The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schümann, J.
Right arrow Articles by MacDonald, H. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schümann, J.
Right arrow Articles by MacDonald, H. R.
The Journal of Immunology, 2003, 170: 5815-5819.
Copyright © 2003 by The American Association of Immunologists


CUTTING EDGE

Cutting Edge: Influence of the TCR V{beta} Domain on the Avidity of CD1d:{alpha}-Galactosylceramide Binding by Invariant V{alpha}14 NKT Cells1

Jens Schümann*, Roger B. Voyle*, Bing-Yuan Wei{dagger} and H. Robson MacDonald2,*

* Ludwig Institute for Cancer Research, Lausanne Branch, Epalinges, Switzerland; and {dagger} BD Biosciences PharMingen, San Diego, CA 92121


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
CD1d tetramers loaded with {alpha}-galactosylceramide ({alpha}-GalCer) bind selectively to mouse invariant V{alpha}14 (V{alpha}14i) NKT cells and their human counterparts. Whereas tetramer binding strictly depends on the expression of a V{alpha}14-J{alpha}18 chain in murine NKT cells, the associated {beta}-chain (typically expressing V{beta}8.2 or V{beta}7) appears not to influence tetramer binding. In this study, we describe novel {alpha}-GalCer-loaded mouse and human CD1d-IgG1 dimers, which revealed an unexpected influence of the TCR-{beta} chain on the avidity of CD1d:{alpha}-GalCer binding. A subset of V{alpha}14i NKT cells clearly discriminated {alpha}-GalCer bound to mouse or human CD1d on the basis of avidity differences conferred by the V{beta} domain of the TCR-{beta} chain, with V{beta}8.2 conferring higher avidity binding than V{beta}7.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Natural killer T cells are a subset of T lymphocytes that express an {alpha}{beta} TCR as well as markers usually associated with NK cells and activated/memory T cells. In the mouse, the vast majority of NKT cells expresses a semi-invariant {alpha}{beta} TCR composed of an invariant V{alpha}14-J{alpha}18 chain, paired preferentially with V{beta}8.2 or V{beta}7 chains (the human equivalents are V{alpha}24-J{alpha}18 and V{beta}11) (1, 2, 3, 4) with diverse CDR3{beta} sequences (5, 6). These NKT cells, also known as invariant V{alpha}14 (V{alpha}14i)3 NKT cells (7), recognize glycolipids associated with the nonpolymorphic MHC-like molecule CD1d (8, 9). Although the endogenous and possibly foreign glycolipids recognized by the semi-invariant TCR on V{alpha}14i NKT cells under physiological conditions are not known, a glycolipid obtained from an extract of the marine sponge Agelas mauritanius, {alpha}-galactosylceramide ({alpha}-GalCer), bound to CD1d, is widely used as a pan-activating ligand for V{alpha}14i NKT cells (8, 9). In vivo, {alpha}-GalCer rapidly activates V{alpha}14i NKT cells, which in turn release cytokines, notably IL-4 and IFN-{gamma} (10). Functional recognition of CD1d-{alpha}-GalCer appears to depend on V{alpha}14-J{alpha}18 (11) and on suitable V{beta} chains (12).

An important recent development in the biology of V{alpha}14i NKT cells has been the successful production of CD1d tetramers loaded with {alpha}-GalCer (10, 13, 14). {alpha}-GalCer-loaded mouse CD1d tetramers are a sensitive and highly specific reagent for identifying mouse V{alpha}14i NKT cells, binding to 75–80% of TCR-{beta}intNK1.1+ cells within thymus (where NKT cells develop) and liver (a major site for the peripheral concentration of NKT cells) and ~35% of TCR-{beta}intNK1.1+ cells within the spleen of C57BL/6 mice (10). Depending on the tissue, 35–60% of these tetramer+ V{alpha}14i NKT cells are V{beta}8.2+ and 12–18% are V{beta}7+ (10, 13), consistent with the V{beta} repertoire of NKT cells identified previously by TCR-{beta} and NK1.1 staining (15). Interestingly, {alpha}-GalCer-loaded mouse CD1d tetramers also bind to virtually all human V{alpha}24+V{beta}11+ NKT cells in {alpha}-GalCer-stimulated human PBLs (13), suggesting extensive cross-reactivity of {alpha}-GalCer-loaded mouse CD1d with human V{alpha}24+V{beta}11+ NKT cells. In addition, several mouse V{alpha}14i NKT hybridoma cells can be stimulated by human CD1d-transfected cell lines pulsed with {alpha}-GalCer (16, 17), pointing to a cross-reactivity of {alpha}-GalCer-loaded human CD1d with mouse V{alpha}14i NKT cells as well. Because of this bidirectional cross-reactivity, {alpha}-GalCer-loaded mouse and human CD1d tetramers are considered useful for staining CD1d-dependent NKT cells of either species, and indeed mouse CD1d tetramers have been used for identification of human CD1d-dependent NKT cells (18).

Whereas binding of {alpha}-GalCer-loaded mouse CD1d tetramers is strongly correlated with the expression of V{alpha}14-J{alpha}18, no influence of the {beta}-chain on tetramer binding is observed (5, 10, 13, 19), although putative V{beta}-dependent differences in responsiveness of V{alpha}14i NKT hybridoma lines to APC transfectants expressing mouse or human CD1d, respectively, have been described (16). The failure to see TCR-{beta} chain-dependent differences in {alpha}-GalCer-loaded mouse CD1d tetramer binding to V{alpha}14i NKT cells might be due to the high and highly variable valency of the tetramers. To circumvent this potential limitation, we used {alpha}-GalCer-loaded mouse and human CD1d-IgG1 dimers (for convenience referred to hereafter as "mouse dimers" and "human dimers") to investigate a possible influence of the V{beta} domain on the avidity of CD1d:{alpha}-GalCer binding by V{alpha}14i NKT cells. Indeed, by using these reagents, we were able to demonstrate a V{beta}-dependent heterogeneity among V{alpha}14i NKT cells, with V{beta}8.2 conferring higher avidity to CD1d:{alpha}-GalCer than V{beta}7.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Mice

C57BL/6 mice were obtained from Harlan (Zeist, The Netherlands). CD1d-/- (20) and J{alpha}18-/- (11) mice backcrossed to C57BL/6 were kindly provided by Dr. M. J. Grusby and Dr. M. Taniguchi, respectively.

Cell preparations

Liver mononuclear cells were prepared as previously described (2). Thymocytes were depleted of heat stable Ag (HSA)+CD8+ cells by treatment with rat IgM mAb B2A2 and rat IgM mAb 3.168.8.1 plus rabbit complement. Viable recovered cells were purified on a Lympholyte M gradient (Cedarlane Laboratories, Hornby, Ontario, Canada).

Generation of {alpha}-GalCer-loaded CD1d-IgG1 dimers

Soluble divalent mouse or human CD1d-IgG1 fusion proteins were generated by insertion of cDNA encoding the three extracellular domains of CD1d at the 5' end of the mouse IgG1 H chain gene. Briefly, RT-PCR was performed with RNA purified from BALB/c mouse spleen and human PBL, respectively, using the following oligonucleotides: 5' mouse CD1d, GTCCACGCGTCGCAG CAAAAGAATTACACCTTCCGC; 3' mouse CD1d, GTCACTCGAGCCAGTAGAGGATGATATCCTGTC; 5' human CD1d, GTCCACGCGTCGGAAGTCCCGCAAAGGCTTTTCC; and 3' human CD1d, GTCACTCGAGCCAGTAGAGGACGATGTCCTG. Two restriction sites for MluI and XhoI were added to these oligonucleotides (underlined) for insertion of the amplified cDNAs upstream of the IgG1-VH region into the pXIg expression vector (21). The plasmids encoding the mouse or human CD1d-IgG1 molecules were transfected either alone (for mouse dimers) or along with a plasmid encoding human {beta}2-microglobulin (for human dimers) by electroporation into murine myeloma J558L cells, which are deficient in synthesizing Ig H chains, but capable of producing Ig {lambda}-chains. Cells were selected by addition of G418 (1 mg/ml) to the culture medium and subcloned. Cells producing high amounts of CD1d-IgG1 were selected according to quantitative ELISA and cultured in BD Cell serum-free medium (BD Biosciences, San Jose, CA). Mouse and human CD1d-IgG1 were purified using protein G affinity columns and elution at pH 11. Loading of CD1d-IgG1 dimers with {alpha}-GalCer (kindly provided by Y. Koezuka, Kirin Brewery, Gunma, Japan) was performed at neutral pH by overnight incubation at a molar ratio of 1:9 (CD1d-IgG1 dimer:{alpha}-GalCer) at room temperature.

Flow cytometry

Stainings with {alpha}-GalCer-loaded CD1d-IgG1 dimers were performed at 4°C for 60 min, followed by incubations with anti-mouse IgG1-PE mAb (A85-1) and finally an excess of mouse and rat IgG1 molecules. Cells were surface stained with combinations of the following mAb conjugates, anti-TCR-{beta}-FITC (H57-597), anti-NK1.1-PerCP-Cy5.5 (PK136), anti-V{beta}8.2-biotin (F23-2), and anti-V{beta}7-biotin (TR310), or {alpha}-GalCer-loaded CD1d-IgG1 dimers, directly conjugated with Alexa Fluor 488 using the Zenon One Mouse IgG1 Labeling kit (Molecular Probes, Eugene, OR). The biotinylated mAbs were revealed with streptavidin-allophycocyanin (Molecular Probes). All mAbs were purified and conjugated at our institute, with the exception of PK136 that was purchased from BD Biosciences PharMingen. Samples were passed on a BD FACSCalibur flow cytometer (BD Biosciences), gated to exclude nonviable cells on the basis of light scatter. Data were analyzed using CellQuest software (BD Biosciences).

Regression analyses

Scatchard analyses of mouse and human dimer binding to mouse NKT cells were performed using SigmaPlot software (SPSS, Chicago, IL).


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Specific, concentration-dependent binding of mouse and human dimers to V{alpha}14i NKT cells

HSA/CD8-depleted thymocytes from C57BL/6 mice were stained with an Ab against TCR-{beta} and increasing amounts of mouse and human dimers in 2-fold steps. Both mouse and human dimers bound to TCR-{beta}int thymocytes in a concentration-dependent manner, reaching a maximum mean fluorescence intensity of ~200 for mouse dimers and of ~70 for human dimers at saturating concentrations (Fig. 1A, upper panel). Scatchard transformations of the binding curves revealed apparent Kd values of 11.2 ± 1.1 nM for mouse dimer and 1.5 ± 0.1 nM for human dimer binding to TCR-{beta}int mouse thymocytes (Fig. 1A, lower panel). Similar results were obtained using liver mononuclear cells (data not shown). To ensure optimal dimer binding, all further studies were performed at dimer concentrations of 85 nM, i.e., under saturating conditions. Specificity of dimer binding to V{alpha}14i NKT cells was tested by comparative staining of HSA/CD8-depleted thymocytes from C57BL/6 wild-type mice and from two mutant mouse strains deficient for genes required for the development of V{alpha}14i NKT cells: CD1d-/- (20) and J{alpha}18-/- mice (11). Both mouse and human dimers bound to TCR-{beta}int thymocytes from C57BL/6 wild-type mice (Fig. 1B). Interestingly, the mouse dimers stained roughly twice as many HSA/CD8-depleted C57BL/6 thymocytes as the human dimers (Fig. 1B). In contrast, neither dimer stained any detectable cells from CD1d-/- or J{alpha}18-/- mice (Fig. 1B), although in those two mouse strains there was a significant residual staining of TCR-{beta}intNK1.1+ cells (data not shown), as described before (10). Furthermore, neither dimer in its unloaded form stained any detectable cells from C57BL/6 wild-type mice (data not shown). Taken together, these results show that mouse and human dimers bind specifically to V{alpha}14i NKT cells in a concentration-dependent manner, and that there is a heterogeneity among V{alpha}14i NKT cells with respect to species-specific binding of mouse vs human dimers.



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 1. Specific, concentration-dependent binding of mouse and human dimers to V{alpha}14i NKT cells. A, 105 HSA/CD8-depleted thymocytes from C57BL/6 mice were stained with different amounts of mouse or human dimers along with a mAb against TCR-{beta}. Upper panel, the mean fluorescence intensities (MFI) of TCR-{beta}int mouse dimer+ or TCR-{beta}int human dimer+ cells are plotted against the concentrations of the respective dimer used. Lower panel, Scatchard transformations of these plots. B, HSA/CD8-depleted thymocytes from C57BL/6 wild-type, CD1d-/-, and J{alpha}18-/- mice were stained with mouse or human dimers and a mAb against TCR-{beta}. Numbers represent the mean percentage of positive cells in the indicated gate.

 
Differential binding of mouse and human dimers to V{alpha}14i NKT cells is V{beta} dependent

HSA/CD8-depleted thymocytes or liver mononuclear cells from C57BL/6 mice were stained with mouse or human dimers, in conjunction with Abs against TCR-{beta}, NK1.1, and the two most commonly used V{beta} segments of V{alpha}14i NKT cells (i.e., V{beta}8.2 or V{beta}7) and were analyzed by four-color flow cytometry. Interestingly, the mouse dimers were comparable to the recently described {alpha}-GalCer-loaded mouse CD1d tetramers with respect to the percentage of mouse NKT cells bound (10). Almost 70% of the TCR-{beta}intNK1.1+ thymocytes or liver mononuclear cells were positively stained by mouse dimers (Fig. 2A). In contrast, only 32% of TCR-{beta}intNK1.1+ thymocytes and 39% of TCR-{beta}intNK1.1+ liver lymphocytes bound human dimers (Fig. 2A). By using mouse dimers, the well-known (10, 13) repertoire bias of V{alpha}14i NKT cells toward V{beta}8.2 (thymus, 53 ± 4%; liver, 58 ± 2%) and V{beta}7 (thymus, 16 ± 2%; liver, 12 ± 2%) could be confirmed (Fig. 2B). However, most dramatically, TCR-{beta}int human dimer+ cells were much more strongly biased toward V{beta}8.2 (thymus, 80 ± 7%; liver, 84 ± 4%) than TCR-{beta}int mouse dimer+ cells, whereas the frequency of V{beta}7+ cells was significantly lower (thymus, 6 ± 5%; liver, 4 ± 1%) than among TCR-{beta}int mouse dimer+ cells (Fig. 2C). No differences in the V{beta} repertoire were observed between dimer+CD4+ and CD4-CD8- cells (data not shown), suggesting that the CD4 molecule had no influence on differential binding. Taken together, these results show that the differential binding of mouse and human dimers to V{alpha}14i NKT cells is V{beta} dependent, providing the first evidence that the V{beta} domain makes a significant contribution to the binding of CD1d:{alpha}-GalCer to the V{alpha}14i TCR. Furthermore, V{alpha}14i NKT cells are clearly not as extensively cross-reactive to {alpha}-GalCer-loaded mouse and human CD1d as previously thought. Therefore, one should be cautious when using CD1d:{alpha}-GalCer-based tools for detection of invariant NKT cells across species barriers.



View larger version (86K):
[in this window]
[in a new window]
 
FIGURE 2. Differential binding of mouse and human dimers to V{alpha}14i NKT cells is V{beta} dependent. A, HSA/CD8-depleted thymocytes or liver mononuclear cells from C57BL/6 mice were stained with mAbs against TCR-{beta} and NK1.1 and mouse or human dimers. The cytograms depict the gates defining TCR-{beta}intNK1.1+ cells, and the histograms show the stainings with mouse or human dimers among these cells. B and C, NKT-enriched thymocytes or liver mononuclear cells from C57BL/6 mice were stained with mouse (B) or human (C) dimers and mAbs against TCR-{beta} and V{beta}8.2 or V{beta}7. Cytograms depict the gates defining TCR-{beta}int mouse or human dimer+ cells. Histograms show the stainings with mAbs against V{beta}8.2 or V{beta}7 among these cells. Numbers represent the mean percentage of positive cells (±SD) in the indicated gates (n = 5).

 
Magnitude of mouse dimer binding by V{alpha}14i NKT cells is V{beta} dependent

To investigate whether binding of mouse dimers by V{alpha}14i NKT cells is also V{beta} dependent, we electronically gated TCR-{beta}int mouse dimer+ HSA/CD8-depleted thymocytes or liver lymphocytes into four populations with different binding intensities for mouse dimers and analyzed them for expression of V{beta}8.2 or V{beta}7. Strikingly, the binding intensity of mouse dimers positively correlated with the frequency of V{beta}8.2+ cells and negatively correlated with the frequency of V{beta}7+ cells (Fig. 3). Since binding intensities of mouse dimers did not correlate with the expression levels of TCR-{beta} (Fig. 3), the observed V{beta} heterogeneity most likely reflects the fact that V{beta}8.2+ V{alpha}14i NKT cells have a higher avidity for mouse dimers than V{beta}7+ V{alpha}14i NKT cells. Our results are apparently contradictory to the recent finding that the apparent avidity of {alpha}-GalCer-loaded mouse CD1d tetramer binding to a limited panel of V{alpha}14i NKT hybridoma cells is not dependent on the V{beta} molecule expressed (19). The higher and variable valency of tetramers, however, could have masked avidity differences that are detectable using dimers.



View larger version (67K):
[in this window]
[in a new window]
 
FIGURE 3. The magnitude of mouse dimer binding by V{alpha}14i T cells is V{beta} dependent. HSA/CD8-depleted thymocytes or liver mononuclear cells from C57BL/6 mice were stained with mouse dimers and mAbs against TCR-{beta} and V{beta}8.2 or V{beta}7. Cytograms depict gates defining TCR-{beta}int mouse dimer+ cells with different intensities of mouse dimer binding (R3–R6). R2 comprises all gates, R3–R6. The bar charts represent the mean percentages of V{beta}8.2+ or V{beta}7+ cells (±SD) in the indicated gates (n = 5). Horizontal lines indicate the mean percentages of V{beta}8.2+ or V{beta}7+ cells among total TCR-{beta}int mouse dimer+ cells (R2).

 
Human dimer+ cells are a subset of mouse dimer+ cells representing high-avidity V{alpha}14i NKT cells

To check whether human dimer+ V{alpha}14i NKT cells are a subset of mouse dimer+ V{alpha}14i NKT cells and whether they represent the high-avidity V{alpha}14i NKT cells, we performed a sequential double staining of HSA/CD8-depleted thymocytes from C57BL/6 mice with both types of dimers. Staining with human dimers was done first, followed by staining with mouse dimers along with Abs against V{beta}8.2 or V{beta}7. Since initial staining with human dimers only partially inhibited subsequent staining with mouse dimers, it was possible to resolve two V{alpha}14i NKT cell populations, one characterized as human dimer- mouse dimer+ and the other as human dimer+ mouse dimer+ (Fig. 4), showing formally that human dimer+ V{alpha}14i NKT cells are a subset of mouse dimer+ V{alpha}14i NKT cells. Frequencies of V{beta}8.2+ and V{beta}7+ cells among the human dimer+ mouse dimer+ cell population (Fig. 4) corresponded to the percentages of V{beta}8.2+ and V{beta}7+ cells among NKT-enriched thymocytes stained with human dimers alone (cf Fig. 2C). Strikingly, the V{alpha}14i NKT cells that bound mouse, but not human, dimers preferentially utilized V{beta}7. About 45% of these cells were V{beta}7+, whereas the frequency of V{beta}8.2+ cells was around 15% (Fig. 4). By electronically gating the human dimer- mouse dimer+ cells into four populations with different binding intensities for mouse dimers and subsequent analysis of V{beta}8.2 expression, we found that the frequency of V{beta}8.2+ cells was highest among those human dimer- mouse dimer+ V{alpha}14i NKT cells which bound mouse dimers only with low intensity (Fig. 4). This result directly confirms that human dimers preferentially bind to a high-avidity subset of V{beta}8.2+ V{alpha}14i NKT cells.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 4. Human dimer+ cells are a subset of mouse dimer+ cells representing high-avidity V{alpha}14i NKT cells. HSA/CD8-depleted thymocytes from C57BL/6 mice were stained with human and mouse dimers and mAbs against V{beta}8.2 or V{beta}7. The cytogram depicts the gates defining human dimer+ mouse dimer+ and human dimer- mouse dimer+ cells as well as the gates defining human dimer- mouse dimer+ cells with different intensities of mouse dimer binding (R3–R6). The histograms show V{beta}8.2 or V{beta}7 staining among human dimer+ mouse dimer+ cells (upper panel) or human dimer- mouse dimer+ cells (lower panel) and the numbers represent the percentages of positive cells in the indicated gates from one of two independent experiments. The bar chart represents the mean percentages of V{beta}8.2+ cells in the indicated gates from two independent experiments. The horizontal line indicates the mean percentage of V{beta}8.2+ cells among total human dimer- mouse dimer+ cells (R2).

 
Concluding remarks

Our data demonstrate directly and by two independent criteria that the avidity of the V{alpha}14i TCR on NKT cells for CD1d:{alpha}-GalCer complexes is strongly influenced by the V{beta} domain of the associated TCR-{beta} chain, with V{beta}8.2 conferring higher avidity than V{beta}7. Since V{beta} domains are most polymorphic in their hypervariable CDR1 and CDR2 regions, our data further suggest that residues in the CDR1{beta} and/or CDR2{beta} may contact CD1d or its associated glycolipid. Consistent with this hypothesis, previous attempts (5, 6) to identify motifs in the hypervariable CDR3{beta} domain that are selectively expressed by CD1d-dependent NKT cells have failed, suggesting that CDR3{beta} is in general less important than CDR1{beta} and/or CDR2{beta} in conferring avidity of the V{alpha}14i TCR to CD1d:glycolipid complexes. Nevertheless, our study reveals a minor subset of V{beta}8.2-expressing TCR-{beta} chains that bind mouse but not human dimers and hence are apparently unable to confer high-avidity CD1d:{alpha}-GalCer binding because of putative nonpermissive binding motifs in their CDR3{beta} sequences. Such hypothetical motifs might have been missed in previous studies analyzing CDR3{beta} sequences of total {alpha}-GalCer-loaded mouse CD1d tetramer+ cells, where no selection for or against particular CDR3{beta} regions was observed (5).

An obvious question arising from our data is whether V{beta}-dependent differences in V{alpha}14i TCR avidity have any functional consequences. In this regard, we have observed that the amount of IFN-{gamma} produced by liver NKT cells 2 h after i.v. injection of {alpha}-GalCer is negatively correlated with V{beta}7 expression (data not shown), suggesting that differences in V{alpha}14i TCR avidity for CD1d:{alpha}-GalCer complexes also impact quantitatively on biological responses of NKT cells in vivo.

Since the avidity of the V{alpha}14i TCR on NKT cells for CD1d:{alpha}-GalCer complexes is significantly influenced by the V{beta} domain, it is tempting to speculate that the V{beta} domain may also influence the avidity of V{alpha}14i TCR binding to CD1d complexed with its natural ligand. A direct answer to this question is not possible until natural CD1d-binding glycolipid ligands (either endogenous or foreign) have been identified. Nevertheless, one might anticipate that positive and negative selection of V{alpha}14i NKT cells in the thymus would be influenced by the avidity of the TCR for endogenous glycolipids bound to CD1d. In this context, the well-known bias for V{beta}8.2+ over V{beta}7+ V{alpha}14i NKT cells is consistent with an avidity-based positive selection mechanism. Furthermore, in two recently described transgenic mouse models (22, 23), in which NKT cell activation signals were enhanced to supraphysiological levels, selective loss of V{beta}8.2+ NKT cells was observed, suggesting that preferential negative selection of V{beta}8.2+ NKT cells can also occur as a consequence of a higher TCR avidity for CD1d complexed with its natural ligand. Thus, V{beta}-dependent avidity differences of V{alpha}14i TCR also appear to exist for CD1d bound to endogenous ligands.


    Acknowledgments
 
We are grateful to Y. Koezuka (Kirin Brewery, Gunma, Japan) for kindly providing {alpha}-GalCer. We also thank M. J. Grusby (Harvard Medical School, Boston, MA) and M. Taniguchi (Chiba University, Chiba, Japan) for providing CD1d-/- and J{alpha}18-/- mice, respectively.


    Footnotes
 
1 This work was supported in part by a Grant RG-00168/2000 (to H.R.M.) from the Human Frontiers Science Program and by a fellowship from the Deutsche Forschungsgemeinschaft (to J.S.). Back

2 Address correspondence and reprint requests to Dr. H. Robson MacDonald, Ludwig Institute for Cancer Research, Chemin des Boveresses 155, CH-1066 Epalinges, Switzerland. E-mail address: HughRobson. Macdonald{at}isrec.unil.ch Back

3 Abbreviations used in this paper: V{alpha}14i, invariant V{alpha}14; {alpha}-GalCer, {alpha}-galactosylceramide; HSA, heat-stable Ag; int, intermediate. Back

Received for publication February 10, 2003. Accepted for publication April 23, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Arase, H., N. Arase, K. Ogasawara, R. A. Good, K. Onoe. 1992. An NK1.1+CD4+8- single-positive thymocyte population that expresses a highly skewed T-cell antigen receptor V{beta} family. Proc. Natl. Acad. Sci. USA 89:6506.[Abstract/Free Full Text]
  2. Ohteki, T., H. R. MacDonald. 1994. Major histocompatibility complex class I related molecules control the development of CD4+8- and CD4-8- subsets of natural killer 1.1+ T cell receptor-{alpha}/{beta}+ cells in the liver of mice. J. Exp. Med. 180:699.[Abstract/Free Full Text]
  3. Lantz, O., A. Bendelac. 1994. An invariant T cell receptor {alpha} chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD4-8- T cells in mice and humans. J. Exp. Med. 180:1097.[Abstract/Free Full Text]
  4. Ohteki, T., H. R. MacDonald. 1996. Stringent V{beta} requirement for the development of NK1.1+ T cell receptor-{alpha}/{beta}+ cells in mouse liver. J. Exp. Med. 183:1277.[Abstract/Free Full Text]
  5. Matsuda, J. L., L. Gapin, N. Fazilleau, K. Warren, O. V. Naidenko, M. Kronenberg. 2001. Natural killer T cells reactive to a single glycolipid exhibit a highly diverse T cell receptor {beta} repertoire and small clonal size. Proc. Natl. Acad. Sci. USA 98:12636.[Abstract/Free Full Text]
  6. Ronet, C., M. Mempel, N. Thieblemont, A. Lehuen, P. Kourilsky, G. Gachelin. 2001. Role of complementarity-determining region 3 (CDR3) of the TCR-{beta} chains associated with the V{alpha}14 semi-invariant TCR {alpha}-chain in the selection of CD4+ NK T cells. J. Immunol. 166:1755.[Abstract/Free Full Text]
  7. Kronenberg, M., L. Gapin. 2002. The unconventional lifestyle of NKT cells. Nat. Rev. Immunol. 2:557.[Medline]
  8. Kawano, T., J. Cui, Y. Koezuka, I. Toura, Y. Kaneko, K. Motoki, H. Ueno, R. Nakagawa, H. Sato, E. Kondo, et al 1997. CD1d-restricted and TCR-mediated activation of V{alpha}14 NKT cells by glycosylceramides. Science 278:1626.[Abstract/Free Full Text]
  9. Burdin, N., L. Brossay, Y. Koezuka, S. T. Smiley, M. J. Grusby, M. Gui, M. Taniguchi, K. Hayakawa, M. Kronenberg. 1998. Selective ability of mouse CD1 to present glycolipids: {alpha}-galactosylceramide specifically stimulates V{alpha}14+ NK T lymphocytes. J. Immunol. 161:3271.[Abstract/Free Full Text]
  10. Matsuda, J. L., O. V. Naidenko, L. Gapin, T. Nakayama, M. Taniguchi, C.-R. Wang, Y. Koezuka, M. Kronenberg. 2000. Tracking the response of natural killer T cells to a glycolipid antigen using CD1d tetramers. J. Exp. Med. 192:741.[Abstract/Free Full Text]
  11. Cui, J., T. Shin, T. Kawano, H. Sato, E. Kondo, I. Toura, Y. Kaneko, H. Koseki, M. Kanno, M. Taniguchi. 1997. Requirement for V{alpha}14 NKT cells in IL-12-mediated rejection of tumors. Science 278:1623.[Abstract/Free Full Text]
  12. Gui, M., J. Li, L.-J. Wen, R. R. Hardy, K. Hayakawa. 2001. TCR{beta} chain influences but does not solely control autoreactivity of V{alpha}14J281T cells. J. Immunol. 167:6239.[Abstract/Free Full Text]
  13. Benlagha, K., A. Weiss, A. Beavis, L. Teyton, A. Bendelac. 2000. In vivo identification of glycolipid antigen-specific T cells using fluorescent CD1d tetramers. J. Exp. Med. 191:1895.[Abstract/Free Full Text]
  14. Karadimitris, A., S. Gadola, M. Altamirano, D. Brown, A. Woolfson, P. Klenerman, J.-L. Chen, Y. Koezuka, I. A. G. Roberts, D. A. Price, et al 2001. Human CD1d-glycolipid tetramers generated by in vitro oxidative refolding chromatography. Proc. Natl. Acad. Sci. USA 98:3294.[Abstract/Free Full Text]
  15. Bendelac, A., M. N. Rivera, S.-H. Park, J. H. Roark. 1997. Mouse CD1-specific NK1 T cells: development, specificity, and function. Annu. Rev. Immunol. 15:535.[Medline]
  16. Brossay, L., M. Chioda, N. Burdin, Y. Koezuka, G. Casorati, P. Dellabona, M. Kronenberg. 1998. CD1d-mediated recognition of an {alpha}-galactosylceramide by natural killer T cells is highly conserved through mammalian evolution. J. Exp. Med. 188:1521.[Abstract/Free Full Text]
  17. Naidenko, O. V., J. K. Maher, W. A. Ernst, T. Sakai, R. L. Modlin, M. Kronenberg. 1999. Binding and antigen presentation of ceramide-containing glycolipids by soluble mouse and human CD1d molecules. J. Exp. Med. 190:1069.[Abstract/Free Full Text]
  18. Lee, P. T., A. Putnam, K. Benlagha, L. Teyton, P. A. Gottlieb, A. Bendelac. 2002. Testing the NKT cell hypothesis of human IDDM pathogenesis. J. Clin. Invest. 110:793.[Medline]
  19. Sidobre, S., O. V. Naidenko, B.-C. Sim, N. R. J. Gascoigne, K. C. Garcia, M. Kronenberg. 2002. The V{alpha}14 NKT cell TCR exhibits high-affinity binding to a glycolipid/CD1d complex. J. Immunol. 169:1340.[Abstract/Free Full Text]
  20. Smiley, S. T., M. H. Kaplan, M. J. Grusby. 1997. Immunoglobulin E production in the absence of interleukin-4-secreting CD1-dependent cells. Science 275:977.[Abstract/Free Full Text]
  21. Dal Porto, J., T. E. Johansen, B. Captipovic, D. J. Parfitt, D. Tuveson, U. Gether, D. Kozlowski, D. Fearon, J. P. Schneck. 1993. A soluble divalent class I major histocompatibility complex molecule inhibits alloreactive T cells at nanomolar concentrations. Proc. Natl. Acad. Sci. USA 90:6671.[Abstract/Free Full Text]
  22. Voyle, R. B., F. Beermann, R. K. Lees, J. Schümann, J. Zimmer, W. Held, H. R. MacDonald. 2003. Ligand-dependent inhibition of CD1d-restricted NKT cell development in mice transgenic for the activating receptor Ly49D. J. Exp. Med. 197:919.[Abstract/Free Full Text]
  23. Chun, T., M. J. Page, L. Gapin, J. L. Matsuda, H. Xu, H. Nguyen, H.-S. Kang, A. K. Stanic, S. Joyce, W. A. Koltun, et al 2003. CD1d-expressing dendritic cells but not thymic epithelial cells can mediate negative selection of NKT cells. J. Exp. Med. 197:907.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
J. D. Wesley, M. S. Tessmer, C. Paget, F. Trottein, and L. Brossay
A Y Chromosome-Linked Factor Impairs NK T Development
J. Immunol., September 15, 2007; 179(6): 3480 - 3487.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Kishimoto, T. Ohteki, N. Yajima, K. Kawahara, M. Natsui, S. Kawarasaki, K. Hamada, Y. Horie, Y. Kubo, S. Arase, et al.
The Pten/PI3K pathway governs the homeostasis of V{alpha}14iNKT cells
Blood, April 15, 2007; 109(8): 3316 - 3324.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. J. Zullo, K. Benlagha, A. Bendelac, and E. J. Taparowsky
Sensitivity of NK1.1-Negative NKT Cells to Transgenic BATF Defines a Role for Activator Protein-1 in the Expansion and Maturation of Immature NKT Cells in the Thymus
J. Immunol., January 1, 2007; 178(1): 58 - 66.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Pyz, O. Naidenko, S. Miyake, T. Yamamura, I. Berberich, S. Cardell, M. Kronenberg, and T. Herrmann
The Complementarity Determining Region 2 of BV8S2 (Vbeta8.2) Contributes to Antigen Recognition by Rat Invariant NKT Cell TCR.
J. Immunol., June 15, 2006; 176(12): 7447 - 7455.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Med.Home page
D. G. Wei, S. A. Curran, P. B. Savage, L. Teyton, and A. Bendelac
Mechanisms imposing the V{beta} bias of V{alpha}14 natural killer T cells and consequences for microbial glycolipid recognition
J. Exp. Med., May 15, 2006; 203(5): 1197 - 1207.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Med.Home page
L. Kjer-Nielsen, N. A. Borg, D. G. Pellicci, T. Beddoe, L. Kostenko, C. S. Clements, N. A. Williamson, M. J. Smyth, G. S. Besra, H. H. Reid, et al.
A structural basis for selection and cross-species reactivity of the semi-invariant NKT cell receptor in CD1d/glycolipid recognition
J. Exp. Med., March 20, 2006; 203(3): 661 - 673.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Med.Home page
S. D. Gadola, M. Koch, J. Marles-Wright, N. M. Lissin, D. Shepherd, G. Matulis, K. Harlos, P. M. Villiger, D. I. Stuart, B. K. Jakobsen, et al.
Structure and binding kinetics of three different human CD1d-{alpha}-galactosylceramide-specific T cell receptors
J. Exp. Med., March 20, 2006; 203(3): 699 - 710.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Schumann, M. P. Mycko, P. Dellabona, G. Casorati, and H. R. MacDonald
Cutting Edge: Influence of the TCR Vbeta Domain on the Selection of Semi-Invariant NKT Cells by Endogenous Ligands
J. Immunol., February 15, 2006; 176(4): 2064 - 2068.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Schumann, P. Pittoni, E. Tonti, H. R. MacDonald, P. Dellabona, and G. Casorati
Targeted Expression of Human CD1d in Transgenic Mice Reveals Independent Roles for Thymocytes and Thymic APCs in Positive and Negative Selection of V{alpha}14i NKT Cells
J. Immunol., December 1, 2005; 175(11): 7303 - 7310.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Su, R. E. Berg, S. Murray, and J. Forman
Thymus-Dependent Memory Phenotype CD8 T Cells in Naive B6.H-2Kb-/-Db-/- Animals Mediate an Antigen-Specific Response against Listeria monocytogenes
J. Immunol., November 15, 2005; 175(10): 6450 - 6457.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Skold, X. Xiong, P. A. Illarionov, G. S. Besra, and S. M. Behar
Interplay of Cytokines and Microbial Signals in Regulation of CD1d Expression and NKT Cell Activation
J. Immunol., September 15, 2005; 175(6): 3584 - 3593.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Ota, K. Takeda, H. Akiba, Y. Hayakawa, K. Ogasawara, Y. Ikarashi, S. Miyake, H. Wakasugi, T. Yamamura, M. Kronenberg, et al.
IFN-{gamma}-mediated negative feedback regulation of NKT-cell function by CD94/NKG2
Blood, July 1, 2005; 106(1): 184 - 192.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. N. Ajuebor, A. I. Aspinall, F. Zhou, T. Le, Y. Yang, S. J. Urbanski, S. Sidobre, M. Kronenberg, C. M. Hogaboam, and M. G. Swain
Lack of Chemokine Receptor CCR5 Promotes Murine Fulminant Liver Failure by Preventing the Apoptosis of Activated CD1d-Restricted NKT Cells
J. Immunol., June 15, 2005; 174(12): 8027 - 8037.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. K. Stanic, R. Shashidharamurthy, J. S. Bezbradica, N. Matsuki, Y. Yoshimura, S. Miyake, E. Y. Choi, T. D. Schell, L. Van Kaer, S. S. Tevethia, et al.
Another View of T Cell Antigen Recognition: Cooperative Engagement of Glycolipid Antigens by Va14Ja18 Natural TCR
J. Immunol., November 1, 2003; 171(9): 4539 - 4551.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schümann, J.
Right arrow Articles by MacDonald, H. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schümann, J.
Right arrow Articles by MacDonald, H. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS