The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gao, J.-X.
Right arrow Articles by Zheng, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gao, J.-X.
Right arrow Articles by Zheng, P.
Right arrowPubmed/NCBI databases
Medline Plus Health Information
*Stem Cells
The Journal of Immunology, 2003, 170: 5927-5935.
Copyright © 2003 by The American Association of Immunologists

Differentiation of Monocytic Cell Clones into CD8{alpha}+ Dendritic Cells (DC) Suggests that Monocytes Can Be Direct Precursors for Both CD8{alpha}+ and CD8{alpha}- DC in the Mouse1

Jian-Xin Gao*, Xingluo Liu*, Jing Wen*, Huiming Zhang*, Joan Durbin{dagger}, Yang Liu2,* and Pan Zheng2,*

* Division of Cancer Immunology, Department of Pathology and Comprehensive Cancer Center, and {dagger} Department of Pediatrics and Children’s Research Institute, Ohio State University Medical Center, Columbus, OH 43210


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Dendritic cells (DC) are the professional APCs that initiate T cell immune responses. DC can develop from both myeloid and lymphoid progenitors. In the mouse, the CD8{alpha}+ DC had been designated as "lymphoid" DC, and CD8{alpha}- DC as "myeloid" DC until recently when it was demonstrated that common myeloid progenitors can also give rise to CD8{alpha}+ DC in bone marrow chimera mice. However, it is still not clear which committed myeloid lineages differentiate into CD8{alpha}+ DC. Because monocytes can differentiate into DC in vivo, the simplest hypothesis is that the CD8{alpha}+ DC can be derived from the monocyte/macrophage. In this study we show that cell clones, isolated from CD8{alpha}+ DC lymphoma but with a monocytic phenotype (CD11clow/-D11bhighCD8{alpha}-I-Alow), can redifferentiate into CD8{alpha}+ DC either when stimulated by LPS and CD40L or when they migrate into the lymphoid organs. Maturation of DC in vivo correlated with strong priming of allogeneic T cells. Moreover, the monocytes from cultured splenocytes or peritoneal exudates macrophages of wild-type mice are also capable of differentiating into CD11c+CD8{alpha}+ DC after their migration into the draining lymph nodes. Our results suggest that monocytes can be direct precursors for CD11c+CD8{alpha}+ DC in vivo. In addition, the monocyte clones described in this study may be valuable for studying the differentiation and function of CD8{alpha}+ DC that mediate cross-presentation of Ag to CD8 T cells specific for cell-associate Ags.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Dendritic cells (DC)3 are professional APCs that initiate primary T cell immune responses (1). The DC precursors capture Ags and migrate to T cell regions of draining lymph nodes where they mature into functional DC and present Ags to initiate immune responses (2). Recent studies further reveal functional DC subsets differing in histological origin and cell surface markers (3, 4, 5).

In the mouse, one of the important DC subset markers is CD8{alpha}. It was initially suggested that two main DC lineages, i.e., lymphoid and myeloid DC, can be distinguished based on their cell-surface expression of CD8{alpha} (6, 7). Lymphoid DC express CD8{alpha}, whereas myeloid DC do not. However, this concept has been challenged recently, as Traver et al. (8) showed that both common lymphoid progenitors and common myeloid progenitors can develop into CD8{alpha}+ DC after adoptive transfer into congenic mice. Nevertheless, significant functional differences between the CD8{alpha}+ and CD8{alpha}- DC have been reported. Maldonado-Lopez et al. (9) proposed that CD8{alpha}+ and CD8{alpha}- DC induce Th1 and Th2 immune responses, respectively; den Haan et al. (10) reported that CD8{alpha}+ DC have the unique ability to cross-present cell-associated Ags via the MHC class I pathway.

These important functional distinctions make it necessary to study the developmental pathway of CD8{alpha}+ DC in detail. Whereas it is known that common myeloid progenitors can differentiate into different lineages of myeloid cells (11), the immediate precursor for CD8{alpha}+ myeloid DC have yet to be identified. A confounding factor in this area is that because of a scarcity of DC and monocyte clones, heterogeneous populations of cells are used for essentially all studies pertaining to the lineage relationship among DC subsets. In the course of studying immune surveillance over cancer development, we encountered a case of DC lymphoma in mice with targeted mutations of both the Stat-1 and p53 genes. Cells from the spleen were comprised almost exclusively of CD11c+CD8{alpha}+ DC. Given the known roles of p53 and Stat-1 genes in programmed cell death (12, 13, 14), we attempted to obtain stable DC clones. Interestingly, over the course of culture only cells with monocytic phenotypes (CD11clow/-D11bhighCD8{alpha}-) could be obtained, either as the polyclonal or stable monoclonal cultures. Upon adoptive transfer into a syngeneic host, the cloned monocytic cells migrated into lymph nodes and differentiated into CD8{alpha}+ DC. Moreover, the monocytes from cultured splenocytes or peritoneal exudates macrophages (PEM) of wild-type (WT) mice are also capable of differentiating into CD11c+CD8{alpha}+ DC after their migration into the draining lymph nodes. These results provide direct evidence that monocytes can be immediate precursors for CD8{alpha}+CD11c+ DC. The monocyte clones may provide a valuable tool for the study of the molecular mechanisms of DC maturation and the function of CD8{alpha}+ DC.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Experimental animals

C57BL/6j mice with targeted mutations of both p53 and Stat-1 genes were produced by breeding p53-/- mice (The Jackson Laboratory, Bar Harbor, ME) with Stat-1-/- mice (15). The genotype of the mice was determined by PCR. The sequences of the three primers used for p53 locus are as follows: P53F, CCCGAGTATCTGGAAGACAG; P53R, ATAGGTCGGTTCAT; and Neo-F, GTTCGCCAGGCTCAA. The WT locus yields a band of 900 bp, whereas the mutant locus results in a band of 600 bp. The sequences for three primers for the Stat-1 gene are as follows: TAATGTTTCATAGTTGGATATCAT, GAGATAATTCACAAAATCAGAGAG, and CTGATCCAGGCAGGCGTTG. This primer combination yields 142 bp for WT locus and 342 for mutant locus.

Male C57BL/6j (H-2b) and BALB/c (H-2d) mice were purchased from the National Cancer Institute (Rockville, MD) and were used at 8–12 wk. CD45.1 B6 (B6SJL/PTPRCA; H-2b) mice were purchased from Taconic Farms (Germantown, NY) and were maintained in the University Laboratory Animal Research Facility at Ohio State University under specific pathogen-free conditions.

Abs and other reagents

The following fluorochrome-conjugated mAbs to mouse Ags were purchased from BD PharMingen (San Diego, CA): anti-CD3 (145-2C11), anti-CD4 (GK1.5), anti-CD8{alpha} (53-6.7), anti-CD8{beta} (53-5.8), anti-CD11b (M1/70), anti-CD11c (N418), anti-CD14 (rmC5-3), anti-CD16/32 (2.4G2), anti-CD24 (M1/69), anti-CD40 (HM40-3); anti-CD44 (IM7), anti-CD45.1 (A20), anti-CD45.2 (104), anti-CD45R/B220 (RA3-6B2), anti-Thy1.2 (53-2.1), anti-Gr-1 (RB6-8C5), anti-I-A{beta}b (AF6-120.1), and anti-H-2Db (KH95). The following unconjugated rat mAbs were generated from cell lines purchased from American Type Culture Collection (Rockville, MD) and purified from culture supernatant by protein G affinity chromatography: anti-DEC-205 (HB290), anti-macrophage (F4/80), and anti-VLA-4 (PS/2). The biotinylated anti-B7-2 (GL-1) hybridoma was a gift from Dr. R. Hodes (National Institutes of Health, Bethesda, MD). The biotinylated anti-B7-1 (3A12, hamster IgG) was produced in the laboratory as described (16). FITC-labeled donkey anti-rat IgG and goat anti-hamster IgG Abs were purchased from Jackson ImmunoResearch Laboratories (West Grove, PA). LPS was purchased from Sigma-Aldrich (St. Louis, MO). Yellow-green fluosphere carboxylate-modified microspheres (1.0 µm, catalog number F-8823) were purchased from Molecular Probes (Eugene, Oregon).

Cell culture

The 3T3 cells transfected with either vector or with CD40L were generated and cultured as described (17). The DC lymphoma M9 cells were cultured and maintained in 25-cm flasks in RPMI medium containing 10% FCS, 2 mM glutamine, 50 µM 2-ME, 100 U/ml penicillin and 100 µg/ml streptomycin (Sigma-Aldrich). They were cloned by limiting dilution. To induce differentiation in vitro, cloned M9 cells were cultured in DMEM containing 10% FCS, 2 mM glutamine, 50 µM 2-ME, 100 U/ml penicillin, and 100 µg/ml streptomycin in 24-well (0.5–1 x 106/well) or 6-well plates (2–3 x 106/well) in the presence or absence of CD40L-transfected 3T3 cells (17) for 4 days and then in the presence or absence of LPS (10 µg/ml) for 2 more days. In all experiments, M9 and cloned M9 cells were harvested by gentle pipeting or incubation with PBS containing 5 mM EDTA for 5 min at room temperature.

Generation of monocytes from murine spleen or peritoneal exudates

Unfractionated splenic cells (5–10 x 107) from C57BL/6J mice (H-2b) were cultured with irradiated (3000 rad) allogeneic splenic cells (5 x 107) from BALB/c mice (H-2d) in a 25-cm2 flask (BD Biosciences, Lincoln Park, NJ) as described (18). The cultures were maintained for 2–3 mo when monocytes grew out and formed multiple layers with disseminated aggregates. The cells were harvested by gentle pipetting for adoptive transfer.

For PEM, C57BL/6j mice received an i.p. injection of 3 ml of 4% thioglycolate broth. The peritoneal exudates were harvested on days 5–7, when ~95% peritoneal exudates were mainly composed of macrophages. The cells were depleted of CD8+ and CD11c+ cells by magnetic biosphere as instructed by manufacturer (BioSource International, Camarillo CA) and injected s.c. into footpads of CD45.1+ congenic B6 mice.

In vivo differentiation of M9 cells, splenic monocytes, and PEM

Cloned M9 cells, cultured splenic monocytes, or PEM were injected i.p. (5 x 106/mouse) or s.c. (1–5 x 106/mouse) into the footpad of congenic B6CD45.1 mice. The mice were sacrificed 4-5 days later. Peritoneal cavity exudate cells (PEC) were collected by injecting and then redrawing 10 ml of medium. In addition, cells from the spleen and mesenteric lymph nodes (MLN) of mice that received i.p. injections or those from popliteal lymph nodes (PLN) of mice that received s.c. injections were also harvested and analyzed by flow cytometry. In some experiments, spleens were digested with collagenase (5 mg/ml, 5 ml/spleen) for 1 h at 37°C. Low-density cells were harvested from the interface between 40–50% percoll gradients.

T cell proliferation assay

To examine the capacity of cloned M9 cells to stimulate T cells, M9 cells were irradiated (3000 rad) and cocultured in various concentrations with purified allogeneic T cells (2 x 105/well) from BALB/c mice for 4 days in flat-bottom 96-well tissue culture plates. In some experiments, a suboptimal concentration of recombinant murine IL-2 (3 ng/ml) was added. The cultures were pulsed with [3H]thymidine (0.5 µCi/well) 16 h before harvest. In some experiments, BALB/c mice received a s.c. injection of cloned M9 cells in one footpad (1 x 106/mouse) and PBS in another footpad. The draining lymphoid nodes and spleen were harvested on day 5 after injection. Varying numbers of purified T cells were stimulated with 2 x 105/well irradiated allogeneic splenocytes (B6) for 60 h in round-bottom 96-well tissue culture plates and then pulsed with [3H]thymidine 16 h before harvest. Spleen T cells were purified by depletion of CD11c+, B220+, and Fc{gamma}R+ cells using magnetic biospheres provided by BioSource International.

Flow cytometry

For staining with biotin- or fluorochrome-conjugated Abs, the cells were first incubated with mAb 2.4G2 for 15 min to block Fc receptors on the surface of mononuclear cells. This was followed by staining with two or three conjugated mAbs. In addition, fluorochrome-conjugated streptavidin was used as the second-step reagent when biotinylated Abs were the first Ab. For indirect staining involving unconjugated first-step reagents, specific or isotype-matched control mAbs were used as first-step reagents, and FITC-conjugated donkey anti-rat or hamster IgG was used as secondary Ab.

For intracellular staining of MHC class II molecules in established M9 cell lines, the cells were harvested, permeabilized, and stained using a kit for intracellular staining (BD PharMingen) according to the manufacturer’s instructions. The intracellular nature of the I-A{beta} is confirmed by fluorescent microscopy. In some experiments, intracellular expression of cytokines was determined according to an established procedure (19).

Histological analysis

For pathological analysis, mouse organs were fixed with 10% formalin in PBS and were paraffin embedded. Tissue sections were stained with H&E and examined under a microscope. For immunohistochemical analysis, frozen sections were prepared and stained with 2 µg/ml Ag-specific mAbs and then developed using an ABC kit (Vector Laboratories, Burlingame, CA).

Analysis of cytokine gene expression in monocyte clones

Monocyte clones were cultured in the presence or absence of 100 ng/ml LPS for 48 h. The cDNA were prepared using total RNA as template and random hexamers as primers. The amount of cytokine mRNA was determined based on PCR reactions. With the exception of primers for macrophage DC-derived chemokine (MDC) (forward ATGGCTACCCTGGGTG; reverse CTAGGACAGTTTATGG), the primer sequence and experimental protocol have been described (20).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Isolation of monocyte clones from a p53-/-Stat-1-/- mouse with a DC lymphoma

In the process of analyzing the immune surveillance of cancer in >200 mice with targeted mutation of both p53 and Stat-1 genes, we came across a case of diffuse DC lymphoma. The mouse was moribund with splenomegaly and infiltrations of tumor cells in multiple organs including kidney, liver, lung, and lymph nodes. The spleen cells harvested had the typical morphology of DC. To confirm this, we analyzed cell phenotypes by flow cytometry (Fig. 1a). Essentially, all of the cells isolated from the spleen expressed DC markers, such as CD11c, DEC-205, CD8{alpha} (but not CD8{beta}), MHC class II, and co-stimulatory molecules B7-1 (CD80), B7-2 (CD86), CD40, CD24, and CD44. The phenotypes suggested that they belonged to the CD8{alpha}+ DC subset. However, in contrast to the typical CD8{alpha}+ DC (3), these cells also expressed a number of monocyte/macrophage markers, including low levels of CD11b, F4/80, and CD16/32, although not CD14 (Fig. 1a). Immunohistochemical staining of spleen sections revealed that all of the tumor cells expressed CD11c, DEC-205, and CD8{alpha} but not B220 or Thy1 (data not shown). Similarly, the tumor cells that infiltrated tissues, such as livers, expressed both CD8{alpha} and CD11c (Fig. 1b) as well as DEC-205 (data not shown).



View larger version (63K):
[in this window]
[in a new window]
 
FIGURE 1. Phenotypes of a DC lymphoma from a p53- and Stat-1-deficient mouse. a, Flow cytometry analysis of spleen cells. Spleen cells were isolated from a male mouse (M9) bearing lymphoma and were stained with indicated Abs. Open histograms represent either fluorochrome-conjugated isotype control for direct staining or nonconjugated isotype mAb plus FITC-labeled secondary Ab as negative control for indirect staining. The shaded histograms represent profiles of specific Ab staining. b, Immunohistochemical analysis of liver-infiltrating lymphoma cells. Formalin-fixed liver sections were prepared and stained with H&E (upper left) and frozen sections with mAb to CD11c (upper right) or CD8{alpha} (lower left) or isotype-matched mAb (lower right).

 
To isolate DC clones or lines, we cultured M9 cells (10 x 106/75 cm2 flask) and monitored their function and phenotypes. Initially, M9 cells were loosely adherent, grew slowly, and became confluent at 4–6 wk of culture. After one or two passages, the level of CD11c, CD8{alpha}, and I-A{beta} on M9 cells was reduced progressively (data not shown). At 1 year after the initial culture, essentially all cell surface DC markers disappeared (data not shown).

We cloned M9 cells by limiting dilution using either ex vivo M9 cells (after recovery from liquid nitrogen) or the 6-wk-old cultured M9 cells. Individual clones were recovered 4 wk later. Twenty-one clones were obtained from ex vivo M9 cells, and four clones were obtained from 6-wk-old M9 cells. Among the 21 clones isolated directly from ex vivo DC lymphoma, 18 (87%) clones expressed various levels of CD11c, CD8{alpha}, and I-A{beta}, whereas three clones expressed no DC markers or lineage markers (data not shown). All four clones from 6-wk-old cultured DC also expressed low but detectable CD11c, CD8{alpha}, and I-A{beta} (data not shown). All (n = 22) clones that expressed DC markers were adherent. They became nonadherent when they grew in high density. In all cases, even cloned cells were heterogeneous in their expression of these markers, and after two more passages in vitro all clones lost the DC markers. Because this occurred in all of the clones analyzed, the loss of DC markers is not caused by an overgrowth of non-DC present in the spleen of the M9 mouse.

Essentially, all of the stable clones displayed the cell surface phenotype of monocytes. The phenotype of a representative clone, 2C8, is depicted in Fig. 2. The characteristic DC markers CD11c, DEC205, CD8{alpha}, I-A{beta}, B7-1, and CD40 had all but disappeared, although B7-2 continued to be stably expressed on the 2C8 cells (Fig. 2a) and other cloned cells (data not shown). In contrast, expression of the monocyte markers, such as CD11b, F4/80, CD14, VLA-4, and CD16/32 increased somewhat in comparison to the ex vivo lymphoma cells (Fig. 1). However, 2C8 and most other clones maintained a DC-like morphology. Both adherent (Fig. 2b, top) and nonadherent (Fig. 2b, bottom) cells had long processes. Moreover, the cell clones could efficiently phagocytose the fluorescent microbeads (Fig. 2c).



View larger version (62K):
[in this window]
[in a new window]
 
FIGURE 2. Phenotypes and morphology of cloned M9 cells. a, Cloned M9 cells exhibited monocytic phenotypes. An M9 clone (2C8) was stained with indicated mAbs and analyzed by flow cytometry. Open histograms depict control staining as described in Fig. 1a, whereas the shaded histograms represent profiles of binding by specific mAbs. b, A phase contrast microphotograph of 2C8 in culture; top: morphology of adherent cells (x40), bottom: morphology of nonadherent cells (x100). Arrows indicate the long processes of nonadherent cells. This morphology is representative of the majority of 22 clones established. c, Phagocytosis of fluorescent microbeads by cloned M9 cells. 2C8 cells (1 x 106) were incubated with 5-µl microbeads in 1.0 ml RPMI medium at 37°C for 30 min, washed three times, and fixed in 1% paraformaldehyde in PBS. The samples were examined under a fluorescent microscope. The top shows a fluorescent micrograph under a dark field, whereas the bottom shows the same cells under a bright field.

 
Whereas cloned M9 cells expressed barely detectable cell-surface MHC class II molecules, we detected intracellular I-A{beta} molecules in all seven clones examined by flow cytometry (Fig. 3a) and fluorescent microscopy (Fig. 3b). Moreover, the cloned cells can stimulate proliferation of allogeneic T cells from unprimed mice, especially when a low dose of IL-2 is added (Fig. 3c). Thus, whereas cloned M9 cells mainly expressed monocyte/macrophage markers, they have certain functional characteristics of immature DC.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 3. Expression of MHC class II and stimulation of unprimed spleen T cells by 2C8 cells. a, Intracellular expression of I-A{beta} molecules in cloned M9 cells. 2C8 cells, which were devoid of cell surface MHC class II (Fig. 2a), were permeabilized and stained with PE-conjugated anti-I-A{beta} mAb or mAb to keyhole limpet hemocyanin as control and were analyzed by flow cytometry. b, Verification of intracellular localization of I-A{beta} by fluorescent microscopy. Isotype control mAb staining is shown on the left, whereas the staining of anti-I-A{beta} is presented on the right. c, Stimulation of unprimed allogeneic T cells by 2C8. Various numbers of irradiated 2C8 (H-2b) cells or spleen cells from C57BL/6 (H-2b) mice were cocultured with T cells from BALB/c (H-2d) mice in the presence or absence of suboptimal IL-2 (3 ng/ml) for 96 h. The proliferation was measured by incorporation of [3H]TdR. The data shown are representative of three similar experiments using two independent clones from M9 cells.

 
Induction of M9 cell differentiation in vitro and in vivo

We have attempted to use the cytokines GM-CSF, IL-4, TNF-{alpha}, LPS, and PGE2 to induce differentiation of M9 cells to DC. Whereas I-A{beta} and B7-1 were consistently up-regulated upon stimulation by cytokines or inflammatory stimuli, the consistent induction of CD11c and CD8{alpha} expression was not observed with these stimuli (data not shown). Consistent with a major function of CD40 in DC maturation (21, 22, 23), we observed significant induction of MHC class II by CD40L-transfected fibroblasts (Fig. 4a). However, optimal induction of CD11c and CD8{alpha} requires both CD40L and LPS, which have been demonstrated to be potent inducers of DC maturation (24, 25, 26, 27, 28). Consistent with the expression of cell surface markers, the 3B11 cell line stimulated by the CD40L in conjunction with LPS induced significantly stronger proliferation of allogeneic T cells (Fig. 4b). With regard to cytokine expression, the monocyte clones expressed significant levels of IL-1{beta}, IL-6, and IL-10 constitutively. In response to LPS stimulation, a substantial increase in the expression of IL-1{alpha}, IL-12, and MDC were observed (Fig. 4c), which is consistent with one of the features of DC maturation.



View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 4. Induction of maturation of and cytokine expression by the monocyte clones 2C8 and/or 3B11. a, Synergistic activity of CD40L and LPS in the induction of cell surface expression of CD11c, CD8{alpha}, and I-A{beta} on cloned M9 cells. Cells from clone 3B11 were cocultured (1 x 106/well) with irradiated (3000 rad) CD40L-transfected 3T3 cells (1 x 105/well) in 24-well plates for 4 days. Then, LPS (1 µg/ml) was added, and the cultures were maintained for 2 more days. The cells were harvested on day 6 and stained with fluorochrome-conjugated mAbs to CD11c, I-A{beta}, or CD8{alpha}. 3B11 cells were cultured with either medium alone (none), CD40L-transfected cells (CD40L), or LPS alone. Data shown are representative of three independent experiments. b, Proliferation of allogeneic T cells. The DC matured as described (a) were harvested and washed extensively to remove LPS. They were then irradiated (3000 rad) and used (1250 cells/well) to induce proliferation of BALB/c (H-2d) T cells (4 x 105/well) for 90 h. The cultures were pulsed with [3H]TdR (1 µci/well) during the last 16 h. Data shown were means ± SD of triplicate cultures. T cells cultured without DC had incorporation of 3053 ± 70.2 cpm. c, Analysis of cytokine production in response to LPS-stimulation. Two monocyte clones (3B11 and 2C8) were cultured in the presence or absence of LPS (100 ng/ml) for 48 h. The RNA was prepared, and expression of given cytokines was analyzed by RT-PCR.

 
It has been elegantly demonstrated that tissue macrophages can differentiate into DC upon migration to lymph nodes (29). To test the differentiation potential of the M9 cells in vivo, we injected two clones, 2C8 and 3B11 cells (H-2b, CD45.2) i.p. or s.c. into the footpads of congenic B6 mice (H-2b, CD45.1). The phenotypes of 2C8 or 3B11 cells were analyzed 5 days after adoptive transfer. To increase the frequency of adoptively transferred cells among the events analyzed, we set an acquisition gate to exclude small lymphocytes. Adoptively transferred 2C8 or 3B11 cells were identified with anti-CD45.2 mAb (Fig. 5, top) and were analyzed for expression of CD11c vs CD8{alpha} and I-A{beta} vs CD8{alpha} by three-color flow cytometry. As shown in Fig. 5a, left, ~4% of 2C8 cells in the peritoneal cavity expressed CD11c, and <1% of them expressed CD8{alpha}. The cells appeared to have undergone some differentiation, as significant levels of I-A{beta} were detected on ~30% of the cells. Substantial numbers of 2C8 cells were found in the spleen and draining MLN. In the spleen, ~15% of the 2C8 cells expressed CD11c. Expression of MHC class II was less in 2C8 cells found in the spleen than of those found in the peritoneal cavity. Among the 2C8 cells that migrated into the draining lymph nodes, 40% expressed CD11c, whereas 80% expressed cell surface MHC class II (Fig. 5a, right). Similar increases in expression of CD8{alpha} were found in the 2C8 cells harvested from draining lymph nodes.



View larger version (73K):
[in this window]
[in a new window]
 
FIGURE 5. Differentiation of cloned M9 cells into CD8{alpha}+ DC in vivo. M9 clones 2C8 or 3B11 were injected i.p. (5 x 106/mouse) or s.c. (1 x 106/mouse into right footpad) into congenic male CD45.1 B6 mice (H-2b) (n = 5/group). The mice were sacrificed 5 days later, and cells were harvested from the peritoneal cavity, the spleen, and draining MLN of mice that received an i.p. injection (a) and from PLN of mice that received a s.c. injection (b). The cells were stained with FITC-conjugated anti-mouse CD45.2, PE-conjugated anti-mouse CD8{alpha}, CD11c, or I-A{beta} CyChrome-conjugated anti-mouse CD8{alpha} and/or APC-conjugated anti-mouse CD11b, depending on the combination shown. Lymphocytes were excluded by acquisition gate. The donor cells were identified by their CD45.2 marker (histogram). a, Shows in vivo differentiation of 2C8 cells after i.p. injection. The results were similar to 3B11 cells (data not shown). b, Shows in vivo differentiation of 2C8 and 3B11 cells after s.c. injection. They had a similar differentiation pattern (not completely shown). The numbers in the quadrants or histograms represent percentages of gated populations. The marker lines were set based on isotype controls. The data shown are representative of three independent experiments.

 
The in vivo maturation of the 2C8 and 3B11 clones into DC appeared even more efficiently when they were injected s.c., as shown in Fig. 5b. In experiment 1 we analyzed the expression of CD8{alpha} vs CD11c and CD8{alpha} vs I-A{beta}. In this analysis, 70% of 2C8 cells expressed CD11c on the cell surface, and 90% of 2C8 cells found in the draining lymph nodes expressed I-A{beta}. Expression of CD8{alpha} varied from 20 to 50% between experiments. Expression of distinct cell surface markers among 2C8 cells recovered from different lymphoid tissue provides strong support for the thesis that migration of DC is coupled with its maturation (29, 30, 31). It is worth noting that despite expression of CD8{alpha}, CD11c, and MHC class II, the overwhelming majority (>85%) of the 2C8 or 3B11 cells recovered in the draining lymph nodes retained expression of CD11b (Fig. 5b, Expt. 2).

These results raised the issue of whether the monocyte clones could differentiate into the typical CD8{alpha}+CD11c+CD11b- DC in vivo. To address this issue, we injected the 2C8 cells s.c. into the CD45.1 congenic mice and analyzed the donor CD45.2 cells for the expression of CD8{alpha}, CD11b, and CD11c. Essentially all of the CD8{alpha}+CD45.2+ cells expressed CD11c. Most of them also expressed CD11b. Only ~5% of CD8{alpha}+ DC differentiated into the CD8{alpha}+CD11b-CD11c+ subset that expressed an intermediate level of CD11c. Among the CD8{alpha}-CD45.2+ cells, ~24% expressed CD11c. As expected, most of the CD11c+ cells coexpressed CD11b (data not shown). Thus, a single monocyte clone can give rise to at least four subsets of CD11c+ DC: CD8{alpha}+CD11b+, CD8{alpha}+CD11b-, CD8{alpha}-CD11b+, and CD8{alpha}-CD11b-.

DC differentiation correlates with significant priming of allogeneic T cells in the draining lymph nodes

To test the functional consequence of DC maturation in vivo, we examined whether this differentiation led to T cell priming. 2C8 or 3B11 (H-2b) cells were injected s.c. into the right footpad of BALB/c mice (H-2d). The left footpad was injected with PBS as a control. The mice were sacrificed 5 days after injection, and PLN and the spleen were collected. We found that the right PLN were enlarged, whereas the left PLN remained unchanged. The cell number in the draining PLN increased by >10-fold in comparison to the nondraining left PLN (data not shown). We then compared the proliferative response of the T cells recovered from different lymph nodes. When a limited number of responders and spleen cell stimulators were used, the lymph node or spleen T cells from unprimed mice mounted a poor proliferative response. However, T cells isolated from either the spleen or local draining lymph nodes of the primed mice mounted a strong proliferative response. In contrast, T cells from nondraining lymph nodes of the primed mice also failed to respond (Fig. 6a). Corresponding to the proliferative response, we also observed a substantial increase of cytokine-producing cells in the draining lymph nodes (Fig. 6b). Upon in vitro restimulation, 12.5-fold more CD8+ T cells from draining lymph nodes than those from nondraining lymph nodes produced IFN-{gamma}. Likewise, 2.5-fold more CD4+ T cells from draining lymph nodes than those from nondraining lymph nodes produced IFN-{gamma}. Overall, the CD4+ T cell responded poorly in comparison with the CD8+ T cells. Few IL-2-, IL-4-, and IL-10-producing cells were detected in the CD4 and CD8 T cells (data not shown).



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 6. In vivo priming allogeneic T cells by cloned M9 cells. a, T cell proliferation in vitro from mice primed by M9 cells. Cloned M9 cells (3B11) were injected s.c. (1 x 106/mouse) at the right footpad of BALB/c mice (n = 5/group). The mice were sacrificed on day 5, and draining popliteal (LN-R), nondraining popliteal (LN-L), lymph node cells, and splenocytes were harvested. Spleen (N-SPL) and lymphoid node (LN-N) T cells from normal BALB/c mice were used as nonpriming control. Various numbers of purified T cells from BALB/c mice were cocultured with irradiated splenocytes (2 x 105/well) from normal B6 mice for 60 h. The cultures were pulsed with 0.5 µCi [3H]thymidine 16 h before harvesting. The data shown are means of triplicates and are representative of at least three experiments. b, Analysis of the cytokine-producing cells in DC primed T cell culture. As in a, except that the T cells from draining or nondraining nodes were cultured in 24-well plates for 4 days in the presence of IL-2 (5 ng/ml). The cells were then stimulated with PMA (50 ng/ml) and ionomycin (500 ng/ml) for 6 h in the presence of Golgi blocker before intracellular staining with the fluorochrome-conjugated mAbs. The data shown are representative of three independent experiments.

 
A DC subset expressing both CD8{alpha} and CD11b in WT and p53-/-Stat-1-/- mice

Most of the M9-derived CD8+ DC coexpressed both CD11b and CD8{alpha}. Because the clones were derived from a Stat-1-/-p53-/- DC lymphoma, it is of interest to test whether similar cells are present in nonmalignant DC, and if so, whether generation of these cell types is affected by the defects in p53 and Stat-1 genes. To address this issue we analyzed the expression of CD8{alpha} on CD11b+ and CD11c+ cells in both WT and p53-/-Stat-1-/- mouse spleen cells. Again, we excluded lymphocytes (based on cellular scatters) for this analysis to avoid the complication of CD8 T cells and to enrich the events associated with DC. As shown in Fig. 7, both CD11c+ and CD11b+ cells can be divided into four major subsets based on the expression of I-A{beta} and CD8{alpha}. I-A{beta}- cells were generally devoid of CD8{alpha}high molecules, which indicated that we had gated out essentially all of the CD8 T cells. The I-A{beta}+ cells can be divided into three major subsets based on the level of CD8{alpha}, namely negative (-), low (lo), and high (hi) (Fig. 7b). The summary of data from four WT or six knockout mice per group revealed that mutations in p53 and Stat-1 had no effect on the frequency of the three subsets, regardless of whether CD11c+ or CD11b+ cells were compared (Fig. 7b). Consistent with the general finding that most of the CD8{alpha}+ DC were CD11b-, the proportion of CD8high cells was greater among the CD11c+ than among the CD11b+ cells. However, among the cells with lower levels of CD8, similar proportions fell into CD11c+ and CD11b+ subsets. Thus, CD11c+CD11b+CD8{alpha}+ DC are not artifacts, neither of malignancy nor of defects in p53 and Stat-1 genes.



View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 7. Expression of CD8{alpha} vs I-A{beta} on CD11c+ and CD11b+ in both WT Stat-1-/-p53-/- mice. a, Splenocytes from WT or Stat-1-/-p53-/- mice were stained with FITC-conjugated anti-mouse CD11c or CD11b, PE-conjugated anti-mouse I-A{beta} and CyChrome-conjugated anti-mouse CD8{alpha} and analyzed by three-color flow cytometry. After excluding lymphocytes based on their cellular scatters, CD11c+ or CD11b+ cells were gated and analyzed for expression of CD8{alpha} vs I-A{beta}. Numbers in the panels are the percentages of the following: I-A{beta}+CD8{alpha}high (upper panel), I-A{beta}+CD8{alpha}low (middle panel), or I-A{beta}+CD8{alpha}- (lower panels). b, Summary of data in a. The means ± SD from four (WT) or six (mutant) mice are shown.

 
In addition, substantial numbers of CD11c+I-A{beta}- cells were observed. This is surprising, but reproducible (Fig. 7). Further work indicated that some monocytes and NK cells expressed CD11c (data not shown).

In vitro cultured WT monocytes and PEM differentiated into CD8{alpha}+ DC in vivo

A critical issue is whether WT monocytes can differentiate into CD8{alpha}+ DC in vivo. Because it is technically difficult to isolate sufficient numbers of mouse monocytes with adequate purity for adoptive transfer studies, we used monocytes cultured from spleens. As we have reported, after splenocytes are stimulated with irradiated allogeneic splenocytes, a large number of cells with monocytic characteristics can be generated after 2–3 mo of in vitro culture (18). As shown in Fig. 8a, harvested cells have the morphology of monocytes as determined by Wright/Giemsa staining. The viable cells expressed high levels of monocytic marker CD11b, but not CD8{alpha}. A low level of CD11c was detected (Fig. 8b). In addition, we have reported that the in vitro cultured cells expressed additional monocytic markers, including F4/80, Mac-2, Mac-3, and FcR (18). Therefore, we transferred these cells into CD45.1 congenic mice and analyzed the phenotype of the CD45.2+ donor cells by flow cytometry.



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 8. Differentiation of monocytes cultured from WT mouse spleens into CD8{alpha}+CD11c+ DC in vivo. The cultured spleen monocytes (C57BL/6, CD45.2) were injected s.c. into footpads (1.5 x 106/site) of congenic mice (CD45.1). The recipient mice were sacrificed on day 4 to harvest draining lymph nodes (PLN). The cells were stained with FITC-conjugated anti-CD45.2, PE-conjugated anti-CD11c, or CD8{alpha}, and APC-conjugated anti-CD8{alpha}, or CD11b mAbs, or isotype-matched control mAbs, all in three-color combination and analyzed by flow cytometry. a, The morphology of in vitro-cultured monocytes was determined by Wright/Giemsa staining after cytospin. b, Phenotypes of the monocyte culture before injection. Note the absence of CD8{alpha} expression. c, Phenotypes of the donor cells recovered from the recipient lymph nodes. Histograms (left) and two-color dot plots (right) of the CD45.2+ cells gated in large forward scatter, depicting the expression of CD11b, CD8{alpha}, and high levels of CD11c. The open histograms depict isotype-matched control, whereas the filled histograms represent the profiles of specific Ab bindings. The percentages of CD11chighCD8{alpha}+, CD11clowCD8{alpha}+, CD11bhighCD8{alpha}+, and CD11blowCD8{alpha}+ cells are indicated. Data shown are obtained from pooled draining lymph nodes of five mice.

 
At 4 days after adoptive transfer, a large proportion of the transferred cells expressed significantly higher levels of CD11c. More importantly, a substantial population expressed high levels of CD8{alpha} (Fig. 8c, left). The CD8{alpha}+ cells consist of CD11c+CD8{alpha}+ and CD11b+CD8{alpha}+ populations (Fig. 8c, right), which are analogous to DC clones used in the study.

To determine whether primary uncultured monocytes/macrophages can also differentiate into CD8{alpha}+ cells, we adoptively transferred PEM that were thioglycolate elicited, harvested at day 5–7, and depleted of CD11c+ and CD8{alpha}+ cells, into the footpad of congenic mice (Fig. 9). Four days later, draining lymph nodes were harvested and examined for expression of CD45.2, CD11c, CD11b, and CD8{alpha}. As shown in Fig. 9a, all donor cells expressed CD11b, but not CD11c and CD8{alpha} before adoptive transfer. About 9% of the gated large cells expressed CD45.2. Fifteen percent of the CD45.2+ cells differentiated into CD11b+CD11c+ cells. Among them, 40% expressed CD8{alpha}. In addition, 21% of the donor cells differentiated into the CD11b+CD11clow subset, of which 4% expressed CD8{alpha}. Thus, monocytes with no defects in p53 and STAT-1 genes can differentiate into CD8{alpha}+ DC.



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 9. Differentiation of PEM into CD11c+CD8{alpha}+ cells in vivo. PEM were harvested on day 4, and CD11c+ and CD8{alpha}+ cells were depleted using magnetic biospheres. The cells (5 x 106/mouse) were injected s.c. into footpads of CD45.1+ B6 mice. The draining PLN were harvested 4 days after injection. a, Phenotypes of purified PEM. Open histograms are isotype-matched control; shaded histograms are Ag-specific mAb staining. b, Draining PLN cells were stained with FITC-conjugated anti-mouse CD45.2, PE-conjugated anti-CD11c, PerCP-conjugated anti-CD8{alpha}, and APC-conjugated anti-CD11b mAbs. Cells were gated on large light scatters and analyzed for the expression of CD45.2, CD11c, CD11b, and CD8{alpha}. Numbers in the figure represent the percentage of gated populations. The data shown are representative of at least three experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have used cloned cells of monocyte/macrophage lineage to show that these monocytes and/or macrophages can differentiate into both CD8{alpha}+ and CD8{alpha}- DC in vivo. This is not unique for the cell line derived from DC lymphoma, because both cultured splenic monocytes and uncultured PEM from WT mice can differentiate into CD11c+CD8{alpha}+ DC. Whereas the ability of monocytes/macrophages to differentiate into CD8{alpha}- DC has been elegantly demonstrated recently (29), our work appears to be the first direct evidence to suggest that monocytes can also be precursors of CD8{alpha}+ DC. Our results extend the notion that common myeloid progenitors have the potential to differentiate into CD8{alpha}+ DC in vivo (8) by showing a major myeloid cell type as a direct precursor for CD8{alpha}+ DC. Moreover, the fact that cloned monocytes can differentiate into DC with phenotypes of both "lymphoid" and "myeloid" lineages further underscore the plasticity of DC subsets.

It is worth noting that the monocyte clones were isolated from a CD8{alpha}+ DC lymphoma. This raises an intriguing possibility as to whether the differentiation of DC from monocytes is reversible. However, because Stat-1 and p53 genes have both been implicated in programmed cell death (12, 13, 14), it is also possible that differentiation from monocytes to DC is terminal in normal cells and that death of DC is prevented when the two genes are mutated.

We have observed that most of the DC derived from the monocyte clones co-express both CD11b and CD8{alpha}. A small but distinct population of monocyte-derived DC have lost CD11b but retained CD11c at 5 days of in vivo maturation. Because the monocytes expressed high levels of CD11b before injection, it is possible that the CD11b+CD11c+CD8{alpha}+ DC is the direct precursor of the CD11b-CD11c+CD8{alpha}+ DC, the major CD8{alpha}+ DC in the spleen. Consistent with this hypothesis, we observed that a significant number of endogenous CD11b+ cells express both CD8{alpha} and I-A on the cell surface, although most CD8{alpha}+ and I-A+ cells have a somewhat lower level of CD8{alpha} expression. Whereas this subset has not been formally recognized (32), published work by others has also indicated that a significant proportion of monocyte-derived DC (29) and Flt-3 ligand-induced DC (33) co-express CD11b and CD8{alpha}. More recent work (34, 35) from two independent laboratories has demonstrated that the CD11b+CD8{alpha}- cells can differentiate into CD11b+CD8{alpha}+ and CD11b-CD8{alpha}+ DC either upon adoptive transfer or upon uptake of virus-like particles in vivo.

Finally, utilization of DC lines has greatly facilitated the study of DC in mouse (36). However, to our knowledge, the immature DC cell lines were not of monocytic phenotypes and have not been demonstrated to differentiate into CD8{alpha}+ DC in vivo. The cell lines described in this study may have unique value in studying biology of the CD8{alpha}+ DC that mediates the cross-presentation of cell-associate Ags to cytotoxic T lymphocytes (10).


    Acknowledgments
 
We thank Jennifer Kiel and Lynde Shaw for secretarial assistance and Drs. Hong-zheng Hu and Xing-zheng Bao (Ohio State University Medical Center, Columbus, OH) for assistance with photography.


    Footnotes
 
1 This work is supported by grants from the National Institutes of Health (AI32981, CA58033, CA69091, and CA82355). X.L. is supported by National Institutes of Health Training Grant T32CA90223. Back

2 Address correspondence and reprint requests to Drs. Yang Liu or Pan Zheng, Department of Pathology and Comprehensive Cancer Center, Ohio State University Medical Center, 129 Hamilton Hall, 1645 Neil Avenue, Columbus, OH 43210. E-mail address: liu-3{at}medctr.osu.edu Back

3 Abbreviations used in this paper: DC, dendritic cell; PEM, peritoneal exudates macrophage; MLN, mesenteric lymph node; PLN, popliteal lymph node; PEC, peritoneal cavity exudate cell; WT, wild type; MDC, macrophage DC-derived chemokine. Back

Received for publication November 21, 2002. Accepted for publication April 1, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Steinman, R. M.. 1991. The dendritic cell system and its role in immunogenicity. Annu. Rev. Immunol. 9:271.[Medline]
  2. Banchereau, J., R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245.[Medline]
  3. Liu, Y. J., H. Kanzler, V. Soumelis, M. Gilliet. 2001. Dendritic cell lineage, plasticity, and cross-regulation. Nat. Immunol. 2:585.[Medline]
  4. Vremec, D., J. Pooley, H. Hochrein, L. Wu, K. Shortman. 2000. CD4 and CD8 expression by dendritic cell subtypes in mouse thymus and spleen. J. Immunol. 164:2978.[Abstract/Free Full Text]
  5. Banchereau, J., F. Briere, C. Caux, J. Davoust, S. Lebecque, Y. J. Liu, B. Pulendran, K. Palucka. 2000. Immunobiology of dendritic cells. Annu. Rev. Immunol. 18:767.[Medline]
  6. Vremec, D., M. Zorbas, R. Scollay, D. J. Saunders, C. F. Ardavin, L. Wu, K. Shortman. 1992. The surface phenotype of dendritic cells purified from mouse thymus and spleen: investigation of the CD8 expression by a subpopulation of dendritic cells. J. Exp. Med. 176:47.[Abstract/Free Full Text]
  7. Ardavin, C., L. Wu, C. L. Li, K. Shortman. 1993. Thymic dendritic cells and T cells develop simultaneously in the thymus from a common precursor population. Nature 362:761.[Medline]
  8. Traver, D., K. Akashi, M. Manz, M. Merad, T. Miyamoto, E. G. Engleman, I. L. Weissman. 2000. Development of CD8{alpha}-positive dendritic cells from a common myeloid progenitor. Science 290:2152.[Abstract/Free Full Text]
  9. Maldonado-Lopez, R., T. De Smedt, P. Michel, J. Godfroid, B. Pajak, C. Heirman, K. Thielemans, O. Leo, J. Urbain, M. Moser. 1999. CD8{alpha}+ and CD8{alpha}- subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J. Exp. Med. 189:587.[Abstract/Free Full Text]
  10. den Haan, J. M., S. M. Lehar, M. J. Bevan. 2000. CD8+ but not CD8- dendritic cells cross-prime cytotoxic T cells in vivo. J. Exp. Med. 192:1685.[Abstract/Free Full Text]
  11. Akashi, K., D. Traver, T. Miyamoto, I. L. Weissman. 2000. A clonogenic common myeloid progenitor that gives rise to all myeloid lineages. Nature 404:193.[Medline]
  12. Lowe, S. W., E. M. Schmitt, S. W. Smith, B. A. Osborne, T. Jacks. 1993. p53 is required for radiation-induced apoptosis in mouse thymocytes. Nature 362:847.[Medline]
  13. Clarke, A. R., C. A. Purdie, D. J. Harrison, R. G. Morris, C. C. Bird, M. L. Hooper, A. H. Wyllie. 1993. Thymocyte apoptosis induced by p53-dependent and independent pathways. Nature 362:849.[Medline]
  14. Stephanou, A., B. K. Brar, T. M. Scarabelli, A. K. Jonassen, D. M. Yellon, M. S. Marber, R. A. Knight, D. S. Latchman. 2000. Ischemia-induced STAT-1 expression and activation play a critical role in cardiomyocyte apoptosis. J. Biol. Chem. 275:10002.[Abstract/Free Full Text]
  15. Durbin, J. E., R. Hackenmiller, M. C. Simon, D. E. Levy. 1996. Targeted disruption of the mouse Stat1 gene results in compromised innate immunity to viral disease. Cell 84:443.[Medline]
  16. Wu, Y., Y. Guo, Y. Liu. 1993. A major costimulatory molecule on antigen-presenting cells, CTLA4 ligand A, is distinct from B7. J. Exp. Med. 178:1789.[Abstract/Free Full Text]
  17. Wu, Y., J. Xu, S. Shinde, I. Grewal, T. Henderson, R. A. Flavell, Y. Liu. 1995. Rapid induction of a novel costimulatory activity on B cells by CD40 ligand. Curr. Biol. 5:1303.[Medline]
  18. Gao, J. X., J. Madrenas, W. Zeng, R. Zhong, D. Grant. 1997. Generation of dendritic cell-like antigen-presenting cells in long-term mixed leucocyte culture: phenotypic and functional studies. Immunology 91:135.[Medline]
  19. Gao, J.-X., H. Zhang, X. F. Bai, J. Wen, X. Zheng, J. Liu, P. Zheng, Y. Liu. 2002. Peripheral blockade of B7-1 and B7-2 inhibits clonal deletion of highly pathogenic autoreactive T cells. J. Exp. Med. 195:959.[Abstract/Free Full Text]
  20. Gao, J. X., J. Madrenas, W. Zeng, M. J. Cameron, Z. Zhang, J. J. Wang, R. Zhong, D. Grant. 1999. CD40-deficient dendritic cells producing interleukin-10, but not interleukin-12, induce T-cell hyporesponsiveness in vitro and prevent acute allograft rejection. Immunology 98:159.[Medline]
  21. Bennett, S. R., F. R. Carbone, F. Karamalis, R. A. Flavell, J. F. Miller, W. R. Heath. 1998. Help for cytotoxic-T-cell responses is mediated by CD40 signalling. Nature 393:478.[Medline]
  22. Ridge, J. P., F. Di Rosa, P. Matzinger. 1998. A conditioned dendritic cell can be a temporal bridge between a CD4+ T-helper and a T-killer cell. Nature 393:474.[Medline]
  23. Schoenberger, S. P., R. E. Toes, E. I. van der Voort, R. Offringa, C. J. Melief. 1998. T-cell help for cytotoxic T lymphocytes is mediated by CD40-CD40L interactions. Nature 393:480.[Medline]
  24. Granucci, F., E. Ferrero, M. Foti, D. Aggujaro, K. Vettoretto, P. Ricciardi-Castagnoli. 1999. Early events in dendritic cell maturation induced by LPS. Microbes Infect. 1:1079.[Medline]
  25. Cella, M., F. Sallusto, A. Lanzavecchia. 1997. Origin, maturation and antigen presenting function of dendritic cells. Curr. Opin. Immunol. 9:10.[Medline]
  26. Cella, M., D. Scheidegger, K. Palmer-Lehmann, P. Lane, A. Lanzavecchia, G. Alber. 1996. Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation. J. Exp. Med. 184:747.[Abstract/Free Full Text]
  27. Morelli, A. E., A. F. Zahorchak, A. T. Larregina, B. L. Colvin, A. J. Logar, T. Takayama, L. D. Falo, A. W. Thomson. 2001. Cytokine production by mouse myeloid dendritic cells in relation to differentiation and terminal maturation induced by lipopolysaccharide or CD40 ligation. Blood 98:1512.[Abstract/Free Full Text]
  28. Kelleher, M., P. C. Beverley. 2001. Lipopolysaccharide modulation of dendritic cells is insufficient to mature dendritic cells to generate CTLs from naive polyclonal CD8+ T cells in vitro, whereas CD40 ligation is essential. J. Immunol. 167:6247.[Abstract/Free Full Text]
  29. Randolph, G. J., K. Inaba, D. F. Robbiani, R. M. Steinman, W. A. Muller. 1999. Differentiation of phagocytic monocytes into lymph node dendritic cells in vivo. Immunity 11:753.[Medline]
  30. Randolph, G. J., S. Beaulieu, S. Lebecque, R. M. Steinman, W. A. Muller. 1998. Differentiation of monocytes into dendritic cells in a model of transendothelial trafficking. Science 282:480.[Abstract/Free Full Text]
  31. Randolph, G. J.. 2001. Dendritic cell migration to lymph nodes: cytokines, chemokines, and lipid mediators. Semin. Immunol. 13:267.[Medline]
  32. Shortman, K., Y. J. Liu. 2002. Mouse and human dendritic cell subtypes. Nat. Rev. Immunol. 2:151.[Medline]
  33. O’Connell, P. J., W. Li, Z. Wang, S. M. Specht, A. J. Logar, A. W. Thomson. 2002. Immature and mature CD8{alpha}+ dendritic cells prolong the survival of vascularized heart allografts. J. Immunol. 168:143.[Abstract/Free Full Text]
  34. Moron, G., P. Rueda, I. Casal, C. Leclerc. 2002. CD8{alpha}- CD11b+ dendritic cells present exogenous virus-like particles to CD8+ T cells and subsequently express CD8{alpha} and CD205 molecules. J. Exp. Med. 195:1233.[Abstract/Free Full Text]
  35. Martinez del Hoyo, G., P. Martin, C. F. Arias, A. R. Marin, C. Ardavin. 2002. CD8{alpha}+ dendritic cells originate from the CD8{alpha}- dendritic cell subset by a maturation process involving CD8{alpha}, DEC-205, and CD24 up-regulation. Blood 99:999.[Abstract/Free Full Text]
  36. Paglia, P., G. Girolomoni, F. Robbiati, F. Granucci, P. Ricciardi-Castagnoli. 1993. Immortalized dendritic cell line fully competent in antigen presentation initiates primary T cell responses in vivo. J. Exp. Med. 178:1893.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
L. Chen, E. Calomeni, J. Wen, K. Ozato, R. Shen, and J.-X. Gao
Natural killer dendritic cells are an intermediate of developing dendritic cells
J. Leukoc. Biol., June 1, 2007; 81(6): 1422 - 1433.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
P. S. Joshi, J.-Q. Liu, Y. Wang, X. Chang, J. Richards, E. Assarsson, F.-D. Shi, H.-G. Ljunggren, and X.-F. Bai
Cytokine-induced killer T cells kill immature dendritic cells by TCR-independent and perforin-dependent mechanisms
J. Leukoc. Biol., December 1, 2006; 80(6): 1345 - 1353.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
R. J. Steptoe, J. M. Ritchie, L. K. Jones, and L. C. Harrison
Autoimmune Diabetes Is Suppressed by Transfer of Proinsulin-Encoding Gr-1+ Myeloid Progenitor Cells That Differentiate In Vivo Into Resting Dendritic Cells
Diabetes, February 1, 2005; 54(2): 434 - 442.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gao, J.-X.
Right arrow Articles by Zheng, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gao, J.-X.
Right arrow Articles by Zheng, P.
Right arrowPubmed/NCBI databases
Medline Plus Health Information
*Stem Cells


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS