The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sharfe, N.
Right arrow Articles by Roifman, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sharfe, N.
Right arrow Articles by Roifman, C. M.
The Journal of Immunology, 2003, 170: 6024-6032.
Copyright © 2003 by The American Association of Immunologists

Ephrin-A1 Induces c-Cbl Phosphorylation and EphA Receptor Down-Regulation in T Cells1

Nigel Sharfe2, Andrew Freywald2, Ana Toro and Chaim M. Roifman3

Immunology and Allergy, Department of Pediatrics, Infection, Immunity, Injury, and Repair Program, Research Institute, Hospital for Sick Children, and University of Toronto, Toronto, Canada


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Eph receptor tyrosine kinases are expressed by T lineage cells, and stimulation with their ligands, the ephrins, has recently been shown to modulate T cell behavior. We show that ephrin-A1 stimulation of Jurkat T cells induces tyrosine phosphorylation of EphA3 receptors and cytoplasmic proteins, including the c-cbl proto-oncogene. Cbl phosphorylation was also observed in peripheral blood T cells. In contrast, stimulation of Jurkat cells with the EphB receptor ligand ephrin-B1 does not cause Cbl phosphorylation. EphA activation also induced Cbl association with Crk-L and Crk-II adapters, but not the related Grb2 protein. Induction of Cbl phosphorylation upon EphA activation appeared to be dependent upon Src family kinase activity, as Cbl phosphorylation was selectively abrogated by the Src family inhibitor 4-amino-5(4-chlorophenyl-7-(tert-butyl)pyrazolo[3,4-d]pyrimidine, while EphA phosphorylation was unimpaired. Ephrin-A1 stimulation of Jurkat cells was also found to cause down-regulation of endogenous EphA3 receptors from the cell surface and their degradation. In accordance with the role of Cbl as a negative regulator of receptor tyrosine kinases, overexpression of wild-type Cbl, but not its 70-Z mutant, was found to down-regulate EphA receptor expression. Receptor down-regulation could also be inhibited by blockage of Src family kinase activity. Our findings show that EphA receptors can actively signal in T cells, and that Cbl performs multiple roles in this signaling pathway, functioning to transduce signals from the receptors as well as regulating activated EphA receptor expression.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Eph receptor tyrosine kinases and their ligands, the ephrins, play an important role in regulating cell migration and targeting in the neuronal system and during embryonic development (1, 2). Eph receptors have been shown to generate adhesive or repulsive signals, guiding axonal growth cones and cell migration and regulating the formation of synapses (1, 3). Recently, Eph receptor expression has been reported in cells of the immune system (4, 5, 6), and the first reports examining their function and potential roles have begun to appear. Ephs were recently shown to regulate platelet aggregation (7) and to modulate both thymocyte and T cell apoptosis (8, 9), while B lymphocytes have been demonstrated to secrete soluble forms of ephrin-A4 upon activation (5). Most recently, activation of the EphB6 receptor in T cells has been shown to selectively inhibit TCR-mediated activation of the c-Jun N-terminal kinase pathway (10). Activation of Eph receptors has also been shown to modulate the migration of T cells in response to a chemokine stimulus (11).

The Ephs form the largest known family of receptor tyrosine kinases (RTK),4 with 14 members (1, 2), and are complemented by nine ligands, known as ephrins (Eph family receptor interacting) (2, 12). The ephrins themselves are membrane-associated proteins, anchored by either a glycosylphosphatidylinositol linkage (ephrin-A1 to -A6) or a trans-membrane domain (ephrin-B1 to -B3). Monomeric soluble forms of the ephrins are inactive, most likely due to a failure to form multimeric complexes, as artificially dimerized soluble ephrins are active and can induce Eph signaling responses (13, 14). The Ephs are categorized as EphA or EphB, according to the class of ephrin bound. Receptor-ligand interaction is degenerate within each group, each Eph receptor binding many, if not all, of the ephrins (2, 12). All the Eph receptors, except EphB6, are catalytically active tyrosine kinases (6, 15), undergoing autophosphorylation and initiating signaling cascades. Recently, cross-talk between Eph receptors and the formation of stable complexes between different members of the Eph family have also been described (16).

The signal transduction pathways downstream of the Ephs remain far from fully characterized. Eph receptor activation occurs as the result of ligand-induced oligomerization and subsequent autophosphorylation, and a number of signaling proteins molecules have been shown to bind phosphorylated Eph tyrosine residues. These include the Grb2, Nck, and Src-like protein adapters; Src and Fyn kinases; and the lipid-modifying enzymes phosphoinositol 3-kinase (PI3-kinase) and phospholipase C (12), although in many cases their function is unclear. Ephs have also been shown to be negative regulators of mitogen-activated protein kinase (MAPK) activation (17, 18). These investigations into Eph signaling have been performed almost exclusively with in vitro assays or in neuronal and endothelial cells, and little is known of Eph receptor signaling in lymphoid cells.

To address EphA receptor signaling in T cells we examined the signaling events resulting from ephrin-A stimulation of the Jurkat T cell line. Jurkat cells demonstrate strong binding of ephrin-A ligands and, according to RT-PCR analysis, predominantly express the EphA1 and EphA3 receptors. We show here that EphA receptor activation, but not EphB receptor activation, induces rapid tyrosine phosphorylation of the c-cbl proto-oncogene in Jurkat cells. Inducible Cbl phosphorylation was also observed in peripheral blood T cells, which selectively express EphA1 and EphA4 receptors. EphA receptor activation also found to alter Cbl interactions with the signal transduction adapters Crk-L and Crk-II, but not the related Grb2 protein. Induction of Cbl phosphorylation upon ephrin-A stimulation, but not Eph receptor activation, was found to be specifically abrogated by the Src family inhibitor 4-amino-5(4-chlorophenyl)-7-(tert-butyl)pyrazolo[3,4-d]pyrimidine (PP2), suggesting that Src family kinases may play a role in RTK-mediated activation of Cbl.

c-Cbl is a member of a family of related scaffold proteins (sli-1, d-Cbl, c-Cbl, Cbl-b, and Cbl-3) (19, 20) and undergoes tyrosine phosphorylation in response to activation of a number of receptors, including the epidermal growth factor (EGF) and platelet-derived growth factor (PDGF) tyrosine kinase receptors (21, 22). Upon activation, c-Cbl can associate with a variety of signaling molecules, including the tyrosine kinases Zap-70, Syk, and Src family kinases; the adapter proteins Crk, Shc, and Grb2; and effectors such as p85 PI3-kinase and Vav (19, 20, 23, 24). The function of Cbl in these complexes remains ambiguous, but it is suggested to act as a scaffold, serving to juxtapose these disparate signaling molecules.

Cbl can also induce physical down-regulation of activated EGF, PDGF, and CSF receptors from the plasma membrane through induction of receptor ubiquitination, targeting them for internalization (19, 25, 26, 27). This activity is derived from its Ring finger domain, an E3 ubiquitin-ligase (28, 29). This appears to form a negative feedback loop regulating the intensity and duration of receptor signaling. In accordance with the known properties of Cbl as a regulator of RTKs, we show here that cell surface expression of endogenous EphA receptor decreases following ephrin-A1 stimulation of Jurkat cells, and proteasome-dependent degradation of the EphA3 receptor is observed. EphA4 receptor expression could also be down-regulated in transfected cells by overexpression of wild-type Cbl, but not of a ubiquitin-ligase inactive 70-Z Cbl protein.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Abs and recombinant proteins

Monoclonal anti-phosphotyrosine was obtained from Upstate Biotechnology (Lake Placid, NY). Abs to Cbl, Crk-L, Crk-II, Grb2, Myc, and Fyn were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Ephrin-human Fc chimeric fusion proteins were purchased from R&D Systems (Minneapolis, MN). Purified human IgG was purchased from Serotec (Oxford, U.K.).

Cell lines and isolation of T lymphocytes

The mature T cell line Jurkat was grown in complete RPMI-10 medium. PBL were purified from fresh peripheral blood by centrifugation on Ficoll and were cultured with PHA and IL-2 for 3 days in complete RPMI-10 medium before transfer to RPMI-10 with IL-2. Suspension cells were collected after 6–8 days of culture. The resultant T cell lymphocytes are typically >95% CD3+.

RT-PCR analysis

Total RNA was purified using RNAeasy (Qiagen, Valencia, CA). First-strand cDNA was made with random primer and Superscript II (Invitrogen, San Diego, CA). The following primer pairs were used for analysis of Eph receptor expression, creating PCR products each of ~400 bp: EphA1, gaagcttcaggcacatctggag and ccttgaatccctgaatactgcaaag; EphA2, ctttgacccccgcgtgtctatc and gatggggatccccacagtgttc; EphA3, cagtgcagccgcaaggccatc and cacgggaactgggccattctttg; EphA4, cggagagctccagacctaacac and gacgggaaccattctgccgtgc; and EphA7, ggaacttgtagtaggccaataagc and cacacttgaatgccagttccatg. PCRs were performed with the cycle conditions 94°C for 30 s, 60°C for 30 s, and 68°C for 45 s for 35 cycles.

T cell stimulation

Soluble ephrin-Fc fusion proteins (dimerized) were precomplexed by incubation on ice with F(ab)'2 goat anti-human Fc (Pierce, Rockford, IL) to form soluble oligomers. F(ab)'2 goat anti-human Fc was used as a control where necessary. Irrelevant Fc-fusion protein or purified human IgG were used as specificity controls.

Pull-down assays, immunoprecipitation, and Western blotting and kinase assays

For immunoprecipitation, cells were resuspended in ice-cold 1% Triton lysis buffer consisting of 10 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, and 1 mM sodium orthovanadate. Abs and protein G-Sepharose were added to cleared lysates and incubated at 4°C overnight. For ligand pull-down assays, cells were incubated on ice for 30 min with the ephrin-Fc ligands before transfer to 37°C for the indicated times. Triton X-100 was replaced with 1% IGA-230, and ligand was precipitated by addition of protein G-Sepharose beads. Samples were separated by SDS-PAGE and transferred to nitrocellulose membrane, and immunoblotting Abs were added in PBS, 0.1% Tween 20. Bound Abs were detected using HRP-conjugated Abs and chemiluminescent reagents. All experiments were repeated at least three times.

Transfection

293T cells were transiently transfected with Myc-tagged EphA4 (0.2 µg), Cbl, and 70-Z Cbl (2 µg each) cDNA in pcDNA3 vector as indicated using Lipofectamine (Invitrogen). The amounts of transfected DNA were equalized with empty pcDNA3. Cells were harvested after 48 h.

Eph receptor down-regulation assays

Jurkat cells (5 x 105) in serum-free RPMI were incubated at 37°C with a saturating concentration of ephrin-A1-Fc (10 µg/ml) or control IgG protein for 30 min. Cells were stripped of bound ligand by acid wash with RPMI (pH 3.0) for 30 s and washed three times in ice-cold complete RPMI-10 before resuspension in cold PBS. Cells were stained with 10 µg/ml ephrin-A1-Fc for 1 h on ice, washed three times in PBS, and incubated on ice with PE-labeled anti-Fc. Bound ligand was detected by flow cytometry. To further analyze changes in cells expressing the highest EphA levels, the 25% most intensely ephrin-A1-staining cells were gated and analyzed in parallel to the total population. In some experiments cells were preincubated with the Src family inhibitor PP2 (5 µM) or the inactive analog PP3 at 37°C.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Ephrin-A stimulates EphA receptor activation and tyrosine phosphorylation in T cells

RT-PCR analysis of Jurkat T cells demonstrated the presence of mRNA for EphA1, EphA2, and EphA3 receptors (Fig. 1A), while analysis of purified peripheral blood T cells (PBL-T) revealed preferential expression of EphA1 and EphA4. Incubation of both Jurkat cells and PBL-T on ice with soluble ephrin-A-Fc chimeric protein, followed by staining with FITC-labeled anti-Fc to detect bound ligand, revealed strong staining with ephrin-A1 to -A5 upon flow cytometric analysis (not shown), demonstrating the expression of functional EphA receptors at the cell surface.



View larger version (54K):
[in this window]
[in a new window]
  		FIGURE 1. Ephrin-A stimulation induces tyrosine phosphorylation in Jurkat cells. A, EphA receptor expression by Jurkat T cells and purified PBL-T (from three unrelated individuals) was examined by RT-PCR analysis in parallel with HEK-293, which expresses all the EphA receptors examined. One representative experiment of three is shown. B, Jurkat cells (1 x 106) were stimulated with 1 µg/ml oligomeric ephrin-1 or ephrin-A3 as indicated at 37°C for 10 min, and total cell lysates were Western blotted with anti-phosphotyrosine. Loading was controlled by reblotting with anti-Gi{alpha}. Right panel, Jurkat cells were stimulated with 1 µg/ml ephrin-A1 for the indicated periods of time, and total cell lysates were Western blotted with anti-phosphotyrosine. One representative experiment of four is shown.

 
To examine EphA receptor signaling, Jurkat cells were stimulated with oligomeric ephrin-A1 or ephrin-A3 for 15 min at 37°C. This resulted in the appearance of a strongly phosphorylated band of ~125 kDa in anti-phosphotyrosine blots of total cell lysates and minor bands of 100 and 65 kDa (Fig. 1B). Control stimulations with IgG did not induce tyrosine phosphorylation (not shown). Members of the ephrin-A subclass demonstrate highly degenerate binding to EphA receptors (1, 2), and therefore, the similarity of responses to ephrin-A1 and ephrin-A3 was not unexpected. The dominant phosphorylated 125-kDa band appeared to represent ligand-induced EphA receptor phosphorylation, being of approximately the expected m.w. to be a member of the EphA subfamily (1, 2). The p125 phosphorylation was induced rapidly, was maximal after 10–15 min, and declined to a near basal level by 60 min (Fig. 1B, right panel). In the absence of Abs capable of immunoprecipitating many EphA receptors, it is difficult to examine endogenous receptor activation. However, we used the previously demonstrated ability of ephrin-A ligands to pull-down EphA receptors under permissive lysis conditions (18). Cells were incubated on ice with ephrin-A1 or control proteins before transfer to 37°C for 15 min. Cells were then solubilized in Nonidet P-40 lysis buffer, and the ligand-receptor complex was pulled-down by addition of protein G-Sepharose beads. Ephrin-A1, but not control proteins, specifically precipitated the 125-kDa phosphoprotein (Fig. 2A), suggesting that this was indeed EphA receptor. RT-PCR analysis of Eph expression in Jurkat cells revealed messages for EphA1 and EphA3, and Western blotting demonstrated that the 125-kDa phosphoprotein was recognized by Abs to EphA3 (Fig. 2B). EphA1 was not detected in ephrin-A1 pull-downs despite attempts to Western blot with several different Abs to the receptor. However, as Ephs may act as heteroreceptor complexes, we cannot rule out the possibility that EphA1 is present, but undetectable due to the limited sensitivity of the assay. In accordance with the degeneracy of ephrin-A binding to EphA receptors, the 125-kDa EphA3 receptor could be specifically precipitated by all the ephrin-A ligands examined (not shown). All the EphA receptors are reported to be catalytically active tyrosine kinases (2), and in vitro kinase assays performed with ephrin-A pull-downs revealed strong phosphorylation of the 125-kDa protein consistent with autophosphorylation (Fig. 2C).



View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 2. Jurkat cells express active EphA3 receptor. A and B, Jurkat cells (107) were incubated with 1 µg/ml ephrin-A1-Fc or control proteins on ice for 30 min before transfer to 37°C for 15 min. Cells were then lysed in Nonidet P-40 lysis buffer, and the Fc ligand was precipitated by addition of protein G-Sepharose. Fc ligand pull-downs were Western blotted with anti-phosphotyrosine to detect the phosphorylated protein or anti-EphA3 or anti-EphA1 as indicated. IgG, purified human immunoglobulin; Fc, Fc, anti-human Fc F(ab)2; A1, ephrin-A1-Fc; FGF, fibroblast growth factor receptor-Fc. C, Ligand pull-downs were washed with kinase assay buffer before addition of 10 µCi of [{gamma}-33P]ATP and transfer to 37°C for 20 min. SDS-PAGE-separated samples were exposed to film. All experiments were repeated three times.

 
Ephrin-A stimulation induces c-Cbl phosphorylation

There were several candidates for the 100-kDa phosphorylated protein observed in ephrin-A1-stimulated total cell lysates. One of them, Cas, lies downstream of EphA receptors in NIH-3T3 cells (30). Although Cas undergoes ephrin-A1-inducible tyrosine phosphorylation in 3T3 cells, Cas phosphorylation was not detected upon ephrin-A1 stimulation of Jurkat (not shown). A second candidate was the proto-oncogene c-cbl. Many receptor tyrosine kinases, such as the EGF and PDGF receptors, activate c-Cbl through phosphorylation (22). Immunoprecipitation of Cbl revealed a rapid induction of tyrosine phosphorylation upon ephrin-A1 stimulation (Fig. 3A). Cbl phosphorylation could be detected within 30 s (not shown), peaking at levels 2- to 3-fold higher than basal at 10 min. Similar levels of Cbl phosphorylation (1.5- to 2.5-fold increase) could also be induced by ephrin-A2 and ephrin-A3 (Fig. 3B). Cbl phosphorylation was not, however, altered in response to stimulation with ephrin-B1 (Fig. 3C), although Jurkat express mRNA for multiple EphB receptors (EphB1–4 and 6, not shown).



View larger version (38K):
[in this window]
[in a new window]
  		FIGURE 3. Ephrin-A stimulation induces Cbl phosphorylation. A, Jurkat cells (107) were stimulated with 1 µg/ml ephrin-A1-Fc for the indicated times. Cbl was immunoprecipitated from cell lysates in 1% Triton and blotted with anti-phosphotyrosine. Loading was controlled by reblotting with anti-Cbl. B, Cells were stimulated with ephrin-A1 to -A3 as indicated and analyzed as described in A. C, Jurkat cells were stimulated with ephrin-B1 for 10 min, and Cbl phosphorylation was examined as described in A. All experiments were repeated at least three times. D, PBL-T (5 x 106) from two unrelated individuals were stimulated with 1 µg/ml ephrin-A1 for the indicated times, and Cbl phosphorylation was examined as described in A. Matching lysates were blotted with anti-Cbl to control protein loading.

 
To determine whether ephrin-A1-induced Cbl phosphorylation was restricted to cell lines or could also occur in primary T cells, we examined whether ephrin-A1 could stimulate Cbl phosphorylation in PBL-T. RT-PCR analysis of EphA receptors in PBL-T revealed preferential expression of EphA1 and EphA4, rather than the EphA1 and EphA3 observed in the mature T cell line Jurkat (Fig. 1A). However, ephrin-A1 stimulation similarly resulted in c-Cbl phosphorylation (Fig. 3D). Induction of Cbl phosphorylation was lower in primary T cells (consistently a 1.5-fold increase by densitometry) than in Jurkat cells, but this was probably due to a lower level of EphA receptor expression on primary T cells (as assessed by flow cytometry, not shown). Whether EphA1, commonly expressed by Jurkat and PBL-T, is alone responsible for activating Cbl, or whether many EphA receptors induce Cbl phosphorylation remains to be determined.

Src family kinase inhibitor, PP2, blocks EphA-mediated Cbl phosphorylation, but not EphA activation

Cbl phosphorylation in hemopoietic cells often appears to result from activation of soluble cytoplasmic kinases, most particularly members of the Src family (31, 32, 33). We therefore examined whether Src kinases might play a role in EphA receptor-induced Cbl phosphorylation.

Interaction between the T cell Src family kinase Fyn and Cbl is well described in response to Ag receptor and cytokine stimuli. Fyn has been shown to bind Cbl both through its SH3 domain and in a phosphorylation-dependent manner via its SH2 domain. Anti-phosphotyrosine blotting of Fyn immunoprecipitates from ephrin-A1-stimulated Jurkat cells revealed increased association of a 100-kDa Cbl-like phosphoprotein (Fig. 4A), although reblotting with anti-Cbl was unable to unambiguously confirm the identity of the protein as Cbl. Fyn catalytic activity was also found to increase upon ephrin-A1 stimulation (not shown), suggesting that Fyn could indeed play a role in phosphorylation of proteins downstream of the activated EphA receptor. A role for Src family kinases in Cbl activation was further suggested when pretreatment of Jurkat T cells with the Src family-specific kinase inhibitor PP2, but not its inactive analog PP3, was found to inhibit ephrin-A1-induced Cbl phosphorylation (Fig. 4B). PP2 is reported to be a highly specific inhibitor of Src family members (34), and EphA phosphorylation, resulting predominantly from autophosphorylation, was unaltered in its presence (Fig. 4B, right panel), confirming the specificity of PP2. This inhibition of Cbl phosphorylation was specific to PP2, as neither PP3, the Syk family inhibitor piceatannol, nor the MAPK kinase kinase inhibitor PD 98059 affected the induction of Cbl phosphorylation (Fig. 4C), suggesting that Src family kinases are indeed involved in ephrin-A1-induced Cbl phosphorylation.



View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 4. The Src family kinase inhibitor PP2 blocks Cbl phosphorylation. A, Jurkat cells were stimulated with ephrin-A1 for the indicated times. Anti-Fyn immunoprecipitates were Western blotted with anti-phosphotyrosine and subsequently with anti-Fyn. B, Jurkat cells (107) were pretreated with the Src kinase inhibitor PP2 or its inactive analog PP3. Cells were incubated at 37°C for 30 min with PP2 or PP3 (5 µM) before addition of ephrin-A1 for an additional 10 min. Cbl phosphorylation was examined as in Fig. 3A. Right panel, Jurkat cells were pretreated with PP2 or PP3. Fc ligand pull-downs from treated cells were blotted with anti-phosphotyrosine. Matching lysates were blotted with anti-Gi{alpha} to control protein loading. C, Jurkat cells were pretreated with Src kinase inhibitor PP2 (5 µM), PP3 (5 µM), the Syk family inhibitor picteannol (10 µM), or the MAPK kinase kinase inhibitor PD 98059 (5 µM) for 30 min. Cbl precipitates were blotted with anti-phosphotyrosine and reblotted with anti-Cbl, Eph receptor phosphorylation was monitored by blotting total cell lysates with anti-phosphotyrosine, and lysates were reblotted with anti-Gi{alpha} to control loading. One representative experiment of at least three is shown in all cases.

 
Ephrin-A1 stimulation regulates the role of c-Cbl in signal transduction

There are at least two distinct aspects to c-Cbl function in T cells, one being a central role in connecting downstream signaling pathways (19, 23). Cbl appears to act as a scaffold for the assembly of a large complex of signal transduction proteins. We therefore examined the influence of ephrin-A1 stimulation on a number of well-described Cbl interactions. One of these is with the adapter protein Crk-L (35, 36, 37, 38). Crk-L was immunoprecipitated from ephrin-A1-stimulated Jurkat cells, and the association of tyrosine-phosphorylated proteins was examined by Western blotting. Ephrin-A1 stimulation resulted in increased association of a 100-kDa phosphoprotein in Crk-L immunoprecipitates (Fig. 5A, left panel), which was confirmed as Cbl by Western blotting with anti-Cbl Abs (Fig. 5A, right panel). While Cbl association with Crk-L increased 2- to 2.5-fold, it was not present in control immunoprecipitation with irrelevant IgG (not shown). The correlation between Cbl/Crk-L association and Cbl phosphorylation is in accordance with binding mediated through the recognition of phosphorylated Cbl tyrosine residues by an SH2 domain of Crk-L as previously described (35, 36). Tyrosine phosphorylation of Crk-L itself (42 kDa) could not be detected. Jurkat cells also express the closely related Crk-II gene product, and ephrin-A1 induced similar binding of pp100 to Crk-II (Fig. 5B; a similar 2-fold increase, confirmed as Cbl by direct blotting with anti-Cbl, not shown). Cbl also undergoes a well-characterized interaction with the adapter protein Grb2 in response to certain stimuli (37, 39, 40). However, while basal association of Grb2 with a 100-kDa phosphorylated protein was evident, no increase in the phosphorylation of this protein was observed upon ephrin-A1 stimulation (Fig. 5C), suggesting that the Grb2-Cbl complex may not participate in EphA receptor signaling. In addition to modulating Cbl association with the Crk proteins, ephrin-A1 stimulation was found to alter interaction with p85 PI3-kinase and Vav (not shown), suggesting that EphA receptor activation may regulate many transduction pathways through Cbl.



View larger version (55K):
[in this window]
[in a new window]
  		FIGURE 5. Ephrin-A1 stimulation induces association of Cbl with the Crk adapter proteins. A, Jurkat cells were stimulated with 1 µg/ml ephrin-A1 for the indicated times. Crk-L was immunoprecipitated from Triton lysates and blotted with anti-phosphotyrosine. Samples were reblotted with anti-Crk-L. Right panel, Crk-L was immunoprecipitated from ephrin-A1-stimulated Jurkat cell lysates and blotted with anti-Cbl. Immunoprecipitates of ephrin-A1-stimulated cells with control human IgG did not demonstrate Cbl binding (not shown). B and C, Cells were stimulated as described in A, and Crk-II (B) or Grb2 (C) precipitates were blotted with anti-phosphotyrosine.

 
EphA receptors undergo down-regulation from the cell surface upon ephrin-A1 stimulation

c-Cbl has a second important function in addition to a role in signal transduction. Cbl is known to be responsible for the physical down-regulation of receptor tyrosine kinases from the cell surface, including the EGF, PDGF, and CSF receptors (27, 41, 42). This would appear to form part of a negative feedback loop regulating the intensity and duration of receptor signaling. The down-regulation of receptors requires receptor kinase activity (27) and may be dependent upon phosphorylation of Cbl (25), suggesting that the EphA receptors could be subject to Cbl-mediated down-regulation.

We were unable to coimmunoprecipitate EphA receptor and Cbl from Jurkat cells, either because of the absence of an effective immunoprecipitating Ab to EphA3 or because of a relatively low level of receptor expression. However, a constitutive complex could be isolated by coexpression of EphA receptor and Cbl in 293T cells (Fig. 6A). Furthermore, overexpression of wild-type Cbl, but not the 70-Z Cbl mutant, was found to decrease EphA expression, although they bound the receptor equally well. 70-Z Cbl has a functional extended SH2 domain, allowing it to bind activated receptors, but contains a deletion in its ubiquitin ligase ring finger domain, rendering it unable to induce RTK ubiquitination and, thus, down-regulation (26, 43). 70-Z Cbl did not decrease EphA expression, but, rather, elevated it, further suggesting that activated EphA receptors undergo degradation as the result of interaction with wild-type Cbl.



View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 6. EphA receptor cell surface expression is down-regulated following ephrin-A1 stimulation. A, 293T cells were transiently transfected with Myc-tagged EphA4, Cbl, and 70-Z Cbl cDNA in the pcDNA3 vector. EphA4 was immunoprecipitated with anti-Myc, and samples were blotted with anti-Cbl and anti-Myc as indicated. Matching lysates were blotted with anti-Cbl to determine the expression of transfected Cbl proteins and anti-Gi{alpha} to control protein loading. One representative experiment of four is shown. B, Jurkat cells (5 x 105) were incubated with 10 µg/ml ephrin-A1-Fc or control IgG protein for 30 min at 37°C. Cells were then stripped of bound ligand by acid wash before resuspension in cold PBS for staining. Cells were stained on ice with 10 µg/ml ephrin-A1-Fc and incubated with PE-labeled anti-Fc, and bound ligand was detected by flow cytometry. The average of three independent experiments is shown with SEs. Right panel, Cells initially displaying the highest levels of EphA receptor expression were examined separately (~25% of total) and demonstrated an ~80% drop in EphA expression. C, Cells were treated with 10 µg/ml ephrin-A1-Fc or control IgG protein for the indicated periods of time at 37°C, and receptor expression was analyzed as described in B. The average of three experiments is shown. D, Jurkat cells were pretreated with the Src family inhibitor PP2 or inactive PP3 for 37°C for 30 min before addition of 10 µg/ml ephrin-A1 or control IgG for an additional 30 min. Receptor expression was analyzed as described in B. E, Jurkat cells were stimulated with ephrin-A1 or control IgG as indicated for up to 60 min at 37°C. Cells were lysed, 1 µg of ephrin-A1-Fc was added to each stimulated sample, and EphA3 receptor precipitated by Fc ligand pull-down. Receptor expression was revealed by blotting with anti-EphA3. Specificity was controlled by control immunoprecipitation with IgG. Lower panel, Sample loading was controlled by blotting matching lysates with anti-Gi{alpha}. F, Cells were pretreated with the proteasomal inhibitor MG-132 (50 µM) for 30 min before stimulation with ephrin-A1 at 37°C. EphA3 expression was then examined by pull-down and blotting with anti-EphA3 and was controlled by blotting matching lysates with anti-Erk2. One representative experiment of three is shown.

 
To assess the potential for endogenous EphA receptor down-regulation in Jurkat T cells, we analyzed cell surface expression of EphA receptors by ligand binding assay. Jurkat cells were incubated with a saturating concentration of ephrin-A1-Fc (10 µg/ml) or control IgG protein for 30 min at 37°C to induce receptor down-regulation. Cells were then stripped of bound ligand by acid wash (RPMI, pH 3.0) and stained with ephrin-A1-Fc ligand for 1 h on ice to detect EphA receptor expression. Bound ligand was detected by a secondary incubation on ice with PE-labeled anti-Fc and subsequent flow cytometric analysis. EphA receptor expression was consistently decreased following incubation at 37°C with ephrin-A1, but not with control protein (Fig. 6B). This was most notable when the cells initially displaying the highest levels of EphA receptor expression were examined separately (~25% of total), where an ~80% drop in EphA receptor surface expression was seen (Fig. 6B, right panel). Down-regulation of EphA receptors reached a plateau after ~40 min (Fig. 6C), roughly paralleling the disappearance of phosphorylated EphA receptor from total cell lysates (Fig. 1C). Control experiments using incubation with ephrin-A1 on ice did not show altered EphA receptor expression (not shown). Interestingly, preincubation with the Src family inhibitor PP2, but not PP3, was also found to block ephrin-A1-induced EphA down-regulation (Fig. 6D), suggestive of a requirement for Src kinase activity similar to that for induction of Cbl phosphorylation.

The coexpression of EphA4 and Cbl in HEK-293 cells was observed to decrease receptor protein expression. Similarly, the level of EphA3 protein expression in Jurkat cells was found to decrease upon stimulation with ephrin-A1, but not control protein (Fig. 6E), suggesting that the EphA3 receptor was not only removed from the cell surface, but subsequently degraded. Indeed, pretreatment with the proteasomal inhibitor MG-132 prevented ligand-induced disappearance of EphaA3 (Fig. 6F).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Our finding that EphA activation induces Cbl phosphorylation brings these receptors into a larger group of tyrosine kinase receptors demonstrating the ability to regulate and be regulated by Cbl. These observations also add to our understanding of EphA receptor signaling and function in cells of the immune system and furthermore may reveal a basis by which EphA receptors can cross-talk with other T cell-expressed receptors, most importantly the Ag and chemokine receptors. Eph costimulation has recently been shown to modulate T cell responses to activation of both of these receptors (8, 9, 11). As the TCR and chemokine receptors both regulate Cbl phosphorylation and function (35, 37, 44, 45), the ability to modulate Cbl and its associated proteins may permit EphA receptors to influence the activation of these signaling pathways.

While EphA receptor activation was observed to induce rapid tyrosine phosphorylation of Cbl in Jurkat cells, interestingly Cbl phosphorylation was not induced by ephrin-B1. This is despite the presence of multiple EphB receptors in Jurkat cells and suggests that EphBs may not be subject to regulation by Cbl. Previously, we have shown that the EphB6 receptor, but not EphB1, can bind Cbl in transfected 293-T cells (16), but were unable to observe any effect on Cbl phosphorylation. Luo et al. (8) also examined the linkage between EphB6 and Cbl using Jurkat cells, demonstrating that ligation of EphB6 with specific Ab caused a reduction in basal Cbl phosphorylation. We did not observe a decrease in Cbl phosphorylation upon stimulation of Jurkat with ephrin-B1, although this may reflect the different natures of ephrin-B and Ab stimuli, one activating multiple EphB receptors and the other EphB6 alone.

To date, the potential for EphA down-regulation has received little attention, although down-regulation of the ephrin-A ligand upon engagement by EphA receptor has been reported to occur as the result of proteolytic cleavage of the cell surface-expressed ligand (46). We observed down-regulation of EphA receptors from the surface of Jurkat cells following ephrin-A1 stimulation, with kinetics and magnitude of receptor down-regulation similar to those previously reported for other RTKs, such as the EGF receptor (25, 26). The PDGF, EGF, and CSF receptor tyrosine kinases all induce Cbl phosphorylation and undergo down-regulation as the result of Cbl-mediated ubiquitination (27, 41, 42). Although we could not unambiguously detect association between Cbl and the EphA3 receptors in Jurkat cells, a tyrosine-phosphorylated protein of the correct m.w. was observed in ephrin-A pull-downs upon long exposure of anti-phosphotyrosine Western blots (not shown). As with many RTKs, the isolation of the Cbl-EphA receptor complex required overexpression of both proteins, and we were readily able to identify EphA4-Cbl complexes by cotransfection in HEK-293 cells. Most recently, Wang et al. (47) have also demonstrated EphA2-Cbl association by coexpression in these cells. However, it is not clear that all members of the EphA receptor family should bind Cbl and be subject to similar Cbl-mediated regulation. Cbl binding is known to be selective in the ErbB family of RTKs, with subsequent differences in the regulation of activation and expression (27), and we have previously demonstrated that although EphB6 binds Cbl, EphB1 does not (16). As the site of Cbl binding to EphA receptors has not been identified, association with the different subfamily members is not yet predictable.

While Wang et al. (47) observed ligand-inducible EphA2-Cbl association, they did not report ligand-inducible receptor down-regulation or induction of Cbl phosphorylation. However, it is possible that the preactivated status of the receptors due to persistent contact with neighboring cell-expressed ephrins precludes the observation of these events. Alternatively, the different natures of the relatively immobile adherent epithelial cell and the mobile lymphoid cells may entail different modes of EphA receptor regulation in response to engagement by ephrin-A ligand.

The ability to block ephrin-A1-induced Cbl phosphorylation in Jurkat cells by inhibiting Src family kinase activity with PP2 was surprising. This suggests that either the EphA receptor kinase domain is not responsible for Cbl phosphorylation, or alternatively, that ligand-induced, Src family kinase-mediated phosphorylation is required for EphA-Cbl interaction. Although this observation relies upon the use of a synthetic kinase inhibitor, PP2, and the closely related PP1 are considered to be specific inhibitors of the Src family (34, 48, 49, 50) and are commonly used to examine the role of Src family kinases. Providing indirect support for a role for Src family kinase(s) in ephrin-A1-induced Cbl phosphorylation, Fyn kinase activity was observed to be increased following ephrin-A1 stimulation (not shown) and a phosphorylated 100-kDa protein consistent with Cbl was also observed to coimmunoprecipitate with Fyn. It has been suggested that the Src family kinases Fyn and Yes may play a major role in Cbl phosphorylation, while the related Lck phosphorylates Cbl ineffectively (33). In agreement, pp100 was not observed in Lck immunoprecipitates from ephrin-A1-stimulated Jurkat cells, and an absence of Lck expression in the J.Cam.1.6 cell line did not appear to hinder ephrin-A1-induced Cbl phosphorylation (not shown). Our observations are clearly akin to the recent findings of Kassenbrock et al. (51), who demonstrated a role for Src family kinases in EGF-induced phosphorylation of Cbl using the PP1 inhibitor. PP1 inhibited Cbl activation, but not phosphorylation of the EGF receptor itself, observations clearly similar to our findings. While Kassenbrock et al. (51) were also able to observe abrogation of EGF receptor-Cbl association upon PP1 treatment, their observations similarly do not yet permit us to determine the precise role of Src family-mediated phosphorylation.

While the role of Cbl in regulating the expression of activated RTKs is beginning to be reasonably well understood, its precise role in signal transduction is unclear, although interaction with a variety of signaling proteins has been observed. Currently, its role is defined as that of a scaffold protein, serving to juxtapose other proteins in a spatially and temporally regulated manner (23, 24, 43). Following Ag receptor stimulation of T cells, Cbl undergoes rapid tyrosine phosphorylation and associates with the Src homology domain-containing adapters Grb2, Crk, and Crk-L (36, 37, 44). In contrast, ephrin-A1 stimulation of Jurkat cells appeared to result in the association of phosphorylated Cbl with Crk proteins, but not Grb2. Cbl has been suggested to sequester Grb2 away from Sos, thus inhibiting Ras activation (52), and EphA activation has indeed been reported to inhibit Ras-mediated MAPK activation in neuronal and endothelial cells (17, 18). We did not, however, observe decreased MAPK activity in Jurkat cells upon ephrin-A1 stimulation (data not shown), perhaps consistent with unchanged Grb2 association.

While Crk-II was recently shown to link EphA3 activation to a cellular retraction and detachment response in adherent 293T cells (53), the potential function of Crk-L in lymphoid cells in response to ephrin-A stimulation is uncertain. Through the ability to modulate Crk interactions, EphA receptors could potentially regulate many aspects of T cell function. Cbl is the predominant phospho-protein associated with the Crk proteins in activated lymphocytes and in response to Ag receptor stimulation, and this complex appears to have multiple functions (36, 54). The formation of a ternary complex of Cbl-Crk-L and C3G, a guanine nucleotide exchange factor for the small G protein Rap1, has been reported upon Ag receptor stimulation of T cells (24, 35, 55). The role of Rap1 activation is unclear and controversial, but it may antagonize Ras activation. Crk also associates with p130Cas; this complex plays an important role in regulating the attachment and migration of adherent cells (56). Carter et al. (30) have shown recently that EphA receptor stimulation modulates cytoskeletal rearrangement through Cas in NIH-3T3 cells. In T cells the complex of p105Cas-L and Crk plays an important role in {beta}1 integrin signaling, regulating migration on fibronectin (57).

In summary, Cbl would appear to play multiple roles downstream of the EphA receptors, functioning to transduce signals from activated receptors as well as regulating EphA receptor expression.


   Acknowledgments
 
We thank Robin McNeilly and Daniel Hesse for technical assistance.


   Footnotes
 
1 This work was supported by the National Cancer Institute of Canada. Back

2 N.S. and A.F. made equal contributions to this paper. Back

3 Address correspondence and reprint requests to Dr. Chaim M. Roifman, Division of Immunology and Allergy, Department of Pediatrics, Infection, Immunity, Injury, and Repair Program, Research Institute of Hospital for Sick Children, 555 University Avenue, Toronto, Ontario, Canada M5G 1X8. E-mail address: croifman{at}sickkids.on.ca Back

4 Abbreviations used in this paper: RTK, receptor tyrosine kinase; EGF, epidermal growth factor; MAPK, mitogen-activated protein kinase; PBL-T, peripheral blood T cells; PDGF, platelet-derived growth factor; PI3-kinase, phosphoinositol 3-kinase; PP2, 4-amino-5(4-chlorophenyl)-7-(tert-butyl)pyrazolo[3,4-d]pyrimidine. Back

Received for publication December 11, 2002. Accepted for publication April 2, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Zisch, A. H., E. B. Pasquale. 1997. The Eph family: a multitude of receptors that mediate cell recognition signals. Cell Tissue Res. 290:217.[Medline]
  2. Zhou, R.. 1998. The Eph family receptors and ligands. Pharmacol. Ther. 77:151.[Medline]
  3. Ciossek, T., B. Monschau, C. Kremoser, J. Loschinger, S. Lang, B. K. Muller, F. Bonhoeffer, U. Drescher. 1998. Eph receptor-ligand interactions are necessary for guidance of retinal ganglion cell axons in vitro. Eur. J. Neurosci. 10:1574.[Medline]
  4. Aasheim, H. C., L. W. Terstappen, T. Logtenberg. 1997. Regulated expression of the Eph-related receptor tyrosine kinase Hek11 in early human B lymphopoiesis. Blood 90:3613.[Abstract/Free Full Text]
  5. Aasheim, H. C., E. Munthe, S. Funderud, E. B. Smeland, K. Beiske, T. Logtenberg. 2000. A splice variant of human ephrin-A4 encodes a soluble molecule that is secreted by activated human B lymphocytes. Blood 95:221.[Abstract/Free Full Text]
  6. Shimoyama, M., H. Matsuoka, A. Tamekane, M. Ito, N. Iwata, R. Inoue, K. Chihara, A. Furuya, N. Hanai, T. Matsui. 2000. T-cell-specific expression of kinase-defective Eph-family receptor protein, EphB6 in normal as well as transformed hematopoietic cells. Growth Factors 18:63.[Medline]
  7. Prevost, N., D. Woulfe, T. Tanaka, L. F. Brass. 2002. Interactions between Eph kinases and ephrins provide a mechanism to support platelet aggregation once cell-to-cell contact has occurred. Proc. Natl. Acad. Sci. USA 99:9219.[Abstract/Free Full Text]
  8. Luo, H., X. Wan, Y. Wu, J. Wu. 2001. Cross-linking of EphB6 resulting in signal transduction and apoptosis in Jurkat cells. J. Immunol. 167:1362.[Abstract/Free Full Text]
  9. Munoz, J. J., C. L. Alonso, R. Sacedon, T. Crompton, A. Vicente, E. Jimenez, A. Varas, A. G. Zapata. 2002. Expression and function of the Eph A receptors and their ligands ephrins A in the rat thymus. J. Immunol. 169:177.[Abstract/Free Full Text]
  10. Freywald, A., N. Sharfe, C. Rashotte, T. Grunberger, C. M. Roifman. 2003. The EphB6 receptor inhibits JNK activation in T lymphocytes and modulates T cell receptor-mediated responses. J. Biol. Chem. 293:10150.
  11. Sharfe, N., A. Freywald, C. M. Roifman. 2002. Ephrin stimulation modulates T cell chemotaxis. Eur. J. Immunol. 32:3745.[Medline]
  12. Kullander, K., R. Klein. 2002. Mechanisms and functions of Eph and ephrin signalling. Nat. Rev. Mol. Cell. Biol. 3:475.[Medline]
  13. Sakano, S., R. Serizawa, T. Inada, A. Iwama, A. Itoh, C. Kato, Y. Shimizu, F. Shinkai, R. Shimizu, S. Kondo, et al 1996. Characterization of a ligand for receptor protein-tyrosine kinase HTK expressed in immature hematopoietic cells. Oncogene 13:813.[Medline]
  14. Davis, S., N. W. Gale, T. H. Aldrich, P. C. Maisonpierre, V. Lhotak, T. Pawson, M. Goldfarb, G. D. Yancopoulos. 1994. Ligands for EPH-related receptor tyrosine kinases that require membrane attachment or clustering for activity. Science 266:816.[Abstract/Free Full Text]
  15. Gurniak, C. B., L. J. Berg. 1996. A new member of the Eph family of receptors that lacks protein tyrosine kinase activity. Oncogene 13:777.[Medline]
  16. Freywald, A., N. Sharfe, C. M. Roifman. 2002. The kinase null EphB6 receptor undergoes trans-phosphorylation in a complex with EphB1. J. Biol. Chem. 277:3823.[Abstract/Free Full Text]
  17. Elowe, S., S. J. Holland, S. Kulkarni, T. Pawson. 2001. Downregulation of the Ras-mitogen-activated protein kinase pathway by the EphB2 receptor tyrosine kinase is required for ephrin-induced neurite retraction. Mol. Cell. Biol. 21:7429.[Abstract/Free Full Text]
  18. Miao, H., B. R. Wei, D. M. Peehl, Q. Li, T. Alexandrou, J. R. Schelling, J. S. Rhim, J. R. Sedor, E. Burnett, B. Wang. 2001. Activation of EphA receptor tyrosine kinase inhibits the Ras/MAPK pathway. Nat. Cell. Biol. 3:527.[Medline]
  19. Thien, C. B., W. Y. Langdon. 2001. Cbl: many adaptations to regulate protein tyrosine kinases. Nat. Rev. Mol. Cell. Biol. 2:294.[Medline]
  20. Rao, N., I. Dodge, H. Band. 2002. The Cbl family of ubiquitin ligases: critical negative regulators of tyrosine kinase signaling in the immune system. J. Leukocyte Biol. 71:753.[Abstract/Free Full Text]
  21. Meisner, H., M. P. Czech. 1995. Coupling of the proto-oncogene product c-Cbl to the epidermal growth factor receptor. J. Biol. Chem. 270:25332.[Abstract/Free Full Text]
  22. Galisteo, M. L., I. Dikic, A. G. Batzer, W. Y. Langdon, J. Schlessinger. 1995. Tyrosine phosphorylation of the c-cbl proto-oncogene protein product and association with epidermal growth factor (EGF) receptor upon EGF stimulation. J. Biol. Chem. 270:20242.[Abstract/Free Full Text]
  23. Lupher, M. L., Jr, C. E. Andoniou, D. Bonita, S. Miyake, H. Band. 1998. The c-Cbl oncoprotein. Int. J. Biochem. Cell. Biol. 30:439.[Medline]
  24. Miyake, S., M. L. Lupher, Jr, C. E. Andoniou, N. L. Lill, S. Ota, P. Douillard, N. Rao, H. Band. 1997. The Cbl protooncogene product: from an enigmatic oncogene to center stage of signal transduction. Crit. Rev. Oncog. 8:189.[Medline]
  25. Levkowitz, G., H. Waterman, S. A. Ettenberg, M. Katz, A. Y. Tsygankov, I. Alroy, S. Lavi, K. Iwai, Y. Reiss, A. Ciechanover, et al 1999. Ubiquitin ligase activity and tyrosine phosphorylation underlie suppression of growth factor signaling by c-Cbl/Sli-1. Mol. Cell 4:1029.[Medline]
  26. Waterman, H., G. Levkowitz, I. Alroy, Y. Yarden. 1999. The RING finger of c-Cbl mediates desensitization of the epidermal growth factor receptor. J. Biol. Chem. 274:22151.[Abstract/Free Full Text]
  27. Levkowitz, G., H. Waterman, E. Zamir, Z. Kam, S. Oved, W. Y. Langdon, L. Beguinot, B. Geiger, Y. Yarden. 1998. c-Cbl/Sli-1 regulates endocytic sorting and ubiquitination of the epidermal growth factor receptor. Genes Dev. 12:3663.[Abstract/Free Full Text]
  28. Zheng, N., P. Wang, P. D. Jeffrey, N. P. Pavletich. 2000. Structure of a c-Cbl-UbcH7 complex: RING domain function in ubiquitin-protein ligases. Cell 102:533.[Medline]
  29. Yokouchi, M., T. Kondo, A. Houghton, M. Bartkiewicz, W. C. Horne, H. Zhang, A. Yoshimura, R. Baron. 1999. Ligand-induced ubiquitination of the epidermal growth factor receptor involves the interaction of the c-Cbl RING finger and UbcH7. J. Biol. Chem. 274:31707.[Abstract/Free Full Text]
  30. Carter, N., T. Nakamoto, H. Hirai, T. Hunter. 2002. EphrinA1-induced cytoskeletal re-organization requires FAK and p130cas. Nat. Cell. Biol. 4:565.[Medline]
  31. Panchamoorthy, G., T. Fukazawa, S. Miyake, S. Soltoff, K. Reedquist, B. Druker, S. Shoelson, L. Cantley, H. Band. 1996. p120cbl is a major substrate of tyrosine phosphorylation upon B cell antigen receptor stimulation and interacts in vivo with Fyn and Syk tyrosine kinases, Grb2 and Shc adaptors, and the p85 subunit of phosphatidylinositol 3-kinase. J. Biol. Chem. 271:3187.[Abstract/Free Full Text]
  32. Tsygankov, A. Y., S. Mahajan, J. E. Fincke, J. B. Bolen. 1996. Specific association of tyrosine-phosphorylated c-Cbl with Fyn tyrosine kinase in T cells. J. Biol. Chem. 271:27130.[Abstract/Free Full Text]
  33. Feshchenko, E. A., W. Y. Langdon, A. Y. Tsygankov. 1998. Fyn, Yes, and Syk phosphorylation sites in c-Cbl map to the same tyrosine residues that become phosphorylated in activated T cells. J. Biol. Chem. 273:8323.[Abstract/Free Full Text]
  34. Zhu, X., J. L. Kim, J. R. Newcomb, P. E. Rose, D. R. Stover, L. M. Toledo, H. Zhao, K. A. Morgenstern. 1999. Structural analysis of the lymphocyte-specific kinase Lck in complex with non-selective and Src family selective kinase inhibitors. Struct. Fold. Des. 7:651.[Medline]
  35. Reedquist, K. A., T. Fukazawa, G. Panchamoorthy, W. Y. Langdon, S. E. Shoelson, B. J. Druker, H. Band. 1996. Stimulation through the T cell receptor induces Cbl association with Crk proteins and the guanine nucleotide exchange protein C3G. J. Biol. Chem. 271:8435.[Abstract/Free Full Text]
  36. Sawasdikosol, S., J. H. Chang, J. C. Pratt, G. Wolf, S. E. Shoelson, S. J. Burakoff. 1996. Tyrosine-phosphorylated Cbl binds to Crk after T cell activation. J. Immunol. 157:110.[Abstract]
  37. Buday, L., A. Khwaja, S. Sipeki, A. Farago, J. Downward. 1996. Interactions of Cbl with two adapter proteins, Grb2 and Crk, upon T cell activation. J. Biol. Chem. 271:6159.[Abstract/Free Full Text]
  38. Sattler, M., R. Salgia. 1998. Role of the adapter protein CRKL in signal transduction of normal hematopoietic and BCR/ABL-transformed cells. Leukemia 12:637.[Medline]
  39. Anderson, S. M., E. A. Burton, B. L. Koch. 1997. Phosphorylation of Cbl following stimulation with interleukin-3 and its association with Grb2, Fyn, and phosphatidylinositol 3-kinase. J. Biol. Chem. 272:739.[Abstract/Free Full Text]
  40. Donovan, J. A., Y. Ota, W. Y. Langdon, L. E. Samelson. 1996. Regulation of the association of p120cbl with Grb2 in Jurkat T cells. J. Biol. Chem. 271:26369.[Abstract/Free Full Text]
  41. Wang, Y., Y. G. Yeung, E. R. Stanley. 1999. CSF-1 stimulated multiubiquitination of the CSF-1 receptor and of Cbl follows their tyrosine phosphorylation and association with other signaling proteins. J. Cell Biochem. 72:119.[Medline]
  42. Miyake, S., M. L. Lupher, Jr, B. Druker, H. Band. 1998. The tyrosine kinase regulator Cbl enhances the ubiquitination and degradation of the platelet-derived growth factor receptor {alpha}. Proc. Natl. Acad. Sci. USA 95:7927.[Abstract/Free Full Text]
  43. Sawasdikosol, S., J. C. Pratt, W. Meng, M. J. Eck, S. J. Burakoff. 2000. Adapting to multiple personalities: Cbl is also a RING finger ubiquitin ligase. Biochim. Biophys. Acta 1471:M1.[Medline]
  44. Fukazawa, T., K. A. Reedquist, T. Trub, S. Soltoff, G. Panchamoorthy, B. Druker, L. Cantley, S. E. Shoelson, H. Band. 1995. The SH3 domain-binding T cell tyrosyl phosphoprotein p120: demonstration of its identity with the c-cbl protooncogene product and in vivo complexes with Fyn, Grb2, and phosphatidylinositol 3-kinase. J. Biol. Chem. 270:19141.[Abstract/Free Full Text]
  45. Chernock, R. D., R. P. Cherla, R. K. Ganju. 2001. SHP2 and cbl participate in {alpha}-chemokine receptor CXCR4-mediated signaling pathways. Blood 97:608.[Abstract/Free Full Text]
  46. Hattori, M., M. Osterfield, J. G. Flanagan. 2000. Regulated cleavage of a contact-mediated axon repellent. Science 289:1360.[Abstract/Free Full Text]
  47. Wang, Y., S. Ota, H. Kataoka, M. Kanamori, Z. Li, H. Band, M. Tanaka, H. Sugimura. 2002. Negative regulation of EphA2 receptor by Cbl. Biochim. Biophys. Acta 296:214.
  48. Hanke, J. H., J. P. Gardner, R. L. Dow, P. S. Changelian, W. H. Brissette, E. J. Weringer, B. A. Pollok, P. A. Connelly. 1996. Discovery of a novel, potent, and Src family-selective tyrosine kinase inhibitor: study of Lck- and FynT-dependent T cell activation. J. Biol. Chem. 271:695.[Abstract/Free Full Text]
  49. Schindler, T., F. Sicheri, A. Pico, A. Gazit, A. Levitzki, J. Kuriyan. 1999. Crystal structure of Hck in complex with a Src family-selective tyrosine kinase inhibitor. Mol. Cell 3:639.[Medline]
  50. Liu, Y., A. Bishop, L. Witucki, B. Kraybill, E. Shimizu, J. Tsien, J. Ubersax, J. Blethrow, D. O. Morgan, K. M. Shokat. 1999. Structural basis for selective inhibition of Src family kinases by PP1. Chem. Biol. 6:671.[Medline]
  51. Kassenbrock, C. K., S. Hunter, P. Garl, G. L. Johnson, S. M. Anderson. 2002. Inhibition of Src family kinases blocks epidermal growth factor (EGF)-induced activation of Akt, phosphorylation of c-Cbl, and ubiquitination of the EGF receptor. J. Biol. Chem. 277:24967.[Abstract/Free Full Text]
  52. Lupher, M. L., Jr, N. Rao, M. J. Eck, H. Band. 1999. The Cbl protooncoprotein: a negative regulator of immune receptor signal transduction. Immunol. Today 20:375.[Medline]
  53. Lawrenson, I. D., S. H. Wimmer-Kleikamp, P. Lock, S. M. Schoenwaelder, M. Down, A. W. Boyd, P. F. Alewood, M. Lackmann. 2002. Ephrin-A5 induces rounding, blebbing and de-adhesion of EphA3-expressing 293T and melanoma cells by CrkII and Rho-mediated signalling. J. Cell Sci. 115:1059.[Abstract/Free Full Text]
  54. Feller, S. M., G. Posern, J. Voss, C. Kardinal, D. Sakkab, J. Zheng, B. S. Knudsen. 1998. Physiological signals and oncogenesis mediated through Crk family adapter proteins. J. Cell Physiol. 177:535.[Medline]
  55. Amsen, D., A. Kruisbeek, J. L. Bos, K. Reedquist. 2000. Activation of the Ras-related GTPase Rap1 by thymocyte TCR engagement and during selection. Eur. J. Immunol. 30:2832.[Medline]
  56. Klemke, R. L., J. Leng, R. Molander, P. C. Brooks, K. Vuori, D. A. Cheresh. 1998. CAS/Crk coupling serves as a "molecular switch" for induction of cell migration. J. Cell Biol. 140:961.[Abstract/Free Full Text]
  57. Ohashi, Y., S. Iwata, K. Kamiguchi, C. Morimoto. 1999. Tyrosine phosphorylation of Crk-associated substrate lymphocyte-type is a critical element in TCR- and {beta}1 integrin-induced T lymphocyte migration. J. Immunol. 163:3727.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 BloodHome page
S. H. Wimmer-Kleikamp, E. Nievergall, K. Gegenbauer, S. Adikari, M. Mansour, T. Yeadon, A. W. Boyd, N. R. Patani, and M. Lackmann
Elevated protein tyrosine phosphatase activity provokes Eph/ephrin-facilitated adhesion of pre-B leukemia cells
Blood, August 1, 2008; 112(3): 721 - 732.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
G. Jiang, T. Freywald, J. Webster, D. Kozan, R. Geyer, J. DeCoteau, A. Narendran, and A. Freywald
In Human Leukemia Cells Ephrin-B-Induced Invasive Activity Is Supported by Lck and Is Associated with Reassembling of Lipid Raft Signaling Complexes
Mol. Cancer Res., February 1, 2008; 6(2): 291 - 305.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
D. Pfaff, U. Fiedler, and H. G. Augustin
Emerging roles of the Angiopoietin-Tie and the ephrin-Eph systems as regulators of cell trafficking
J. Leukoc. Biol., October 1, 2006; 80(4): 719 - 726.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. J. Munoz, D. Alfaro, J. Garcia-Ceca, L. M. Alonso-C, E. Jimenez, and A. Zapata
Thymic Alterations in EphA4-Deficient Mice
J. Immunol., July 15, 2006; 177(2): 804 - 813.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
A. I. Ivanov, A. A. Steiner, A. C. Scheck, and A. A. Romanovsky
Expression of Eph receptors and their ligands, ephrins, during lipopolysaccharide fever in rats
Physiol Genomics, April 14, 2005; 21(2): 152 - 160.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
H.-C. Aasheim, J. Delabie, and E. F. Finne
Ephrin-A1 binding to CD4+ T lymphocytes stimulates migration and induces tyrosine phosphorylation of PYK2
Blood, April 1, 2005; 105(7): 2869 - 2876.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
K. Hess, Y. Yang, S. Golech, A. Sharov, K. G. Becker, and N.-p. Weng
Kinetic assessment of general gene expression changes during human naive CD4+ T cell activation
Int. Immunol., December 1, 2004; 16(12): 1711 - 1721.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
R. van Doorn, R. Dijkman, M. H. Vermeer, J. J. Out-Luiting, E. M. H. van der Raaij-Helmer, R. Willemze, and C. P. Tensen
Aberrant Expression of the Tyrosine Kinase Receptor EphA4 and the Transcription Factor Twist in Sezary Syndrome Identified by Gene Expression Analysis
Cancer Res., August 15, 2004; 64(16): 5578 - 5586.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sharfe, N.
Right arrow Articles by Roifman, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sharfe, N.
Right arrow Articles by Roifman, C. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS