, CA). Expression of the housekeeping gene, 18S rRNA, was monitored in parallel, using separate reactions, to normalize differences in starting DNA concentration between samples, and is presented as relative expression. Forward (for) and reverse (rev) primers and 6-FAM/BHQ-1 probes (5'-3') for TaqMan PCR were synthesized by Biosearch Technologies (Novato, CA) for the following messages: 18S, for, cggctaccacatccaagga; rev, gagtcctgtattgttatttttcgtcact; probe, cgcgcaaattacccactcccga; I-{kappa}B{alpha}SR, for, aagaaggagcggctactgg; rev, tccttgaccatctgctcgta; probe, cggcctggacgccatgaaa.

Intranasal LPS instillation

Mice anesthetized with 400 mg/kg Avertin (stock solution = 1.6 g/ml 2,2, 2-tribromoethanol in t-amyl alcohol; Sigma-Aldrich, St. Louis, MO; working solution = 20 mg/ml in saline) via i.p. injection were administered 5 µg E. coli 0111:B4 LPS (Sigma-Aldrich) intranasally in 25 µl sterile PBS. Thirty minutes, 1 h, 4 h, or 24 h later, mice were euthanized by a lethal dose of pentobarbital via i.p. injection and cannulated through the trachea with a blunted 16-gauge needle.

Bronchoalveolar lavage (BAL)

BAL fluid was immediately collected from euthanized mice by instillation and recovery of 800 µl 0.9% saline through the tracheal cannula. The BAL fluid was centrifuged, the supernatant was collected. MIP-2 and TNF-{alpha} quantitation was performed by ELISA (R&D Systems, Minneapolis, MN) using undiluted BAL fluid, according to manufacturer’s instructions. The total cells in the pellet were resuspended in PBS and enumerated by counting with a hemocytometer. For cytospins, 2 x 104 cells were centrifuged onto glass slides at 800 rpm. Cytospins were stained using the Hema3 kit (Biochemical Sciences, Swedesboro, NJ), and differential cell counts were performed on 500 cells. For collection of resident alveolar macrophages and their subsequent stimulation, euthanized mice were instilled five times with 1.0 ml 0.9% saline. Pooled BAL fluid was centrifuged at 1200 x g, and resuspended at a density of 1 x 105 cells/ml in RPMI 1640 supplemented with L-glutamine, penicillin/streptomycin, and 10% FBS (Life Technologies). Alveolar macrophages were stimulated with 1 ng/ml murine TNF-{alpha} for 1 h at 37°C. A total of 5 x 104 cells was centrifuged onto glass slides at 800 rpm and fixed with 4% paraformaldehyde for 30 min at 4°C for subsequent immunostaining.

Histological analysis and immunostaining

Following euthanasia (and BAL in the case of RelA staining), the left lobe of the lungs was instilled with 4% paraformaldehyde in PBS (4% paraformaldehyde) for 10 min at a pressure of 25 cm H2O and placed into 4% paraformaldehyde at 4°C overnight for fixation of the tissue. Fixed lungs were then mounted in paraffin, and 7-µm sections were prepared, affixed to glass microscope slides, and prepared for immunostaining by deparaffinizing with xylene and rehydrating through a series of ethanols (31, 32). Sections from unlavaged lungs were stained with H&E, coverslipped, and examined by light microscopy. Alternatively, slides (lung tissue or alveolar macrophages) were permeabilized with 1% Triton X-100 in PBS and blocked three times for 20 min each in PBS containing 1% BSA (PBS/1% BSA). Slides were then incubated with an appropriate dilution of primary Ab recognizing the RelA subunit of NF-{kappa}B (SC-372; Santa Cruz Biotechnology, Santa Cruz, CA). Controls were performed in which isotype-matched nonspecific Ab was substituted for the primary to ensure the specificity of the staining. Following three washes in PBS, slides were incubated with a Cy5-labeled secondary Ab, washed, RNase treated, and counterstained with propidium iodide (PI) to label DNA for nuclear localization. Sections were scanned using an Olympus BX50 upright microscope configured to a Bio-Rad (Hercules, CA) MRX 1000 confocal scanning laser microscope system equipped with a 15-mW mixed-gas krypton-argon laser with excitation wavelengths at 488, 568, and 647 nm. PI staining of nuclei was detected by exciting fluorescence with the 568 laser, whereas Cy5 was detected following excitation with the 647-laser line.

IKK enzyme activity assay

Lungs were lavaged through a tracheal cannula, removed from the mouse, immediately frozen by immersion in liquid nitrogen, and stored at -80°C. Frozen lungs were simultaneously thawed and homogenized in cold Nonidet P-40 immunoprecipitation buffer (0.1% Nonidet P-40, 50 mM HEPES, pH 7.4, 1 mM EDTA, 150 mM NaCl, 2 mM MgCl2, 500 µM DTT, 100 µM NaF, 1% aprotinin, 10 µg/ml leupeptin, 10 mM sodium orthovanadate, and 1 mM PMSF) using a Tissue Tearor mechanical homogenizer (Dremel, Racine, WI). Lysates were centrifuged at 14,000 rpm at 4°C for 10 min, and the supernatants were removed to clean tubes. Following protein quantitation using the Lowrey method (DC Protein Assay; Bio-Rad), the IKK complex was immunoprecipitated from 200 µg total protein using 0.5 µg anti-IKK{gamma} (sc-8330; Santa Cruz Biotechnology) and 35 µl of twice-washed (with Nonidet P-40 immunoprecipitation buffer) protein A agarose beads (Life Technologies) for 90 min at 4°C on a rotating platform. The washed immunoprecipitates were incubated for 20 min at 30°C in 26.5 µl kinase buffer (20 mM HEPES, pH 7.5, 20 mM {beta}-glycerophosphate, 1 mM MnCl2, 5 mM MgCl2, 2 mM NaF, 1 mM DTT, 5 µCi [{gamma}-32P]ATP), with 1.4 µg GST-I-{kappa}B{alpha} (1–54), the substrate for IKK. Incorporation of 32P into the substrate was visualized by autoradiography after loading of proteins onto 15% SDS-polyacrylamide gels and electrophoresis.

Ribonuclease protection assay (RPA)

Following euthanasia and BAL, the right lung lobes were snap frozen in liquid nitrogen. RNA was extracted from frozen lungs using a modified method of Chomczynski (30), and gene expression was assessed qualitatively and quantitatively using the RPA (BD PharMingen, San Jose, CA). Ten micrograms of total lung RNA was hybridized to 32P-labeled probe sets (mCK-5b) and processed according to the manufacturer’s protocol, and hybridized components were separated on a 5% acrylamide gel. Each specific hybridized product migrates according to its size, thereby allowing identification of individual bands that were assigned to specific mRNA products. Band intensities were quantitated by phosphor imaging.

Statistical analysis

Data were analyzed by two-way ANOVA, and Bonferroni correction was used for multiple comparisons. *, p < 0.05; **, p < 0.01. A p value smaller than 0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of CC10-I-{kappa}B{alpha}SR mice

To examine the causal role of airway epithelial NF-{kappa}B activation in pulmonary disease, we generated a mouse in which inducible NF-{kappa}B activation was inhibited specifically in airway epithelial cells. To do so, the rat CC10 promoter was used to drive transgene expression in airway epithelial cells (24). CC10 is a protein expressed specifically by airway epithelial cells (33), and this promoter has been extensively used to direct transgene expression exclusively to these cells (34, 35, 36). We inserted the rat CC10 promoter upstream of a mutant form of the human NF-{kappa}B inhibitor I-{kappa}B{alpha} (25, 26, 27, 37) containing serine->alanine mutations at proteins 32 and 36, which is refractory to IKK-induced phosphorylation and subsequent degradation. This mutated I-{kappa}B{alpha} molecule functions as a potent inhibitor of inducible NF-{kappa}B activation (37). Finally, we provided the intronic and polyadenylation sequences from the human growth hormone gene (28) downstream of the I-{kappa}B{alpha}SR to provide mRNA stability (38). The CC10-I-{kappa}B{alpha}SR transgene construct created is illustrated in Fig. 1A.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 1. Generation of CC10-I-{kappa}B{alpha}SR transgenic mice. To limit expression of I-{kappa}B{alpha}SR (Ser32/36Ala mutant) to airway epithelial cells, the rat CC10 promoter was inserted upstream of the human I-{kappa}B{alpha}SR coding sequence. hGHpoly(A) was placed downstream of the I-{kappa}B{alpha}SR coding sequence to enhance message stability (A). PCR primers were designed to amplify a 407-bp product specific for the transgene, and a 307-bp product for the housekeeping gene GAPDH. PCR was performed on cDNA from lungs, alveolar macrophages, and other tissues from CC10-I-{kappa}B{alpha}SR transgenic mice (B). Laser capture microdissection was used to enrich airway and alveolar epithelium from frozen sections. Abundance of I-{kappa}B{alpha}SR message expression in the captured material was quantitated using real time PCR, and was normalized to the housekeeping gene 18S RNA (C).

 
Lung expression of CC10-I-{kappa}B{alpha}SR transgene

Two lines of CC10-I-{kappa}B{alpha}SR transgenic mice (lines 4 and 22) were generated. Both lines had similar levels of transgene integration, as examined by slot blot analysis (data not shown), and responded similarly in these studies. Transgene-positive animals were maintained as heterozygotes, which exhibited no overt phenotype, and did not demonstrate gross alterations in lung histology compared with transgene-negative littermates (refer to controls in Fig. 5). To assess expression of the transgene, RNA was extracted from tissues and alveolar macrophages of CC10-I-{kappa}B{alpha}SR transgenic mice from each line. cDNA was amplified by PCR to generate a 407-bp product spanning the 3' end of the CC10 promoter, which appends 49 nt onto the mRNA encoding I-{kappa}B{alpha}SR (Fig. 1A). As is demonstrated in Fig. 1B, expression of the transgene was detected only in the lungs of both lines 4 and 22 of CC10-I-{kappa}B{alpha}SR mice. No transgene expression was detected in any other tissue tested, including isolated alveolar macrophages and spleen, which supports published reports that the rat CC10 promoter directs expression exclusively to the lung and not to hemopoietic compartments or cell types (34, 35, 36). To further evaluate the cell types in the lung that express the transgene, we performed LCM from the distal airways or alveolar spaces (31) of CC10-I-{kappa}B{alpha}SR mice. As is shown in Fig. 1C, expression of CC10-I-{kappa}B{alpha}SR was most abundant in the airway epithelial captures, while the expression level in the alveolar epithelium was much lower. These combined results indicate that expression of the CC10-I-{kappa}B{alpha}SR transgene is limited to the airway epithelium.



View larger version (86K):
[in this window]
[in a new window]
 
FIGURE 5. Lung inflammatory response following intranasal instillation of LPS. Paraffin-embedded lung sections were prepared 24 h following intranasal instillation of PBS or LPS to transgene-negative (A and C, respectively) and CC10-I-{kappa}B{alpha}SR mice (B and D, respectively). Sections were stained with H&E and visualized by light microscopy. Short arrows indicate vascular and perivascular inflammatory cells. Long arrows indicate peribronchiolar inflammation. Data are representative of experiments performed twice on four to six mice per group.

 
CC10-I-{kappa}B{alpha}SR mice exhibit reduced airway epithelial NF-{kappa}B activation in response to endotoxin instillation

The I-{kappa}B{alpha}SR inhibits NF-{kappa}B activation induced by the upstream kinase, IKK (25, 26, 27). Because our objective was to evaluate the consequences of inhibiting airway epithelial NF-{kappa}B activation in a model of LPS inhalation, we performed intranasal instillation of LPS or vehicle to transgene-negative mice and measured activation of IKK in whole lung homogenates 30 min later. Results presented in Fig. 2A confirm that intranasal delivery of LPS induces activation of the IKK complex, resulting in a 3-fold increase in phosphorylation of the I-{kappa}B{alpha} substrate in vitro (Fig. 2B). We next confirmed that NF-{kappa}B activation was impaired in the airway epithelium of CC10-I-{kappa}B{alpha}SR mice exposed to inhaled LPS. Because NF-{kappa}B activation is an early event in an LPS-induced inflammatory response, lung sections from mice instilled with LPS 1 h before sacrifice were immunostained using an Ab that recognizes RelA, the transcriptionally active subunit of NF-{kappa}B, and analyzed by confocal microscopy. As was expected, images in Fig. 3 demonstrate a specific and striking localization of RelA (green) in airway epithelium of wild-type mice exposed to intranasal LPS. As we have observed previously, NF-{kappa}B activation also induced increased immunoreactivity of RelA, resulting in enhanced immunofluorescence in the airway epithelium (31). Using PI as a nuclear marker, nuclear translocation of RelA occurred in LPS-exposed transgene-negative mice, evident from the yellow color formation that occurs when the green (RelA) and red (nuclei) colors colocalize. In contrast, following intranasal instillation of LPS to CC10-I-{kappa}B{alpha}SR mice, RelA remained localized to the cytosol of airway epithelial cells and was largely excluded from the nucleus. These results illustrate that NF-{kappa}B activation occurs in the airway epithelium of mice exposed to inhaled LPS and that the CC10-I-{kappa}B{alpha}SR mice effectively repress NF-{kappa}B activation in this cell type.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 2. Activation of IKK by intranasal LPS instillation. The IKK complex was immunoprecipitated from lung homogenates 30 min following intranasal instillation of 5 µg LPS, or PBS as a vehicle control. The immunoprecipitated IKK complex was allowed to phosphorylate the substrate, GST-I-{kappa}B{alpha}, in the presence of [32P]ATP, and the reaction product was resolved on an acrylamide gel. The gel was dried and exposed to film (A) or was phosphor imaged to quantitate band intensities (B).

 


View larger version (177K):
[in this window]
[in a new window]
 
FIGURE 3. Immunolocalization of RelA in airway epithelial cells of mice following intranasal instillation with LPS or PBS. Paraffin-embedded lung sections were prepared 1 h following intranasal instillation of 5 µg LPS, or PBS as a vehicle control, and stained with an Ab directed against RelA (Santa Cruz SC-372), followed by incubation with a Cy5-conjugated secondary Ab (green). PI was used as a nuclear counterstain (red) to evaluate nuclear presence of RelA, in which case green and red merge to create yellow. Sections were scanned by confocal microscopy. Data are representative of results from two separate experiments. Transgene negative = Tg-; CC10-I-{kappa}B{alpha}SR mice = Tg+. Data are representative of experiments performed twice on multiple mice per group.

 
CC10-I-{kappa}B{alpha}SR mice exhibit reduced airway inflammation in response to endotoxin instillation

To assess the functional effects of airway epithelial I-{kappa}B{alpha}SR expression, LPS was delivered to the lungs of transgenic and transgene-negative littermate mice via intranasal instillation. Four hours following LPS instillation, transgene-negative mice exhibited a marked influx of inflammatory cells, preferentially neutrophils, into the airways compared with PBS-instilled controls (Fig. 4). The number of neutrophils was significantly reduced (p < 0.01) in the BAL from LPS-instilled CC10-I-{kappa}B{alpha}SR mice compared with LPS-instilled wild-type mice. The reduced inflammatory response to LPS was observed in CC10-I-{kappa}B{alpha}SR mice from both lines 4 and 22, indicating that this phenotype is due to transgene function rather than site of integration and endogenous gene disruption.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 4. Assessment of neutrophil recruitment into the airways of CC10-I-{kappa}B{alpha}SR mice or transgene-negative littermate controls following the instillation of LPS. Anesthetized transgene-negative (Tg-) and CC10-I-{kappa}B{alpha}SR (Tg+) mice were instilled intranasally with 5 µg LPS in PBS or with PBS alone. Four hours later, BAL was collected and differential cell counts were performed. Values are means from three to six mice per group, with SEM shown by vertical bars. **, p < 0.01 compared with values in PBS-instilled group of corresponding line. ##, p < 0.01 compared with values in LPS-instilled Tg- group of corresponding line.

 
Because a diminished recruitment of neutrophils to the airways was observed, we next analyzed whether inflammatory cells were reduced in the lung tissue from CC10-I-{kappa}B{alpha}SR mice compared with transgene-negative animals 24 h subsequent to intranasal LPS instillation. As is demonstrated in Fig. 5, the gross lung morphology of transgene-negative (A) and CC10-I-{kappa}B{alpha}SR (B) mice was indistinguishable in the control animals. Both the alveolar compartments and the airway epithelium appeared normal in the CC10-I-{kappa}B{alpha}SR mice, and no overt airway epithelial cell defects were observed. In response to LPS instillation, the transgene-negative mice exhibited a marked inflammatory response (C), with prominent neutrophil accumulation occurring in perivascular and peribronchiolar regions, and to a lesser extent in the alveolar compartments. Transgene-negative mice also displayed a distended and thickened bronchiolar epithelium, indicative of its response to the inhaled LPS. In CC10-I-{kappa}B{alpha}SR mice, an overall reduction in the perivascular and peribronchiolar inflammation was observed in response to LPS (D), although some increases in inflammatory cells were apparent in the parenchyma compared with mice instilled with vehicle alone. Moreover, the airway epithelium of CC10-I-{kappa}B{alpha}SR mice did not appear to be thickened subsequent to intranasal LPS instillation, possibly indicative of the reduced responsiveness of CC10-I-{kappa}B{alpha}SR-expressing cells.

CC10-I-{kappa}B{alpha}SR mice exhibit reduced cytokine expression in response to endotoxin instillation

NF-{kappa}B transcriptionally regulates a number of cytokines and chemokines known to play key roles in innate immune responses. Because the CC10-I-{kappa}B{alpha}SR mice exhibited reduced neutrophil recruitment to the lungs in response to LPS instillation, we examined the expression of chemotactic cytokines in the lungs of transgene-negative and CC10-I-{kappa}B{alpha}SR mice. The MIP-2 gene is transcriptionally regulated by NF-{kappa}B and is induced by inflammatory cytokines (39). MIP-2, a rodent analog of human IL-8, is a key chemokine necessary for the recruitment of neutrophils into the lung, which can be produced by epithelial cells and normally plays a role in respiratory tract defenses against a variety of insults (11, 40). As is demonstrated in Fig. 6, transgene-negative mice exhibited marked increases in MIP-2 mRNA expression in response to LPS instillation, whereas CC10-I-{kappa}B{alpha}SR mice exhibited less robust increases in MIP-2 mRNA (Fig. 6A). When expressed relative to levels of the housekeeping gene, L32, MIP-2 mRNA levels in the lungs of transgene-negative mice were increased 4-fold in response to LPS instillation, whereas MIP-2 mRNA expression was not statistically elevated in CC10-I-{kappa}B{alpha}SR mice exposed to LPS (Fig. 6B). In addition, as revealed by the RPA analysis (Fig. 6A), the expression of a number of other chemokines, including MIP-1{beta}, monocyte chemoattractant protein-1, and T cell activation-3, was blunted in CC10-I-{kappa}B{alpha}SR mice instilled with LPS compared with identically treated transgene-negative mice.



View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 6. RPA analysis of chemokine mRNA expression in lungs of mice exposed to inhaled LPS. Anesthetized transgene-negative (Tg-) and CC10-I-{kappa}B{alpha}SR (Tg+) mice were administered LPS in PBS or PBS alone intranasally. Four hours later, lungs were harvested and RNA was extracted for analysis by RPA (A) using a commercial template set (BD PharMingen). Data are representative of results from three separate experiments. Band intensities of MIP-2 and the housekeeping gene L32 were phosphor imaged (B), and values are the means of MIP-2 expression levels relative to L32 from four to five mice, with SEM shown by vertical bars. **, p < 0.01 compared with values in PBS-instilled group. ##, p < 0.01 compared with values in LPS-instilled Tg- group.

 
To confirm that increases in MIP-2 mRNA levels corresponded with increased protein levels, we evaluated MIP-2 in BAL fluid by ELISA. As expected, following intranasal instillation of LPS, protein levels of MIP-2 (Fig. 7A) were elevated in the BAL fluid of transgene-negative mice. In contrast, the levels of MIP-2 recovered in the BAL of CC10-I-{kappa}B{alpha}SR mice were significantly less at both 4 h (p < 0.05) and 24 h (p < 0.01). Furthermore, levels of TNF-{alpha}, a proinflammatory cytokine that activates NF-{kappa}B and amplifies inflammation, were significantly decreased in CC10-I-{kappa}B{alpha}SR mice following LPS instillation compared with transgene-negative controls (Fig. 7B). These results implicate that NF-{kappa}B-dependent gene transcription in airway epithelial cells mediates MIP-2 and TNF-{alpha} production and secretion into the airways of mice exposed to inhaled LPS. However, our data do not rule out the possibility that decreases in MIP-2 observed in CC10-I-{kappa}B{alpha}SR mice are due to the decreased influx of neutrophils to the lung.



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 7. Assessment of chemokine and cytokine levels in BAL fluid of transgene-negative and CC10-I-{kappa}B{alpha}SR mice exposed to inhaled LPS. Anesthetized transgene-negative (Tg-) and CC10-I-{kappa}B{alpha}SR (Tg+) mice were instilled intranasally with 5 µg LPS in PBS or with PBS alone. Four or twenty-four hours later, BAL was collected, and levels of the NF-{kappa}B-regulated neutrophil chemokine, MIP-2 (A), and the inflammatory cytokine, TNF-{alpha} (B), were evaluated by ELISA. Values are means from three to four mice per group, with SEM shown by vertical bars. *, p < 0.05 compared with values in PBS-instilled group at corresponding time following instillation. #, p < 0.05 compared with values in LPS-instilled Tg- group at corresponding time following instillation. ##, p < 0.01 compared with values in LPS-instilled Tg- group at corresponding time following instillation.

 
Normal alveolar macrophage responsiveness in CC10-I-{kappa}B{alpha}SR mice

The activities of alveolar macrophages have been considered to be important for pulmonary responses to inhaled endotoxin (22). Although we could detect no expression of the I-{kappa}B{alpha}SR message in isolated alveolar macrophages, we sought to confirm that the ability to activate NF-{kappa}B in this other resident cell type within the lungs of CC10-I-{kappa}B{alpha}SR mice remained intact. Alveolar macrophages were isolated by BAL from transgene-negative and CC10-I-{kappa}B{alpha}SR mice and stimulated for 1 h with 1 ng/ml TNF-{alpha}, which was abundantly produced by transgene-negative mice subsequent to LPS instillation (Fig. 7B). Although RelA staining was observed in the cytoplasm of alveolar macrophages before stimulation (sham), TNF-{alpha} induced translocation of RelA to the nucleus in both the transgene-negative and CC10-I-{kappa}B{alpha}SR mouse macrophages (Fig. 8). These results indicate the NF-{kappa}B activation in alveolar macrophages is not adversely affected by expression of the I-{kappa}B{alpha}SR transgene in the airway epithelium, transcriptionally regulated by the CC10 promoter. Furthermore, these results support the notion that airway epithelial NF-{kappa}B activation plays a prominent role in the airway inflammatory response induced by inhaled endotoxin.



View larger version (73K):
[in this window]
[in a new window]
 
FIGURE 8. Nuclear localization of RelA in alveolar macrophages following stimulation with TNF-{alpha}. Alveolar macrophages from transgene-negative or CC10-I-{kappa}B{alpha}SR mice were harvested by lavage and exposed to 1 ng TNF-{alpha} in vitro. One hour later, cells were fixed and immunostained for RelA. Images were obtained using confocal microscopy and are representative of studies performed twice from two mice per group.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The epithelium serves an important first line of defense within the airways, and perturbation of these cells by inhaled materials evokes responses that may contribute to the development and maintenance of chronic pulmonary inflammation through the activation of NF-{kappa}B (41). Numerous studies have implicated NF-{kappa}B as an important transcription factor that regulates airway inflammation and that may serve as a therapeutic target for the treatment of acute or chronic pulmonary inflammatory disease states (42). NF-{kappa}B activation has been demonstrated in lung tissue (43, 44, 45, 46) and in cells recovered by BAL (45) in response to endotoxin inhalation. However, direct evidence of airway epithelial NF-{kappa}B activation by LPS was lacking, and had only been described in a rat model of asbestos inhalation (47), in a mouse model of allergic airway inflammation (31, 48, 49), and in patients with asthma (50, 51, 52, 53, 54, 55). These observations, however, failed to implicate a causal role of NF-{kappa}B activation in the inflammatory process associated with these agents. The causal contribution of NF-{kappa}B in inflammation has been addressed in the murine asthma model and LPS-induced systemic inflammation via the use of mice deficient in various subunits of NF-{kappa}B (56, 57, 58), or adenoviruses encoding I-{kappa}B{alpha}SR (18, 59), respectively. Yet, these studies have not provided conclusive evidence to support the importance of NF-{kappa}B activity in specific cell types within the airway, due to the targeting of other cells besides the airway epithelium.

The studies presented in this work are novel and important because of the unique targeting of the inhibition of NF-{kappa}B activities to the airway epithelium without affecting other cells or compartments within the lung. We demonstrate that inhibition of NF-{kappa}B activation targeted to the airway epithelium, using the rat CC10 promoter to drive expression of the I-{kappa}B{alpha}SR, is sufficient to blunt the majority of the lung responsiveness to intranasal LPS instillation. Nuclear translocation of the transcriptionally active RelA subunit of NF-{kappa}B was inhibited in airway epithelium in response to LPS challenge in CC10-I-{kappa}B{alpha}SR-expressing mice, compared with transgene-negative littermates, which was accompanied by reduced neutrophilia, reduced expression of the NF-{kappa}B-regulated chemokine MIP-2, and decreased levels of MIP-2 and TNF-{alpha} in the BAL fluid.

Classically, resident alveolar macrophages were thought to play a critical role in responses to inhaled LPS (22). However, our transgenic model does not affect macrophage responsiveness, as evidenced by their lack of transgene expression and retained capacity to activate NF-{kappa}B following perturbation by TNF-{alpha}. These data suggest that the alveolar macrophage does not play the predominant role in the orchestration of airway neutrophil recruitment. However, the residual inflammation that occurs in CC10-I-{kappa}B{alpha}SR-expressing mice exposed to LPS may be contributed by macrophages, other cell types, or other anatomical compartments, such as alveolar epithelial cells. Furthermore, we cannot rule out that cross-talk between epithelial cells and macrophages may be important in orchestrating responses to inhaled LPS (22). For example, stimulated epithelial cells can secrete soluble factors such as TNF-{alpha}, thereby inducing macrophage activation and the subsequent generation of additional mediators, including cytokines and chemokines, which contribute to the perpetuation of inflammation (60). In fact, TNF-{alpha} is one of the mediators down-regulated in CC10-I-{kappa}B{alpha}SR-expressing mice compared with transgene-negative littermate controls following exposure to LPS. It is also possible that alveolar macrophages are inherently responsive to LPS, but require airway epithelial NF-{kappa}B-dependent gene expression to generate a chemokine gradient to promote neutrophil recruitment to the airways.

We currently can only speculate about the identity of the critical NF-{kappa}B-regulated effectors that mediate the recruitment of neutrophils into airspaces. Lowered levels of the neutrophil chemokine, MIP-2, may in part be responsible for the lack of a chemokine gradient normally responsible for recruiting neutrophils into the airspaces. In addition, NF-{kappa}B also transcriptionally regulates matrix metalloproteinase-9 (61), which is critical for matrix degradation, thereby likely contributing to the trafficking of inflammatory cells into the airways (62). Comprehensive gene expression analysis of airway epithelial cells captured by laser microdissection (31) from transgene-positive and transgene-negative mice exposed to LPS will undoubtedly shed insight into the identity of these and additional target genes. Despite its apparent usefulness (3, 63, 64, 65), especially in the regulation of acute inflammation, additional potential consequences of the failure to activate NF-{kappa}B should be considered when designing strategies to prevent NF-{kappa}B activation for the treatment of chronic pulmonary inflammatory disease states. For example, NF-{kappa}B plays critical roles in cell growth and survival. NF-{kappa}B transcriptionally regulates cyclin D1 (66), a critical gene involved in cellular proliferation, as well as a number of genes involved in protecting cells from apoptotic cell death, including cIAP, X-IAP, Bcl-2, and others (67). Lack of NF-{kappa}B activation may thereby sensitize airway epithelium to apoptosis and have a significant impact on pulmonary remodeling.

Understanding the contribution of specific signaling cascades within individual target cell populations will lead to a better understanding of pathophysiologic disease processes and the mechanisms by which current and novel treatments may work to control such diseases. The use of dominant-negative isoforms of intracellular signaling intermediates in the CC10-expressing cells as reported in this work serves to elucidate the role of airway epithelial cells in pathways important for inflammatory processes.


    Acknowledgments
 
We thank Dr. Mercedes M. Rincon (University of Vermont) for innumerable helpful discussions with experimental design and theory, as well as invaluable assistance with the construction of the transgene and identification of the founders; John Dodge (University of Vermont) for oocyte manipulation and transgene microinjection; Dr. Jeffery Whitsett (Children’s Hospital Medical Center, Cincinnati, OH) for kindly providing us with the CC10 promoter; Dr. Patrick Baeuerle (Micromet) for kindly providing us with the I-{kappa}B{alpha}SR construct; Dr. Pamela Vacek (University of Vermont) for statistical analysis; and Kimberly Ward and Roy Cloots for technical support.


    Footnotes
 
1 M.E.P. was supported by a National Research Service Award Individual Postdoctoral Fellowship and a Senator Proctor Research Fund grant from the American Lung Association of Vermont and the Vermont Department of Health. Y.M.W.J.-H. is supported by National Institutes of Health RO1 HL60014 and Public Health Service P20 RL15557 and PO1 HL67004. C.G.I. is supported by National Institutes of Health/NCRR COBRE P20 RR15557 and NHLBI P01 HL67004. Back

2 Address correspondence and reprint requests to Dr. Matthew E. Poynter, University of Vermont, Department of Medicine, Division of Pulmonary and Critical Care, 149 Beaumont Avenue, HSRF 220, Burlington, VT 05405. E-mail address: matthew.poynter{at}uvm.edu Back

3 Abbreviations used in this paper: IKK, I-{kappa}B kinase; BAL, bronchoalveolar lavage; I-{kappa}B{alpha}SR, I-{kappa}B{alpha} superrepressor; LCM, laser capture microdissection; MIP, macrophage-inflammatory protein; PI, propidium iodide; RPA, ribonuclease protection assay. Back

Received for publication August 19, 2002. Accepted for publication April 2, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Barnes, P. J., K. F. Chung, C. P. Page. 1998. Inflammatory mediators of asthma: an update. Pharmacol. Rev. 50:515.[Abstract/Free Full Text]
  2. Polito, A. J., D. Proud. 1998. Epithelial cells as regulators of airway inflammation. J. Allergy Clin. Immunol. 102:714.[Medline]
  3. Christman, J. W., R. T. Sadikot, T. S. Blackwell. 2000. The role of nuclear factor-{kappa}B in pulmonary diseases. Chest 117:1482.[Abstract/Free Full Text]
  4. Griesenbach, U., P. Scheid, E. Hillery, R. de Martin, L. Huang, D. M. Geddes, E. W. Alton. 2000. Anti-inflammatory gene therapy directed at the airway epithelium. Gene Ther. 7:306.[Medline]
  5. Janssen-Heininger, Y. M., M. E. Poynter, P. A. Baeuerle. 2000. Recent advances towards understanding redox mechanisms in the activation of nuclear factor {kappa}B. Free Radical Biol. Med. 28:1317.[Medline]
  6. Pahl, H. L.. 1999. Activators and target genes of Rel/NF-{kappa}B transcription factors. Oncogene 18:6853.[Medline]
  7. Ghosh, S., M. J. May, E. B. Kopp. 1998. NF-{kappa}B and rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16:225.[Medline]
  8. Hein, H., C. Schluter, R. Kulke, E. Christophers, J. M. Schroder, J. Bartels. 1997. Genomic organization, sequence, and transcriptional regulation of the human eotaxin gene. Biochim. Biophys. Acta 237:537.
  9. Sanceau, J., T. Kaisho, T. Hirano, J. Wietzerbin. 1995. Triggering of the human interleukin-6 gene by interferon-{gamma} and tumor necrosis factor-{alpha} in monocytic cells involves cooperation between interferon regulatory factor-1, NF {kappa}B, and Sp1 transcription factors. J. Biol. Chem. 270:27920.[Abstract/Free Full Text]
  10. Harant, H., R. de Martin, P. J. Andrew, E. Foglar, C. Dittrich, I. J. Lindley. 1996. Synergistic activation of interleukin-8 gene transcription by all-trans-retinoic acid and tumor necrosis factor-{alpha} involves the transcription factor NF-{kappa}B. J. Biol. Chem. 271:26954.[Abstract/Free Full Text]
  11. Driscoll, K. E., D. G. Hassenbein, B. W. Howard, R. J. Isfort, D. Cody, M. H. Tindal, M. Suchanek, J. M. Carter. 1995. Cloning, expression, and functional characterization of rat MIP-2: a neutrophil chemoattractant and epithelial cell mitogen. J. Leukocyte Biol. 58:359.[Abstract]
  12. Dunn, S. M., L. S. Coles, R. K. Lang, S. Gerondakis, M. A. Vadas, M. F. Shannon. 1994. Requirement for nuclear factor (NF)-{kappa}B p65 and NF-interleukin-6 binding elements in the tumor necrosis factor response region of the granulocyte colony-stimulating factor promoter. Blood 83:2469.[Abstract/Free Full Text]
  13. Kleinert, H., C. Euchenhofer, I. Ihrig-Biedert, U. Forstermann. 1996. In murine 3T3 fibroblasts, different second messenger pathways resulting in the induction of NO synthase II (iNOS) converge in the activation of transcription factor NF-{kappa}B. J. Biol. Chem. 271:6039.[Abstract/Free Full Text]
  14. Roebuck, K. A., A. Rahman, V. Lakshminarayanan, K. Janakidevi, A. B. Malik. 1995. H2O2 and tumor necrosis factor-{alpha} activate intercellular adhesion molecule 1 (ICAM-1) gene transcription through distinct cis-regulatory elements within the ICAM-1 promoter. J. Biol. Chem. 270:18966.[Abstract/Free Full Text]
  15. Schmedtje, J. F., Jr, Y. S. Ji, W. L. Liu, R. N. DuBois, M. S. Runge. 1997. Hypoxia induces cyclooxygenase-2 via the NF-{kappa}B p65 transcription factor in human vascular endothelial cells. J. Biol. Chem. 272:601.[Abstract/Free Full Text]
  16. Shakhov, A. N., M. A. Collart, P. Vassalli, S. A. Nedospasov, C. V. Jongeneel. 1990. {kappa}B-type enhancers are involved in lipopolysaccharide-mediated transcriptional activation of the tumor necrosis factor {alpha} gene in primary macrophages. J. Exp. Med. 171:35.[Abstract/Free Full Text]
  17. Collart, M. A., P. Baeuerle, P. Vassalli. 1990. Regulation of tumor necrosis factor {alpha} transcription in macrophages: involvement of four {kappa}B-like motifs and of constitutive and inducible forms of NF-{kappa}B. Mol. Cell. Biol. 10:1498.[Abstract/Free Full Text]
  18. Sadikot, R. T., W. Han, M. B. Everhart, O. Zoia, R. S. Peebles, E. D. Jansen, F. E. Yull, J. W. Christman, T. S. Blackwell. 2003. Selective I{kappa}B kinase expression in airway epithelium generates neutrophilic lung inflammation. J. Immunol. 170:1091.[Abstract/Free Full Text]
  19. Hirano, S.. 1997. Quantitative time-course profiles of bronchoalveolar lavage cells following intratracheal instillation of lipopolysaccharide in mice. Ind. Health 35:353.[Medline]
  20. Mizgerd, J. P., M. L. Scott, M. R. Spieker, C. M. Doerschuk. 2002. Functions of I{kappa}B proteins in inflammatory responses to Escherichia coli LPS in mouse lungs. Am. J. Respir. Cell Mol. Biol. 27:575.[Abstract/Free Full Text]
  21. Alcamo, E., J. P. Mizgerd, B. H. Horwitz, R. Bronson, A. A. Beg, M. Scott, C. M. Doerschuk, R. O. Hynes, D. Baltimore. 2001. Targeted mutation of TNF receptor I rescues the RelA-deficient mouse and reveals a critical role for NF-{kappa}B in leukocyte recruitment. J. Immunol. 167:1592.[Abstract/Free Full Text]
  22. Koay, M. A., X. Gao, M. K. Washington, K. S. Parman, R. T. Sadikot, T. S. Blackwell, J. W. Christman. 2002. Macrophages are necessary for maximal nuclear factor-{kappa}B activation in response to endotoxin. Am. J. Respir. Cell Mol. Biol. 26:572.[Abstract/Free Full Text]
  23. Becker, M. N., G. Diamond, M. W. Verghese, S. H. Randell. 2000. CD14-dependent lipopolysaccharide-induced {beta}-defensin-2 expression in human tracheobronchial epithelium. J. Biol. Chem. 275:29731.[Abstract/Free Full Text]
  24. Stripp, B. R., P. L. Sawaya, D. S. Luse, K. A. Wikenheiser, S. E. Wert, J. A. Huffman, D. L. Lattier, G. Singh, S. L. Katyal, J. A. Whitsett. 1992. cis-Acting elements that confer lung epithelial cell expression of the CC10 gene. J. Biol. Chem. 267:14703.[Abstract/Free Full Text]
  25. Zabel, U., T. Henkel, M. S. Silva, P. A. Baeuerle. 1993. Nuclear uptake control of NF-{kappa}B by MAD-3, an I{kappa}B protein present in the nucleus. EMBO J. 12:201.[Medline]
  26. Henkel, T., U. Zabel, K. van Zee, J. M. Muller, E. Fanning, P. A. Baeuerle. 1992. Intramolecular masking of the nuclear location signal and dimerization domain in the precursor for the p50 NF-{kappa}B subunit. Cell 68:1121.[Medline]
  27. Haskill, S., A. A. Beg, S. M. Tompkins, J. S. Morris, A. D. Yurochko, A. Sampson-Johannes, K. Mondal, P. Ralph, A. S. Baldwin, Jr. 1991. Characterization of an immediate-early gene induced in adherent monocytes that encodes I{kappa}B-like activity. Cell 65:1281.[Medline]
  28. Chaffin, K. E., C. R. Beals, T. M. Wilkie, K. A. Forbush, M. I. Simon, R. M. Perlmutter. 1990. Dissection of thymocyte signaling pathways by in vivo expression of pertussis toxin ADP-ribosyltransferase. EMBO J. 9:3821.[Medline]
  29. Hogan, B., F. Costantini, E. Lacy. 1986. Manipulating the Mouse Embryo: a Laboratory Manual Cold Spring Harbor Laboratory, Cold Spring Harbor.
  30. Chomczynski, P., N. Sacchi. 1987. Single-step method of RNA isolation by guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 72:156.
  31. Poynter, M., C. Irvin, Y. Janssen-Heniniger. 2002. Rapid activation of nuclear factor-{kappa}B in airway epithelium in a murine model of allergic airway inflammation. Am. J. Pathol. 160:1325.[Abstract/Free Full Text]
  32. Poynter, M. E., Y. M. W. Janssen-Heininger, S. Buder-Hoffman, D. J. Taatjes, B. T. Mossman. 1999. Measurement of oxidant-induced signal transduction proteins using cell imaging. Free Radical Biol. Med. 27:1164.[Medline]
  33. Ray, M. K., G. Wang, J. Barrish, M. J. Finegold, F. J. DeMayo. 1996. Immunohistochemical localization of mouse Clara cell 10-KD protein using antibodies raised against the recombinant protein. J. Histochem. Cytochem. 44:919.[Abstract]
  34. Lee, C. G., R. J. Homer, Z. Zhu, S. Lanone, X. Wang, V. Koteliansky, J. M. Shipley, P. Gotwals, P. Noble, Q. Chen, et al 2001. Interleukin-13 induces tissue fibrosis by selectively stimulating and activating transforming growth factor {beta}(1). J. Exp. Med. 194:809.[Abstract/Free Full Text]
  35. Wang, J., R. J. Homer, L. Hong, L. Cohn, C. G. Lee, S. Jung, J. A. Elias. 2000. IL-11 selectively inhibits aeroallergen-induced pulmonary eosinophilia and Th2 cytokine production. J. Immunol. 165:2222.[Abstract/Free Full Text]
  36. Ray, P., W. Tang, P. Wang, R. Homer, C. Kuhn, III, R. A. Flavell, J. A. Elias. 1997. Regulated overexpression of interleukin 11 in the lung: use to dissociate development-dependent and -independent phenotypes. J. Clin. Invest. 100:2501.[Medline]
  37. Hellerbrand, C., C. Jobin, Y. Iimuro, L. Licato, B. Sartor, D. A. Brenner. 1998. Inhibition of NF{kappa}B in activated rat hepatic stellate cells by proteasome inhibitors and an I{kappa}B super-repressor. Hepatology 27:1285.[Medline]
  38. Brinster, R. L., J. M. Allen, R. R. Behringer, R. E. Gelinas, R. D. Palmiter. 1988. Introns increase transcriptional efficiency in transgenic mice. Proc. Natl. Acad. Sci. USA 85:836.[Abstract/Free Full Text]
  39. Widmer, U., K. R. Manogue, A. Cerami, B. Sherry. 1993. Genomic cloning and promoter analysis of macrophage inflammatory protein (MIP)-2, MIP-1{alpha}, and MIP-1{beta}, members of the chemokine superfamily of proinflammatory cytokines. J. Immunol. 150:4996.[Abstract]
  40. Driscoll, K. E.. 1994. Macrophage inflammatory proteins: biology and role in pulmonary inflammation. Exp. Lung Res. 20:473.[Medline]
  41. Hamilton, L. M., D. E. Davies, S. J. Wilson, I. Kimber, R. J. Dearman, S. T. Holgate. 2001. The bronchial epithelium in asthma: much more than a passive barrier. Monaldi Arch. Chest Dis. 56:48.[Medline]
  42. Lee, J. I., G. J. Burckart. 1998. Nuclear factor {kappa}B: important transcription factor and therapeutic target. J. Clin. Pharmacol. 38:981.[Abstract/Free Full Text]
  43. Kang, J. L., H. W. Lee, H. S. Lee, I. S. Pack, Y. Chong, V. Castranova, Y. Koh. 2001. Genistein prevents nuclear factor-{kappa}B activation and acute lung injury induced by lipopolysaccharide. Am. J. Respir. Crit. Care Med. 164:2206.[Abstract/Free Full Text]
  44. Held, H. D., S. Boettcher, L. Hamann, S. Uhlig. 2001. Ventilation-induced chemokine and cytokine release is associated with activation of nuclear factor-{kappa}B and is blocked by steroids. Am. J. Respir. Crit. Care Med. 163:711.[Abstract/Free Full Text]
  45. Blackwell, T. S., L. H. Lancaster, T. R. Blackwell, A. Venkatakrishnan, J. W. Christman. 1999. Differential NF-{kappa}B activation after intratracheal endotoxin. Am. J. Physiol. 277:L823.
  46. Walley, K. R., T. E. McDonald, Y. Higashimoto, S. Hayashi. 1999. Modulation of proinflammatory cytokines by nitric oxide in murine acute lung injury. Am. J. Respir. Crit. Care Med. 160:698.[Abstract/Free Full Text]
  47. Janssen, Y. M. W., K. E. Driscoll, B. Howard, T. R. Quinlan, M. Treadwell, A. Barchowsky, B. T. Mossman. 1997. Asbestos causes translocation of p65 protein and increases NF-{kappa}B DNA binding activity in rat lung epithelial and pleural mesothelial cells. Am. J. Pathol. 151:389.[Abstract]
  48. Bureau, F., S. Delhalle, G. Bonizzi, L. Fievez, S. Dogne, N. Kirschvink, A. Vanderplasschen, M. P. Merville, V. Bours, P. Lekeux. 2000. Mechanisms of persistent NF-{kappa}B activity in the bronchi of an animal model of asthma. J. Immunol. 165:5822.[Abstract/Free Full Text]
  49. Bureau, F., G. Bonizzi, N. Kirschvink, S. Delhalle, D. Desmecht, M. P. Merville, V. Bours, P. Lekeux. 2000. Correlation between nuclear factor-{kappa}B activity in bronchial brushing samples and lung dysfunction in an animal model of asthma. Am. J. Respir. Crit. Care Med. 161:1314.[Abstract/Free Full Text]
  50. Wilson, S. J., A. Wallin, G. Della-Cioppa, T. Sandstrom, S. T. Holgate. 2001. Effects of budesonide and formoterol on NF-{kappa}B, adhesion molecules, and cytokines in asthma. Am. J. Respir. Crit. Care Med. 164:1047.[Abstract/Free Full Text]
  51. Zhao, S., Y. Qi, X. Liu, Q. Jiang, S. Liu, Y. Jiang, Z. Jiang. 2001. Activation of NF-{kappa}B in bronchial epithelial cells from children with asthma. Chin. Med. J. 114:909.[Medline]
  52. Stacey, M. A., G. Sun, G. Vassalli, M. Marini, A. Bellini, S. Mattoli. 1997. The allergen Der p1 induces NF-{kappa}B activation through interference with I{kappa}B{alpha} function in asthmatic bronchial epithelial cells. Biochim. Biophys. Acta 236:522.
  53. Vignola, A. M., G. Chiappara, L. Siena, A. Bruno, R. Gagliardo, A. M. Merendino, B. S. Polla, A. P. Arrigo, G. Bonsignore, J. Bousquet, P. Chanez. 2001. Proliferation and activation of bronchial epithelial cells in corticosteroid-dependent asthma. J. Allergy Clin. Immunol. 108:738.[Medline]
  54. Hart, L., S. Lim, I. Adcock, P. J. Barnes, K. F. Chung. 2000. Effects of inhaled corticosteroid therapy on expression and DNA-binding activity of nuclear factor {kappa}B in asthma. Am. J. Respir. Crit. Care Med. 161:224.[Abstract/Free Full Text]
  55. Hart, L. A., V. L. Krishnan, I. M. Adcock, P. J. Barnes, K. F. Chung. 1998. Activation and localization of transcription factor, nuclear factor-{kappa}B, in asthma. Am. J. Respir. Crit. Care Med. 158:1585.[Abstract/Free Full Text]
  56. Das, J., C. H. Chen, L. Yang, L. Cohn, P. Ray, A. Ray. 2001. A critical role for NF-{kappa}B in GATA3 expression and TH2 differentiation in allergic airway inflammation. Nat. Immun. 2:45.
  57. Donovan, C. E., D. A. Mark, H. Z. He, H. C. Liou, L. Kobzik, Y. Wang, G. T. De Sanctis, D. L. Perkins, P. W. Finn. 1999. NF-{kappa}B/Rel transcription factors: c-Rel promotes airway hyperresponsiveness and allergic pulmonary inflammation. J. Immunol. 163:6827.[Abstract/Free Full Text]
  58. Yang, B. L., L. Cohn, D.-H. Zhang, R. Homer, A. Ray, P. Ray. 1998. Essential role of nuclear factor {kappa}B in the induction of eosinophilia in allergic airway inflammation. J. Exp. Med. 188:1739.[Abstract/Free Full Text]
  59. Blackwell, T. S., F. E. Yull, C. L. Chen, A. Venkatakrishnan, T. R. Blackwell, D. J. Hicks, L. H. Lancaster, J. W. Christman, L. D. Kerr. 2000. Multiorgan nuclear factor {kappa}B activation in a transgenic mouse model of systemic inflammation. Am. J. Respir. Crit. Care Med. 162:1095.[Abstract/Free Full Text]
  60. Martin, L. D., L. G. Rochelle, B. M. Fischer, T. M. Krunkosky, K. B. Adler. 1997. Airway epithelium as an effector of inflammation: molecular regulation of secondary mediators. Eur. Respir. J. 10:2139.[Abstract]
  61. Bond, M., R. P. Fabunmi, A. H. Baker, A. C. Newby. 1998. Synergistic up-regulation of metalloproteinase-9 by growth factors and inflammatory cytokines: an absolute requirement for transcription factor NF-{kappa}B. FEBS Lett. 435:29.[Medline]
  62. Lee, Y. C., H. B. Lee, Y. K. Rhee, C. H. Song. 2001. The involvement of matrix metalloproteinase-9 in airway inflammation of patients with acute asthma. Clin. Exp. Allergy 31:1623.[Medline]
  63. Barnes, P. J., I. M. Adcock. 1997. NF-{kappa}B: a pivotal role in asthma and a new target for therapy. Trends Pharmacol. Sci. 18:46.[Medline]
  64. Chen, F., V. Castranova, X. Shi, L. M. Demers. 1999. New insights into the role of nuclear factor-{kappa}B, a ubiquitous transcription factor in the initiation of diseases. Clin. Chem. 45:7.[Abstract/Free Full Text]
  65. Yamamoto, Y., R. B. Gaynor. 2001. Therapeutic potential of inhibition of the NF-{kappa}B pathway in the treatment of inflammation and cancer. J. Clin. Invest. 107:135.[Medline]
  66. Guttridge, D. C., C. Albanese, J. Y. Reuther, R. G. Pestell, A. S. Baldwin, Jr. 1999. NF-{kappa}B controls cell growth and differentiation through transcriptional regulation of cyclin D1. Mol. Cell. Biol. 19:5785.[Abstract/Free Full Text]
  67. Barkett, M., T. D. Gilmore. 1999. Control of apoptosis by Rel/NF-{kappa}B transcription factors. Oncogene 18:6910.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
U. C. S. Yadav, A. S. Naura, L. Aguilera-Aguirre, K. V. Ramana, I. Boldogh, S. Sur, H. A. Boulares, and S. K. Srivastava
Aldose Reductase Inhibition Suppresses the Expression of Th2 Cytokines and Airway Inflammation in Ovalbumin-Induced Asthma in Mice
J. Immunol., October 1, 2009; 183(7): 4723 - 4732.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. He, Y. Su, P. V. Usatyuk, E. Wm. Spannhake, P. Kogut, J. Solway, V. Natarajan, and Y. Zhao
Lysophosphatidic Acid Enhances Pulmonary Epithelial Barrier Integrity and Protects Endotoxin-induced Epithelial Barrier Disruption and Lung Injury
J. Biol. Chem., September 4, 2009; 284(36): 24123 - 24132.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
C. D. Sommers, J. M. Thompson, J. A. Guzova, S. L. Bonar, R. K. Rader, S. Mathialagan, N. Venkatraman, V. W. Holway, L. E. Kahn, G. Hu, et al.
Novel Tight-Binding Inhibitory Factor-{kappa}B Kinase (IKK-2) Inhibitors Demonstrate Target-Specific Anti-Inflammatory Activities in Cellular Assays and following Oral and Local Delivery in an in Vivo Model of Airway Inflammation
J. Pharmacol. Exp. Ther., August 1, 2009; 330(2): 377 - 388.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W. A. Neveu, J. B. Allard, O. Dienz, M. J. Wargo, G. Ciliberto, L. A. Whittaker, and M. Rincon
IL-6 Is Required for Airway Mucus Production Induced by Inhaled Fungal Allergens
J. Immunol., August 1, 2009; 183(3): 1732 - 1738.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. L. Lindauer, J. Wong, Y. Iwakura, and B. E. Magun
Pulmonary Inflammation Triggered by Ricin Toxin Requires Macrophages and IL-1 Signaling
J. Immunol., July 15, 2009; 183(2): 1419 - 1426.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. W. Aesif, V. Anathy, M. Havermans, A. S. Guala, K. Ckless, D. J. Taatjes, and Y. M.W. Janssen-Heininger
In Situ Analysis of Protein S-Glutathionylation in Lung Tissue Using Glutaredoxin-1-Catalyzed Cysteine Derivatization
Am. J. Pathol., July 1, 2009; 175(1): 36 - 45.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
Y. M. W. Janssen-Heininger and A. van der Vliet
Oxidants Are Not All Created Equal: Could Hydrogen Peroxide Actually Be Good for Our Lungs?
Am. J. Respir. Crit. Care Med., April 15, 2009; 179(8): 627 - 628.
[Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Zhai, Z. Zhong, C.-Y. A. Chen, Z. Xia, L. Song, M. R. Blackburn, and A.-B. Shyu
Coordinated Changes in mRNA Turnover, Translation, and RNA Processing Bodies in Bronchial Epithelial Cells following Inflammatory Stimulation
Mol. Cell. Biol., December 15, 2008; 28(24): 7414 - 7426.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
M. Leiva, A. Ruiz-Bravo, and M. Jimenez-Valera
Effects of Telithromycin in In Vitro and In Vivo Models of Lipopolysaccharide-Induced Airway Inflammation
Chest, July 1, 2008; 134(1): 20 - 29.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. I. Kasahara, M. E. Poynter, Z. Othman, D. Hemenway, and A. van der Vliet
Acrolein Inhalation Suppresses Lipopolysaccharide-Induced Inflammatory Cytokine Production but Does Not Affect Acute Airways Neutrophilia
J. Immunol., July 1, 2008; 181(1): 736 - 745.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
X. Ye, J. Ding, X. Zhou, G. Chen, and S. F. Liu
Divergent roles of endothelial NF-{kappa}B in multiple organ injury and bacterial clearance in mouse models of sepsis
J. Exp. Med., June 9, 2008; 205(6): 1303 - 1315.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. H. Y. Fong, M. Bebien, A. Didierlaurent, R. Nebauer, T. Hussell, D. Broide, M. Karin, and T. Lawrence
An antiinflammatory role for IKK{beta} through the inhibition of "classical" macrophage activation
J. Exp. Med., June 9, 2008; 205(6): 1269 - 1276.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
C. Pantano, J. L. Ather, J. F. Alcorn, M. E. Poynter, A. L. Brown, A. S. Guala, S. L. Beuschel, G. B. Allen, L. A. Whittaker, M. Bevelander, et al.
Nuclear Factor-{kappa}B Activation in Airway Epithelium Induces Inflammation and Hyperresponsiveness
Am. J. Respir. Crit. Care Med., May 1, 2008; 177(9): 959 - 969.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
E. Semaeva, O. Tenstad, A. Bletsa, E.-A. B. Gjerde, and H. Wiig
Isolation of rat trachea interstitial fluid and demonstration of local cytokine production in lipopolysaccharide-induced systemic inflammation
J Appl Physiol, March 1, 2008; 104(3): 809 - 820.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
J. P. Mizgerd
Acute Lower Respiratory Tract Infection
N. Engl. J. Med., February 14, 2008; 358(7): 716 - 727.
[Full Text] [PDF]


Home page
Eur Respir JHome page
A. Haegens, J. H. J. Vernooy, P. Heeringa, B. T. Mossman, and E. F. M. Wouters
Myeloperoxidase modulates lung epithelial responses to pro-inflammatory agents
Eur. Respir. J., February 1, 2008; 31(2): 252 - 260.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Bevelander, J. Mayette, L. A. Whittaker, S. A. Paveglio, C. C. Jones, J. Robbins, D. Hemenway, S. Akira, S. Uematsu, and M. E. Poynter
Nitrogen Dioxide Promotes Allergic Sensitization to Inhaled Antigen
J. Immunol., September 15, 2007; 179(6): 3680 - 3688.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. Elizur, T. L. Adair-Kirk, D. G. Kelley, G. L. Griffin, D. E. deMello, and R. M. Senior
Clara cells impact the pulmonary innate immune response to LPS
Am J Physiol Lung Cell Mol Physiol, August 1, 2007; 293(2): L383 - L392.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. M. Gorska, Q. Liang, S. J. Stafford, N. Goplen, N. Dharajiya, L. Guo, S. Sur, M. Gaestel, and R. Alam
MK2 controls the level of negative feedback in the NF-{kappa}B pathway and is essential for vascular permeability and airway inflammation
J. Exp. Med., July 9, 2007; 204(7): 1637 - 1652.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
K. Ckless, A. van der Vliet, and Y. Janssen-Heininger
Arginase Modulates NF-{kappa}B Activity via a Nitric Oxide-Dependent Mechanism
Am. J. Respir. Cell Mol. Biol., June 1, 2007; 36(6): 645 - 653.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D.-s. Cheng, W. Han, S. M. Chen, T. P. Sherrill, M. Chont, G.-Y. Park, J. R. Sheller, V. V. Polosukhin, J. W. Christman, F. E. Yull, et al.
Airway Epithelium Controls Lung Inflammation and Injury through the NF-{kappa}B Pathway
J. Immunol., May 15, 2007; 178(10): 6504 - 6513.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Haegens, T. F. Barrett, J. Gell, A. Shukla, M. MacPherson, P. Vacek, M. E. Poynter, K. J. Butnor, Y. M. Janssen-Heininger, C. Steele, et al.
Airway Epithelial NF-{kappa}B Activation Modulates Asbestos-Induced Inflammation and Mucin Production In Vivo
J. Immunol., February 1, 2007; 178(3): 1800 - 1808.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. J. Quinton, M. R. Jones, B. T. Simms, M. S. Kogan, B. E. Robson, S. J. Skerrett, and J. P. Mizgerd
Functions and Regulation of NF-{kappa}B RelA during Pneumococcal Pneumonia
J. Immunol., February 1, 2007; 178(3): 1896 - 1903.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. B. Allard, M. E. Poynter, K. A. Marr, L. Cohn, M. Rincon, and L. A. Whittaker
Aspergillus fumigatus Generates an Enhanced Th2-Biased Immune Response in Mice with Defective Cystic Fibrosis Transmembrane Conductance Regulator
J. Immunol., October 15, 2006; 177(8): 5186 - 5194.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
D. Okutani, M. Lodyga, B. Han, and M. Liu
Src protein tyrosine kinase family and acute inflammatory responses
Am J Physiol Lung Cell Mol Physiol, August 1, 2006; 291(2): L129 - L141.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. A. Birrell, S. Wong, E. L. Hardaker, M. C. Catley, K. McCluskie, M. Collins, S. Haj-Yahia, and M. G. Belvisi
I{kappa}B Kinase-2-Independent and -Dependent Inflammation in Airway Disease Models: Relevance of IKK-2 Inhibition to the Clinic
Mol. Pharmacol., June 1, 2006; 69(6): 1791 - 1800.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. T. Sadikot, H. Zeng, M. Joo, M. B. Everhart, T. P. Sherrill, B. Li, D.-s. Cheng, F. E. Yull, J. W. Christman, and T. S. Blackwell
Targeted Immunomodulation of the NF-{kappa}B Pathway in Airway Epithelium Impacts Host Defense against Pseudomonas aeruginosa.
J. Immunol., April 15, 2006; 176(8): 4923 - 4930.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Knapp, S. Florquin, D. T. Golenbock, and T. van der Poll
Pulmonary Lipopolysaccharide (LPS)-Binding Protein Inhibits the LPS-Induced Lung Inflammation In Vivo.
J. Immunol., March 1, 2006; 176(5): 3189 - 3195.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
V. Regueiro, M. A. Campos, J. Pons, S. Alberti, and J. A. Bengoechea
The uptake of a Klebsiella pneumoniae capsule polysaccharide mutant triggers an inflammatory response by human airway epithelial cells
Microbiology, February 1, 2006; 152(2): 555 - 566.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. B. Neff, B. R. Z'graggen, T. A. Neff, M. Jamnicki-Abegg, D. Suter, R. C. Schimmer, C. Booy, H. Joch, T. Pasch, P. A. Ward, et al.
Inflammatory response of tracheobronchial epithelial cells to endotoxin
Am J Physiol Lung Cell Mol Physiol, January 1, 2006; 290(1): L86 - L96.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. R. Jones, B. T. Simms, M. M. Lupa, M. S. Kogan, and J. P. Mizgerd
Lung NF-{kappa}B Activation and Neutrophil Recruitment Require IL-1 and TNF Receptor Signaling during Pneumococcal Pneumonia
J. Immunol., December 1, 2005; 175(11): 7530 - 7535.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Noulin, V. F. J. Quesniaux, S. Schnyder-Candrian, B. Schnyder, I. Maillet, T. Robert, B. B. Vargaftig, B. Ryffel, and I. Couillin
Both Hemopoietic and Resident Cells Are Required for MyD88-Dependent Pulmonary Inflammatory Response to Inhaled Endotoxin
J. Immunol., November 15, 2005; 175(10): 6861 - 6869.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. M. Hajjar, H. Harowicz, H. D. Liggitt, P. J. Fink, C. B. Wilson, and S. J. Skerrett
An Essential Role for Non-Bone Marrow-Derived Cells in Control of Pseudomonas aeruginosa Pneumonia
Am. J. Respir. Cell Mol. Biol., November 1, 2005; 33(5): 470 - 475.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. Wang, F. Gigliotti, S. Maggirwar, C. Johnston, J. N. Finkelstein, and T. W. Wright
Pneumocystis carinii Activates the NF-{kappa}B Signaling Pathway in Alveolar Epithelial Cells
Infect. Immun., May 1, 2005; 73(5): 2766 - 2777.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. E. Poynter, R. Cloots, T. van Woerkom, K. J. Butnor, P. Vacek, D. J. Taatjes, C. G. Irvin, and Y. M. W. Janssen-Heininger
NF-{kappa}B Activation in Airways Modulates Allergic Inflammation but Not Hyperresponsiveness
J. Immunol., December 1, 2004; 173(11): 7003 - 7009.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
C.C. dos Santos, B. Han, C.F. Andrade, X. Bai, S. Uhlig, R. Hubmayr, M. Tsang, M. Lodyga, S. Keshavjee, A.S. Slutsky, et al.
DNA microarray analysis of gene expression in alveolar epithelial cells in response to TNF{alpha}, LPS, and cyclic stretch
Physiol Genomics, November 17, 2004; 19(3): 331 - 342.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
J. Hjoberg, S. Shore, L. Kobzik, S. Okinaga, A. Hallock, J. Vallone, V. Subramaniam, G. T. De Sanctis, J. A. Elias, J. M. Drazen, et al.
Expression of nitric oxide synthase-2 in the lungs decreases airway resistance and responsiveness
J Appl Physiol, July 1, 2004; 97(1): 249 - 259.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. J. Skerrett, H. D. Liggitt, A. M. Hajjar, R. K. Ernst, S. I. Miller, and C. B. Wilson
Respiratory epithelial cells regulate lung inflammation in response to inhaled endotoxin
Am J Physiol Lung Cell Mol Physiol, July 1, 2004; 287(1): L143 - L152.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. Zou, J. N. Rao, X. Guo, L. Liu, H. M. Zhang, E. D. Strauch, B. L. Bass, and J.-Y. Wang
NF-{kappa}B-mediated IAP expression induces resistance of intestinal epithelial cells to apoptosis after polyamine depletion
Am J Physiol Cell Physiol, May 1, 2004; 286(5): C1009 - C1018.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Diehl, T. Krahl, L. Rinaldi, R. Norton, C. G. Irvin, and M. Rincon
Inhibition of NFAT Specifically in T Cells Prevents Allergic Pulmonary Inflammation
J. Immunol., March 15, 2004; 172(6): 3597 - 3603.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
T. Okamoto, K. Gohil, E. I. Finkelstein, P. Bove, T. Akaike, and A. van der Vliet
Multiple contributing roles for NOS2 in LPS-induced acute airway inflammation in mice
Am J Physiol Lung Cell Mol Physiol, January 1, 2004; 286(1): L198 - L209.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Poynter, M. E.
Right arrow Articles by Janssen-Heininger, Y. M. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Poynter, M. E.
Right arrow Articles by Janssen-Heininger, Y. M. W.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS