|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+ Dendritic Cells (DC) Suggests that Monocytes Can Be Direct Precursors for Both CD8
+ and CD8
- DC in the Mouse1

* Division of Cancer Immunology, Department of Pathology and Comprehensive Cancer Center, and
Department of Pediatrics and Childrens Research Institute, Ohio State University Medical Center, Columbus, OH 43210
| Abstract |
|---|
|
|
|---|
+ DC had been designated as "lymphoid" DC, and CD8
- DC as "myeloid" DC until recently when it was demonstrated that common myeloid progenitors can also give rise to CD8
+ DC in bone marrow chimera mice. However, it is still not clear which committed myeloid lineages differentiate into CD8
+ DC. Because monocytes can differentiate into DC in vivo, the simplest hypothesis is that the CD8
+ DC can be derived from the monocyte/macrophage. In this study we show that cell clones, isolated from CD8
+ DC lymphoma but with a monocytic phenotype (CD11clow/-D11bhighCD8
-I-Alow), can redifferentiate into CD8
+ DC either when stimulated by LPS and CD40L or when they migrate into the lymphoid organs. Maturation of DC in vivo correlated with strong priming of allogeneic T cells. Moreover, the monocytes from cultured splenocytes or peritoneal exudates macrophages of wild-type mice are also capable of differentiating into CD11c+CD8
+ DC after their migration into the draining lymph nodes. Our results suggest that monocytes can be direct precursors for CD11c+CD8
+ DC in vivo. In addition, the monocyte clones described in this study may be valuable for studying the differentiation and function of CD8
+ DC that mediate cross-presentation of Ag to CD8 T cells specific for cell-associate Ags. | Introduction |
|---|
|
|
|---|
In the mouse, one of the important DC subset markers is CD8
. It was initially suggested that two main DC lineages, i.e., lymphoid and myeloid DC, can be distinguished based on their cell-surface expression of CD8
(6, 7). Lymphoid DC express CD8
, whereas myeloid DC do not. However, this concept has been challenged recently, as Traver et al. (8) showed that both common lymphoid progenitors and common myeloid progenitors can develop into CD8
+ DC after adoptive transfer into congenic mice. Nevertheless, significant functional differences between the CD8
+ and CD8
- DC have been reported. Maldonado-Lopez et al. (9) proposed that CD8
+ and CD8
- DC induce Th1 and Th2 immune responses, respectively; den Haan et al. (10) reported that CD8
+ DC have the unique ability to cross-present cell-associated Ags via the MHC class I pathway.
These important functional distinctions make it necessary to study the developmental pathway of CD8
+ DC in detail. Whereas it is known that common myeloid progenitors can differentiate into different lineages of myeloid cells (11), the immediate precursor for CD8
+ myeloid DC have yet to be identified. A confounding factor in this area is that because of a scarcity of DC and monocyte clones, heterogeneous populations of cells are used for essentially all studies pertaining to the lineage relationship among DC subsets. In the course of studying immune surveillance over cancer development, we encountered a case of DC lymphoma in mice with targeted mutations of both the Stat-1 and p53 genes. Cells from the spleen were comprised almost exclusively of CD11c+CD8
+ DC. Given the known roles of p53 and Stat-1 genes in programmed cell death (12, 13, 14), we attempted to obtain stable DC clones. Interestingly, over the course of culture only cells with monocytic phenotypes (CD11clow/-D11bhighCD8
-) could be obtained, either as the polyclonal or stable monoclonal cultures. Upon adoptive transfer into a syngeneic host, the cloned monocytic cells migrated into lymph nodes and differentiated into CD8
+ DC. Moreover, the monocytes from cultured splenocytes or peritoneal exudates macrophages (PEM) of wild-type (WT) mice are also capable of differentiating into CD11c+CD8
+ DC after their migration into the draining lymph nodes. These results provide direct evidence that monocytes can be immediate precursors for CD8
+CD11c+ DC. The monocyte clones may provide a valuable tool for the study of the molecular mechanisms of DC maturation and the function of CD8
+ DC.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6j mice with targeted mutations of both p53 and Stat-1 genes were produced by breeding p53-/- mice (The Jackson Laboratory, Bar Harbor, ME) with Stat-1-/- mice (15). The genotype of the mice was determined by PCR. The sequences of the three primers used for p53 locus are as follows: P53F, CCCGAGTATCTGGAAGACAG; P53R, ATAGGTCGGTTCAT; and Neo-F, GTTCGCCAGGCTCAA. The WT locus yields a band of 900 bp, whereas the mutant locus results in a band of 600 bp. The sequences for three primers for the Stat-1 gene are as follows: TAATGTTTCATAGTTGGATATCAT, GAGATAATTCACAAAATCAGAGAG, and CTGATCCAGGCAGGCGTTG. This primer combination yields 142 bp for WT locus and 342 for mutant locus.
Male C57BL/6j (H-2b) and BALB/c (H-2d) mice were purchased from the National Cancer Institute (Rockville, MD) and were used at 812 wk. CD45.1 B6 (B6SJL/PTPRCA; H-2b) mice were purchased from Taconic Farms (Germantown, NY) and were maintained in the University Laboratory Animal Research Facility at Ohio State University under specific pathogen-free conditions.
Abs and other reagents
The following fluorochrome-conjugated mAbs to mouse Ags were purchased from BD PharMingen (San Diego, CA): anti-CD3 (145-2C11), anti-CD4 (GK1.5), anti-CD8
(53-6.7), anti-CD8
(53-5.8), anti-CD11b (M1/70), anti-CD11c (N418), anti-CD14 (rmC5-3), anti-CD16/32 (2.4G2), anti-CD24 (M1/69), anti-CD40 (HM40-3); anti-CD44 (IM7), anti-CD45.1 (A20), anti-CD45.2 (104), anti-CD45R/B220 (RA3-6B2), anti-Thy1.2 (53-2.1), anti-Gr-1 (RB6-8C5), anti-I-A
b (AF6-120.1), and anti-H-2Db (KH95). The following unconjugated rat mAbs were generated from cell lines purchased from American Type Culture Collection (Rockville, MD) and purified from culture supernatant by protein G affinity chromatography: anti-DEC-205 (HB290), anti-macrophage (F4/80), and anti-VLA-4 (PS/2). The biotinylated anti-B7-2 (GL-1) hybridoma was a gift from Dr. R. Hodes (National Institutes of Health, Bethesda, MD). The biotinylated anti-B7-1 (3A12, hamster IgG) was produced in the laboratory as described (16). FITC-labeled donkey anti-rat IgG and goat anti-hamster IgG Abs were purchased from Jackson ImmunoResearch Laboratories (West Grove, PA). LPS was purchased from Sigma-Aldrich (St. Louis, MO). Yellow-green fluosphere carboxylate-modified microspheres (1.0 µm, catalog number F-8823) were purchased from Molecular Probes (Eugene, Oregon).
Cell culture
The 3T3 cells transfected with either vector or with CD40L were generated and cultured as described (17). The DC lymphoma M9 cells were cultured and maintained in 25-cm flasks in RPMI medium containing 10% FCS, 2 mM glutamine, 50 µM 2-ME, 100 U/ml penicillin and 100 µg/ml streptomycin (Sigma-Aldrich). They were cloned by limiting dilution. To induce differentiation in vitro, cloned M9 cells were cultured in DMEM containing 10% FCS, 2 mM glutamine, 50 µM 2-ME, 100 U/ml penicillin, and 100 µg/ml streptomycin in 24-well (0.51 x 106/well) or 6-well plates (23 x 106/well) in the presence or absence of CD40L-transfected 3T3 cells (17) for 4 days and then in the presence or absence of LPS (10 µg/ml) for 2 more days. In all experiments, M9 and cloned M9 cells were harvested by gentle pipeting or incubation with PBS containing 5 mM EDTA for 5 min at room temperature.
Generation of monocytes from murine spleen or peritoneal exudates
Unfractionated splenic cells (510 x 107) from C57BL/6J mice (H-2b) were cultured with irradiated (3000 rad) allogeneic splenic cells (5 x 107) from BALB/c mice (H-2d) in a 25-cm2 flask (BD Biosciences, Lincoln Park, NJ) as described (18). The cultures were maintained for 23 mo when monocytes grew out and formed multiple layers with disseminated aggregates. The cells were harvested by gentle pipetting for adoptive transfer.
For PEM, C57BL/6j mice received an i.p. injection of 3 ml of 4% thioglycolate broth. The peritoneal exudates were harvested on days 57, when
95% peritoneal exudates were mainly composed of macrophages. The cells were depleted of CD8+ and CD11c+ cells by magnetic biosphere as instructed by manufacturer (BioSource International, Camarillo CA) and injected s.c. into footpads of CD45.1+ congenic B6 mice.
In vivo differentiation of M9 cells, splenic monocytes, and PEM
Cloned M9 cells, cultured splenic monocytes, or PEM were injected i.p. (5 x 106/mouse) or s.c. (15 x 106/mouse) into the footpad of congenic B6CD45.1 mice. The mice were sacrificed 4-5 days later. Peritoneal cavity exudate cells (PEC) were collected by injecting and then redrawing 10 ml of medium. In addition, cells from the spleen and mesenteric lymph nodes (MLN) of mice that received i.p. injections or those from popliteal lymph nodes (PLN) of mice that received s.c. injections were also harvested and analyzed by flow cytometry. In some experiments, spleens were digested with collagenase (5 mg/ml, 5 ml/spleen) for 1 h at 37°C. Low-density cells were harvested from the interface between 4050% percoll gradients.
T cell proliferation assay
To examine the capacity of cloned M9 cells to stimulate T cells, M9 cells were irradiated (3000 rad) and cocultured in various concentrations with purified allogeneic T cells (2 x 105/well) from BALB/c mice for 4 days in flat-bottom 96-well tissue culture plates. In some experiments, a suboptimal concentration of recombinant murine IL-2 (3 ng/ml) was added. The cultures were pulsed with [3H]thymidine (0.5 µCi/well) 16 h before harvest. In some experiments, BALB/c mice received a s.c. injection of cloned M9 cells in one footpad (1 x 106/mouse) and PBS in another footpad. The draining lymphoid nodes and spleen were harvested on day 5 after injection. Varying numbers of purified T cells were stimulated with 2 x 105/well irradiated allogeneic splenocytes (B6) for 60 h in round-bottom 96-well tissue culture plates and then pulsed with [3H]thymidine 16 h before harvest. Spleen T cells were purified by depletion of CD11c+, B220+, and Fc
R+ cells using magnetic biospheres provided by BioSource International.
Flow cytometry
For staining with biotin- or fluorochrome-conjugated Abs, the cells were first incubated with mAb 2.4G2 for 15 min to block Fc receptors on the surface of mononuclear cells. This was followed by staining with two or three conjugated mAbs. In addition, fluorochrome-conjugated streptavidin was used as the second-step reagent when biotinylated Abs were the first Ab. For indirect staining involving unconjugated first-step reagents, specific or isotype-matched control mAbs were used as first-step reagents, and FITC-conjugated donkey anti-rat or hamster IgG was used as secondary Ab.
For intracellular staining of MHC class II molecules in established M9 cell lines, the cells were harvested, permeabilized, and stained using a kit for intracellular staining (BD PharMingen) according to the manufacturers instructions. The intracellular nature of the I-A
is confirmed by fluorescent microscopy. In some experiments, intracellular expression of cytokines was determined according to an established procedure (19).
Histological analysis
For pathological analysis, mouse organs were fixed with 10% formalin in PBS and were paraffin embedded. Tissue sections were stained with H&E and examined under a microscope. For immunohistochemical analysis, frozen sections were prepared and stained with 2 µg/ml Ag-specific mAbs and then developed using an ABC kit (Vector Laboratories, Burlingame, CA).
Analysis of cytokine gene expression in monocyte clones
Monocyte clones were cultured in the presence or absence of 100 ng/ml LPS for 48 h. The cDNA were prepared using total RNA as template and random hexamers as primers. The amount of cytokine mRNA was determined based on PCR reactions. With the exception of primers for macrophage DC-derived chemokine (MDC) (forward ATGGCTACCCTGGGTG; reverse CTAGGACAGTTTATGG), the primer sequence and experimental protocol have been described (20).
| Results |
|---|
|
|
|---|
In the process of analyzing the immune surveillance of cancer in >200 mice with targeted mutation of both p53 and Stat-1 genes, we came across a case of diffuse DC lymphoma. The mouse was moribund with splenomegaly and infiltrations of tumor cells in multiple organs including kidney, liver, lung, and lymph nodes. The spleen cells harvested had the typical morphology of DC. To confirm this, we analyzed cell phenotypes by flow cytometry (Fig. 1a). Essentially, all of the cells isolated from the spleen expressed DC markers, such as CD11c, DEC-205, CD8
(but not CD8
), MHC class II, and co-stimulatory molecules B7-1 (CD80), B7-2 (CD86), CD40, CD24, and CD44. The phenotypes suggested that they belonged to the CD8
+ DC subset. However, in contrast to the typical CD8
+ DC (3), these cells also expressed a number of monocyte/macrophage markers, including low levels of CD11b, F4/80, and CD16/32, although not CD14 (Fig. 1a). Immunohistochemical staining of spleen sections revealed that all of the tumor cells expressed CD11c, DEC-205, and CD8
but not B220 or Thy1 (data not shown). Similarly, the tumor cells that infiltrated tissues, such as livers, expressed both CD8
and CD11c (Fig. 1b) as well as DEC-205 (data not shown).
|
, and I-A
on M9 cells was reduced progressively (data not shown). At 1 year after the initial culture, essentially all cell surface DC markers disappeared (data not shown).
We cloned M9 cells by limiting dilution using either ex vivo M9 cells (after recovery from liquid nitrogen) or the 6-wk-old cultured M9 cells. Individual clones were recovered 4 wk later. Twenty-one clones were obtained from ex vivo M9 cells, and four clones were obtained from 6-wk-old M9 cells. Among the 21 clones isolated directly from ex vivo DC lymphoma, 18 (87%) clones expressed various levels of CD11c, CD8
, and I-A
, whereas three clones expressed no DC markers or lineage markers (data not shown). All four clones from 6-wk-old cultured DC also expressed low but detectable CD11c, CD8
, and I-A
(data not shown). All (n = 22) clones that expressed DC markers were adherent. They became nonadherent when they grew in high density. In all cases, even cloned cells were heterogeneous in their expression of these markers, and after two more passages in vitro all clones lost the DC markers. Because this occurred in all of the clones analyzed, the loss of DC markers is not caused by an overgrowth of non-DC present in the spleen of the M9 mouse.
Essentially, all of the stable clones displayed the cell surface phenotype of monocytes. The phenotype of a representative clone, 2C8, is depicted in Fig. 2. The characteristic DC markers CD11c, DEC205, CD8
, I-A
, B7-1, and CD40 had all but disappeared, although B7-2 continued to be stably expressed on the 2C8 cells (Fig. 2a) and other cloned cells (data not shown). In contrast, expression of the monocyte markers, such as CD11b, F4/80, CD14, VLA-4, and CD16/32 increased somewhat in comparison to the ex vivo lymphoma cells (Fig. 1). However, 2C8 and most other clones maintained a DC-like morphology. Both adherent (Fig. 2b, top) and nonadherent (Fig. 2b, bottom) cells had long processes. Moreover, the cell clones could efficiently phagocytose the fluorescent microbeads (Fig. 2c).
|
molecules in all seven clones examined by flow cytometry (Fig. 3a) and fluorescent microscopy (Fig. 3b). Moreover, the cloned cells can stimulate proliferation of allogeneic T cells from unprimed mice, especially when a low dose of IL-2 is added (Fig. 3c). Thus, whereas cloned M9 cells mainly expressed monocyte/macrophage markers, they have certain functional characteristics of immature DC.
|
We have attempted to use the cytokines GM-CSF, IL-4, TNF-
, LPS, and PGE2 to induce differentiation of M9 cells to DC. Whereas I-A
and B7-1 were consistently up-regulated upon stimulation by cytokines or inflammatory stimuli, the consistent induction of CD11c and CD8
expression was not observed with these stimuli (data not shown). Consistent with a major function of CD40 in DC maturation (21, 22, 23), we observed significant induction of MHC class II by CD40L-transfected fibroblasts (Fig. 4a). However, optimal induction of CD11c and CD8
requires both CD40L and LPS, which have been demonstrated to be potent inducers of DC maturation (24, 25, 26, 27, 28). Consistent with the expression of cell surface markers, the 3B11 cell line stimulated by the CD40L in conjunction with LPS induced significantly stronger proliferation of allogeneic T cells (Fig. 4b). With regard to cytokine expression, the monocyte clones expressed significant levels of IL-1
, IL-6, and IL-10 constitutively. In response to LPS stimulation, a substantial increase in the expression of IL-1
, IL-12, and MDC were observed (Fig. 4c), which is consistent with one of the features of DC maturation.
|
and I-A
vs CD8
by three-color flow cytometry. As shown in Fig. 5a, left,
4% of 2C8 cells in the peritoneal cavity expressed CD11c, and <1% of them expressed CD8
. The cells appeared to have undergone some differentiation, as significant levels of I-A
were detected on
30% of the cells. Substantial numbers of 2C8 cells were found in the spleen and draining MLN. In the spleen,
15% of the 2C8 cells expressed CD11c. Expression of MHC class II was less in 2C8 cells found in the spleen than of those found in the peritoneal cavity. Among the 2C8 cells that migrated into the draining lymph nodes, 40% expressed CD11c, whereas 80% expressed cell surface MHC class II (Fig. 5a, right). Similar increases in expression of CD8
were found in the 2C8 cells harvested from draining lymph nodes.
|
vs CD11c and CD8
vs I-A
. In this analysis, 70% of 2C8 cells expressed CD11c on the cell surface, and 90% of 2C8 cells found in the draining lymph nodes expressed I-A
. Expression of CD8
varied from 20 to 50% between experiments. Expression of distinct cell surface markers among 2C8 cells recovered from different lymphoid tissue provides strong support for the thesis that migration of DC is coupled with its maturation (29, 30, 31). It is worth noting that despite expression of CD8
, CD11c, and MHC class II, the overwhelming majority (>85%) of the 2C8 or 3B11 cells recovered in the draining lymph nodes retained expression of CD11b (Fig. 5b, Expt. 2).
These results raised the issue of whether the monocyte clones could differentiate into the typical CD8
+CD11c+CD11b- DC in vivo. To address this issue, we injected the 2C8 cells s.c. into the CD45.1 congenic mice and analyzed the donor CD45.2 cells for the expression of CD8
, CD11b, and CD11c. Essentially all of the CD8
+CD45.2+ cells expressed CD11c. Most of them also expressed CD11b. Only
5% of CD8
+ DC differentiated into the CD8
+CD11b-CD11c+ subset that expressed an intermediate level of CD11c. Among the CD8
-CD45.2+ cells,
24% expressed CD11c. As expected, most of the CD11c+ cells coexpressed CD11b (data not shown). Thus, a single monocyte clone can give rise to at least four subsets of CD11c+ DC: CD8
+CD11b+, CD8
+CD11b-, CD8
-CD11b+, and CD8
-CD11b-.
DC differentiation correlates with significant priming of allogeneic T cells in the draining lymph nodes
To test the functional consequence of DC maturation in vivo, we examined whether this differentiation led to T cell priming. 2C8 or 3B11 (H-2b) cells were injected s.c. into the right footpad of BALB/c mice (H-2d). The left footpad was injected with PBS as a control. The mice were sacrificed 5 days after injection, and PLN and the spleen were collected. We found that the right PLN were enlarged, whereas the left PLN remained unchanged. The cell number in the draining PLN increased by >10-fold in comparison to the nondraining left PLN (data not shown). We then compared the proliferative response of the T cells recovered from different lymph nodes. When a limited number of responders and spleen cell stimulators were used, the lymph node or spleen T cells from unprimed mice mounted a poor proliferative response. However, T cells isolated from either the spleen or local draining lymph nodes of the primed mice mounted a strong proliferative response. In contrast, T cells from nondraining lymph nodes of the primed mice also failed to respond (Fig. 6a). Corresponding to the proliferative response, we also observed a substantial increase of cytokine-producing cells in the draining lymph nodes (Fig. 6b). Upon in vitro restimulation, 12.5-fold more CD8+ T cells from draining lymph nodes than those from nondraining lymph nodes produced IFN-
. Likewise, 2.5-fold more CD4+ T cells from draining lymph nodes than those from nondraining lymph nodes produced IFN-
. Overall, the CD4+ T cell responded poorly in comparison with the CD8+ T cells. Few IL-2-, IL-4-, and IL-10-producing cells were detected in the CD4 and CD8 T cells (data not shown).
|
and CD11b in WT and p53-/-Stat-1-/- mice
Most of the M9-derived CD8+ DC coexpressed both CD11b and CD8
. Because the clones were derived from a Stat-1-/-p53-/- DC lymphoma, it is of interest to test whether similar cells are present in nonmalignant DC, and if so, whether generation of these cell types is affected by the defects in p53 and Stat-1 genes. To address this issue we analyzed the expression of CD8
on CD11b+ and CD11c+ cells in both WT and p53-/-Stat-1-/- mouse spleen cells. Again, we excluded lymphocytes (based on cellular scatters) for this analysis to avoid the complication of CD8 T cells and to enrich the events associated with DC. As shown in Fig. 7, both CD11c+ and CD11b+ cells can be divided into four major subsets based on the expression of I-A
and CD8
. I-A
- cells were generally devoid of CD8
high molecules, which indicated that we had gated out essentially all of the CD8 T cells. The I-A
+ cells can be divided into three major subsets based on the level of CD8
, namely negative (-), low (lo), and high (hi) (Fig. 7b). The summary of data from four WT or six knockout mice per group revealed that mutations in p53 and Stat-1 had no effect on the frequency of the three subsets, regardless of whether CD11c+ or CD11b+ cells were compared (Fig. 7b). Consistent with the general finding that most of the CD8
+ DC were CD11b-, the proportion of CD8high cells was greater among the CD11c+ than among the CD11b+ cells. However, among the cells with lower levels of CD8, similar proportions fell into CD11c+ and CD11b+ subsets. Thus, CD11c+CD11b+CD8
+ DC are not artifacts, neither of malignancy nor of defects in p53 and Stat-1 genes.
|
- cells were observed. This is surprising, but reproducible (Fig. 7). Further work indicated that some monocytes and NK cells expressed CD11c (data not shown).
In vitro cultured WT monocytes and PEM differentiated into CD8
+ DC in vivo
A critical issue is whether WT monocytes can differentiate into CD8
+ DC in vivo. Because it is technically difficult to isolate sufficient numbers of mouse monocytes with adequate purity for adoptive transfer studies, we used monocytes cultured from spleens. As we have reported, after splenocytes are stimulated with irradiated allogeneic splenocytes, a large number of cells with monocytic characteristics can be generated after 23 mo of in vitro culture (18). As shown in Fig. 8a, harvested cells have the morphology of monocytes as determined by Wright/Giemsa staining. The viable cells expressed high levels of monocytic marker CD11b, but not CD8
. A low level of CD11c was detected (Fig. 8b). In addition, we have reported that the in vitro cultured cells expressed additional monocytic markers, including F4/80, Mac-2, Mac-3, and FcR (18). Therefore, we transferred these cells into CD45.1 congenic mice and analyzed the phenotype of the CD45.2+ donor cells by flow cytometry.
|
(Fig. 8c, left). The CD8
+ cells consist of CD11c+CD8
+ and CD11b+CD8
+ populations (Fig. 8c, right), which are analogous to DC clones used in the study.
To determine whether primary uncultured monocytes/macrophages can also differentiate into CD8
+ cells, we adoptively transferred PEM that were thioglycolate elicited, harvested at day 57, and depleted of CD11c+ and CD8
+ cells, into the footpad of congenic mice (Fig. 9). Four days later, draining lymph nodes were harvested and examined for expression of CD45.2, CD11c, CD11b, and CD8
. As shown in Fig. 9a, all donor cells expressed CD11b, but not CD11c and CD8
before adoptive transfer. About 9% of the gated large cells expressed CD45.2. Fifteen percent of the CD45.2+ cells differentiated into CD11b+CD11c+ cells. Among them, 40% expressed CD8
. In addition, 21% of the donor cells differentiated into the CD11b+CD11clow subset, of which 4% expressed CD8
. Thus, monocytes with no defects in p53 and STAT-1 genes can differentiate into CD8
+ DC.
|
| Discussion |
|---|
|
|
|---|
+ and CD8
- DC in vivo. This is not unique for the cell line derived from DC lymphoma, because both cultured splenic monocytes and uncultured PEM from WT mice can differentiate into CD11c+CD8
+ DC. Whereas the ability of monocytes/macrophages to differentiate into CD8
- DC has been elegantly demonstrated recently (29), our work appears to be the first direct evidence to suggest that monocytes can also be precursors of CD8
+ DC. Our results extend the notion that common myeloid progenitors have the potential to differentiate into CD8
+ DC in vivo (8) by showing a major myeloid cell type as a direct precursor for CD8
+ DC. Moreover, the fact that cloned monocytes can differentiate into DC with phenotypes of both "lymphoid" and "myeloid" lineages further underscore the plasticity of DC subsets.
It is worth noting that the monocyte clones were isolated from a CD8
+ DC lymphoma. This raises an intriguing possibility as to whether the differentiation of DC from monocytes is reversible. However, because Stat-1 and p53 genes have both been implicated in programmed cell death (12, 13, 14), it is also possible that differentiation from monocytes to DC is terminal in normal cells and that death of DC is prevented when the two genes are mutated.
We have observed that most of the DC derived from the monocyte clones co-express both CD11b and CD8
. A small but distinct population of monocyte-derived DC have lost CD11b but retained CD11c at 5 days of in vivo maturation. Because the monocytes expressed high levels of CD11b before injection, it is possible that the CD11b+CD11c+CD8
+ DC is the direct precursor of the CD11b-CD11c+CD8
+ DC, the major CD8
+ DC in the spleen. Consistent with this hypothesis, we observed that a significant number of endogenous CD11b+ cells express both CD8
and I-A on the cell surface, although most CD8
+ and I-A+ cells have a somewhat lower level of CD8
expression. Whereas this subset has not been formally recognized (32), published work by others has also indicated that a significant proportion of monocyte-derived DC (29) and Flt-3 ligand-induced DC (33) co-express CD11b and CD8
. More recent work (34, 35) from two independent laboratories has demonstrated that the CD11b+CD8
- cells can differentiate into CD11b+CD8
+ and CD11b-CD8
+ DC either upon adoptive transfer or upon uptake of virus-like particles in vivo.
Finally, utilization of DC lines has greatly facilitated the study of DC in mouse (36). However, to our knowledge, the immature DC cell lines were not of monocytic phenotypes and have not been demonstrated to differentiate into CD8
+ DC in vivo. The cell lines described in this study may have unique value in studying biology of the CD8
+ DC that mediates the cross-presentation of cell-associate Ags to cytotoxic T lymphocytes (10).
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Drs. Yang Liu or Pan Zheng, Department of Pathology and Comprehensive Cancer Center, Ohio State University Medical Center, 129 Hamilton Hall, 1645 Neil Avenue, Columbus, OH 43210. E-mail address: liu-3{at}medctr.osu.edu ![]()
3 Abbreviations used in this paper: DC, dendritic cell; PEM, peritoneal exudates macrophage; MLN, mesenteric lymph node; PLN, popliteal lymph node; PEC, peritoneal cavity exudate cell; WT, wild type; MDC, macrophage DC-derived chemokine. ![]()
Received for publication November 21, 2002. Accepted for publication April 1, 2003.
| References |
|---|
|
|
|---|
-positive dendritic cells from a common myeloid progenitor. Science 290:2152.
+ and CD8
- subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J. Exp. Med. 189:587.
+ dendritic cells prolong the survival of vascularized heart allografts. J. Immunol. 168:143.
- CD11b+ dendritic cells present exogenous virus-like particles to CD8+ T cells and subsequently express CD8
and CD205 molecules. J. Exp. Med. 195:1233.
+ dendritic cells originate from the CD8
- dendritic cell subset by a maturation process involving CD8
, DEC-205, and CD24 up-regulation. Blood 99:999.This article has been cited by other articles:
![]() |
L. Chen, E. Calomeni, J. Wen, K. Ozato, R. Shen, and J.-X. Gao Natural killer dendritic cells are an intermediate of developing dendritic cells J. Leukoc. Biol., June 1, 2007; 81(6): 1422 - 1433. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. Joshi, J.-Q. Liu, Y. Wang, X. Chang, J. Richards, E. Assarsson, F.-D. Shi, H.-G. Ljunggren, and X.-F. Bai Cytokine-induced killer T cells kill immature dendritic cells by TCR-independent and perforin-dependent mechanisms J. Leukoc. Biol., December 1, 2006; 80(6): 1345 - 1353. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Steptoe, J. M. Ritchie, L. K. Jones, and L. C. Harrison Autoimmune Diabetes Is Suppressed by Transfer of Proinsulin-Encoding Gr-1+ Myeloid Progenitor Cells That Differentiate In Vivo Into Resting Dendritic Cells Diabetes, February 1, 2005; 54(2): 434 - 442. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |