The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Glogauer, M.
Right arrow Articles by Kwiatkowski, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Glogauer, M.
Right arrow Articles by Kwiatkowski, D. J.
The Journal of Immunology, 2003, 170: 5652-5657.
Copyright © 2003 by The American Association of Immunologists

Rac1 Deletion in Mouse Neutrophils Has Selective Effects on Neutrophil Functions1

Michael Glogauer2,*,{dagger}, Christophe C. Marchal{ddagger}, Fei Zhu{dagger}, Aelaf Worku*, Björn E. Clausen§, Irmgard Foerster, Peter Marks*, Gregory P. Downey||, Mary Dinauer{ddagger} and David J. Kwiatkowski*

* Brigham and Women’s Hospital, Boston, MA 02115; {dagger} University of Toronto, Toronto, Canada; {ddagger} Department of Pediatrics (Hematology/Oncology), Indiana University School of Medicine, Indianapolis, IN 46202; § Department of Cell Biology and Histology, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands; Institute for Medical Microbiology, Immunology and Hygiene, Technical University of Munich, Munich, Germany; and || Department of Medicine, Division of Respirology, and The Toronto General Hospital Research Institute of the University Health Network, Toronto, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Defects in myeloid cell function in Rac2 knockout mice underline the importance of this isoform in activation of NADPH oxidase and cell motility. However, the specific role of Rac1 in neutrophil function has been difficult to assess since deletion of Rac1 results in embryonic lethality in mice. To elucidate the specific role of Rac1 in neutrophils, we generated mice with a conditional Rac1 deficiency restricted to cells of the granulocyte/monocyte lineage. As observed in Rac2-deficient neutrophils, Rac1-deficient neutrophils demonstrated profound defects in inflammatory recruitment in vivo, migration to chemotactic stimuli, and chemoattractant-mediated actin assembly. In contrast, superoxide production is normal in Rac1-deficient neutrophils but markedly diminished in Rac2 null cells. These data demonstrate that although Rac1 and Rac2 are both required for actin-mediated functions, Rac2 is specifically required for activation of the neutrophil NADPH oxidase.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The Rho family of small GTPases consists of three major members: Cdc42, Rac, and Rho (1). Within the Rac subclass there are three members; Rac1, Rac2, and Rac3 (2). Rac1 is ubiquitously expressed while Rac2 expression is restricted to cells of the hemapoietic lineage. Rac3, the most recently described Rac isoform, is expressed in brain, lung, liver, and pancreas (2) but not in neutrophils (U. Knauss, unpublished observations). Although Rac2 is the predominant isoform in human neutrophils (3), murine neutrophils express similar amounts of Rac1 and Rac2 (4). Rac1 and Rac2 share 92% amino acid identity with the major divergence occurring in the C terminus. Importantly, this region determines the subcellular localization and interactions of Rac with some downstream effector proteins (5, 6).

Racs are known to be key regulators of the actin cytoskeleton and of the NADPH oxidase system in neutrophils (7, 8, 9, 10). Recent studies using Rac2-deficient mice and neutrophils from a patient with a naturally occurring mutation in Rac2 have demonstrated that this isoform is a key regulator of several antimicrobial functions including dynamic alterations of the actin cytoskeleton required for cell migration, cell shape, and generation of reactive oxygen species by the NADPH oxidase complex (11, 12, 13, 14). However, the specific role of Rac1 in neutrophils remains obscure. The high degree of homology in the effector regions of Rac1 and 2 has led to the hypothesis that these two proteins function interchangeably. Furthermore, in in vitro cell-free assays of the NADPH oxidase, prenylated Rac1 and Rac2 are indistinguishable. Using purified neutrophil membranes and recombinant Rac1 and Rac2, Heyworth et al. (10) demonstrated that both isoforms have equal activity in reconstitution of superoxide production, although Rac2 was more efficient in the presence of neutrophil cytosol. In permeabilized human neutrophils, Rac1 and Rac2 activated actin assembly similarly and catalytically inactive forms of Rac1 and Rac2 were equally effective at inhibiting fMLP-mediated actin assembly (15). However, the conditions used for all these in vitro systems may not replicate conditions present in intact cells.

Recent studies using Rac2-deficient neutrophils suggest that Rac1 and Rac2 have discrete functions inasmuch as activation and signaling profiles for each isoform in intact neutrophils are unique (4). In fMLP-activated murine neutrophils, 4-fold more Rac2 is activated compared with Rac1. In addition, using Rac2 null and Rac2 heterozygous mice, Li et al. (4) demonstrated that the level of activated Rac2 is rate limiting for fMLP-induced F-actin polymerization, chemotaxis, and superoxide generation (4). However the role of Rac1 in regulating neutrophil functions has not been evaluated. Investigation of the specific roles of these two Rac isoforms and specifically Rac1 in primary neutrophils requires an alternative model to the in vitro models used previously.

Targeted gene disruption in the mouse is an alternate approach to elucidate the distinct functions of Rac1 and 2, because in theory each gene can be disrupted individually. However, Rac1 deficiency results in embryonic lethality (16). To examine the specific role of Rac1 in neutrophil function, we generated mice in which the rac1 gene is selectively disrupted in cells of granulocyte/monocyte lineage. As described herein, this was accomplished using a conditional ("floxed") allele of rac1 and a mouse expressing the Cre recombinase under the control of a neutrophil/monocyte-specific promoter (Lysozyme M). We demonstrate here for the first time that Rac1 null neutrophils have significant defects in inflammatory recruitment in vivo, migration to chemotactic stimuli, and chemoattractant-mediated actin assembly. However, superoxide production is normal in Rac1-deficient neutrophils in contrast to Rac2 null cells. These new data, combined with comparisons to Rac2 null mice, are the first demonstration in functional primary neutrophils that Rac2 is specifically required for superoxide generation in neutrophils, whereas Rac1 and Rac2 are both important regulators of actin-mediated neutrophil functions.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Gene targeting in embryonic stem (ES)3 cells

A 10-kb fragment of the murine Rac1 gene containing the first exon was isolated from a {lambda} phage library made from J1 ES cell DNA (Fig. 1). This fragment was cloned and engineered as shown to contain a loxP sequence inserted at a SpeI site and a loxP-flanked neomycin resistance-thymidine kinase cassette inserted at a StuI site. Following electroporation of the targeting construct into the J1 ES cell line, ~10% of clonal lines selected with neomycin demonstrated evidence of homologous recombination using a flanking Rac1 fragment in Southern blot experiments. One of these clones was expanded and transfected with a cre recombinase expression cassette, and subclones were isolated and analyzed to identify clones with either a conditional, loxP-flanked allele or a deleted allele (Fig. 1). The integrity of the Rac1 genomic region was assessed by multiple Southern blot analyses (data not shown) and targeted ES cell clones were injected into blastocysts for generation of chimeras and germline transmission. Genotyping of the initial offspring was performed by Southern blot (data not shown), and later by PCR genotyping, using the indicated primers (Fig. 1, B and C). Chimeras were bred to C57BL/6 mice and maintained as a mixed strain population.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 1. Construction of a conditional allele of Rac1. A, The genomic map near exon 1 of Rac1 is shown at the top, then the gene targeting construct, then the conditional allele, and last the map of the null allele generated by recombination in the conditional allele. B, BamHI; Sp, SpeI; X, XhoI; S, SacI sites are indicated. B, Diagram of PCR genotyping strategy used, including the positions of three primers. C, PCR genotyping of Rac1c/c and Rac1+/- parents (lanes 1 and 2, respectively) and Rac1c/+ (lanes 4, 5, 7, and 8) and Rac1c/- (lanes 3, 6, and 9) offspring. Racc designates the conditional allele, Rac+ designates the wild-type allele, and Rac- designates the null allele.

 
PCR genotyping analyses of ES cells and mice

Tail snips were used to prepare DNA for PCR analysis (17). PCR genotyping was performed by simultaneous amplification of the wild-type (Rac1+), conditional (Rac1c), and null (Rac1-) alleles using three primers: PO33, TCCAATCTGTGCTGCCCATC; PO45, CAGAGCTCGAATCCAGAAACTAGTA; and PO91, GATGCTTCTAGGGGTGAGCC (Fig. 1B). All three primers were included in a single PCR and yielded products of sizes 115 bp Rac1+, 140 bp Rac-, and 242 bp Racc, which were analyzed on 3% agarose gels. The presence of the LysMcre allele was assessed by a PCR using primers: cre-8, CCCAGAAATGCCAGATTACG and MLys1, CTTGGGCTGCCAGAATTTCTC, which yielded a product of size 620 bp (described previously in Ref. 18).

Animal care procedures

All procedures were conducted in accordance with the Guide for the Humane Use and Care of Laboratory Animals. These studies were approved by the Harvard Medical Area Standing Committee on Animals, the University of Toronto Animal Care Committee, and the Indiana University Animal Care and Use Committee.

Mouse breeding

Following establishment of Rac1 chimeras, germline transmission of both Rac1c and Rac1- alleles was readily achieved. Breeding studies indicated that no viable embryos at E8.5 (embryonic age in days) or later and no live offspring with a Rac1-/- genotype were obtained, similar to a previous study (16) indicating that the null allele was likely completely nonfunctional. In contrast Rac1c/c mice demonstrated no apparent pathology with normal fertility and survival past 2 years of age. Breeding the Rac1c/- with a mouse expressing the LysMcre allele (described previously in Ref. 18) resulted in generation of mice with genotypes of Rac1c/+LysMcre/+ and Rac1+/-LysMcre/+. These mice were interbred to yield mice with the genotype Rac1c/-LysMcre/+ as well as littermate controls of several genotypes. Rac1c/+LysM+/+ and Rac1+/+LysMcre/+ were used exclusively as controls. Rac2-/- mice previously described (14) were backcrossed (>12 generations) into C57BL/6J mice (The Jackson Laboratory, Bar Harbor, Me). All experiments were performed with mice 6–13 wk old.

Neutrophil preparations

Heterozygous and wild-type littermates were euthanized by CO2 inhalation. Femurs and tibias were removed and bone marrow was isolated. Erythrocytes were lysed using E-Lyse (Cardinal Associates, Phoenix, AZ) and the remaining bone marrow cells were layered onto discontinuous Percoll (Sigma-Aldrich, Ontario, Canada) gradient of 82%/65%/55% (19). Mature neutrophils were recovered at the 82%/65% interface and were demonstrated to be positive for Gr-1 and Mac-1 by flow cytometry. More than 85% of cells isolated were neutrophils as assessed by Wright-Giemsa staining. Viability as determined by trypan blue exclusion was >90%.

Measurement of neutrophil NADPH oxidase activity

Neutrophil NADPH oxidase activity was measured as superoxide dismutase-inhibitable superoxide production using an isoluminol chemiluminescence assay for cells activated by 10 µM fMLP or the cytochrome c reduction assay for cells activated with 200 ng/ml PMA (Sigma-Aldrich) as described previously (4). NADPH oxidase activity was compared in neutrophils isolated from Rac1c/-LysMcre/+ mice and control littermates. In addition, neutrophils from Rac2 null and wild-type C57BL/6J mice were assayed in parallel. There was no significant difference in neutrophil NADPH oxidase activity between Rac1 colony control littermates and C57BL/6J wild-type mice.

Chemotaxis assays

Bone marrow neutrophils were placed into the upper well of a Transwell chamber which was separated from the bottom chamber, containing the indicated fMLP (Sigma-Aldrich) concentration by a membrane with 3-µm pores (Corning, Corning, NY) (14). The Transwell plates were incubated at 37°C for 1 h and cells migrating through the membrane and onto the bottom coverslip were fixed with 3.7% paraformaldehyde. The number of cells per field was counted for each condition. A checkerboard approach was used which included having chemoattractant present only in the bottom well (chemotaxis) or in the top and bottom wells (chemokinesis). This approach verified that the fMLP-induced cell recruitment into the bottom chamber was a result of chemotaxis and not chemokinesis.

F-actin assembly assay

Bone marrow neutrophils were incubated at 37°C for 30 min following isolation in HBSS. One micromolar fMLP was added for the indicated time (0–30 min). Cells were immediately fixed with 3.7% paraformaldehyde, permeabilized (0.1% Triton X-100), and stained with 1 U/500 µl of Alexa-phalloidin (Molecular Probes, Eugene, OR) to detect F-actin content. Cellular fluorescence intensity was measured with a BD Biosciences FACScan flow cytometer (14) (BD Biosciences, Franklin Lakes, NJ). fMLP-mediated F-actin assembly was completely inhibited by cytochalasin B in all samples, verifying that we were observing actin assembly.

Sodium periodate peritonitis

To induce an experimental peritonitis, 1 ml of 5 mM sodium periodate (Sigma-Aldrich) in PBS was injected i.p.. The mice were killed 3 h later and the peritoneal exudate was collected by lavage with chilled PBS (20 ml/mouse). Neutrophils were counted by hemocytometer and electronic cell counter (BD Biosciences).

Quantification of Rac1 and Rac2 by immunoblot assay

Cell lysates of murine bone marrow neutrophils were prepared and subjected to 12% SDS-PAGE and immunoblotting as previously described (4). For quantification of Rac1 levels in cells, serial dilutions of rRac1 were loaded in adjacent lanes. Blots were probed with a mouse mAb for Rac1 and an anti-mouse secondary Ab conjugated with HRP and developed using ECL (Amersham Pharmacia Biotech, Piscataway, NJ). Densitometry was used to determine the intensity of signals for scanned films using NIH Image software (Research Services Branch, National Institute of Mental Health, Bethesda, MD). Multiple exposures were analyzed to ensure that relative signal intensities measured were in the linear range.

Statistics

ANOVA and Student’s t tests were performed. The Bonferroni test was used for post hoc testing. All experiments were repeated on at least three separate occasions and error bars in figures represent SEM. There were no observed significant differences between the two wild-type control mouse genotypes (Rac1c/+LysMcre/+ or Rac1c/+LysM+/+) in any of the experiments performed.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of mice with neutrophils lacking Rac1 expression

To investigate the function of Rac1 in neutrophils, we bred Rac1c/c mice (Fig. 1) with mice bearing a targeted insertion of the cre recombinase cDNA into the LysM gene (LysMcre) (18). The LysM gene encodes lysozyme, an enzyme that is expressed at high levels in myeloid cells. Previous studies have shown that the LysMcre allele leads to deletion efficiencies of 83–98% in mature macrophages and near 100% in granulocytes of floxed alleles (18). Mice were obtained with genotype Rac1c/-LysMcre/+ (Rac1 null neutrophils) and were compared with littermate control mice of genotypes Rac1c/+LysMcre/+ or Rac1c/+LysM+/+.

PCR analysis of genomic DNA from peritoneal neutrophils from Rac1c/+LysMcre/+ mice demonstrated near complete conversion of the conditional allele into the null allele (Fig. 2A). Rac1 protein expression was assessed by Western blots of bone marrow (data not shown) and peritoneal neutrophils (Fig. 2B). Western blot analysis using rRac1 as a standard demonstrated that wild-type neutrophils contain 1.15 x 10-4 ± 1.1 x 10-5 ng of Rac1, similar to previous reports (4). A very faint residual Rac1 band was detected in lysates from Rac1 null (Rac1c/-LysMcre/+) neutrophils corresponding to 1.11 x 10-5 ± 1.2 x 10-6 ng of Rac1. Since recombination mediated by Cre recombinase either occurs or does not occur, either neutrophils have no Rac1 or have normal Rac1 expression. As described previously and shown here (Fig. 2A), the LysM Cre mouse eliminates the flanked loxP DNA in >95% of neutrophils (18). The residual Rac1 protein detected in the Western blots is likely to result from a combination of non-neutrophil cell contamination (as our isolation procedure has ~10% contamination of other cell types) or Rac1 Ab cross-reactivity with Rac2 (4, 14) and small numbers (<5%) of neutrophils that retain Rac1 expression.



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 2. Recombination of the Rac1c allele to a null allele: genotyping and immunoblot analysis. A, PCR genotyping of DNA from peritoneal neutrophils and brain from Rac1c/+LysMcre/+ mice and control (Rac1c/+LysM+/+) neutrophils using primers indicated in Fig. 1. In Rac1c/+LysMcre/+ neutrophils, there is conversion of the Rac1c (conditional) allele to the Rac1- (null) allele. Rac1+ denotes the wild-type (w-type) allele. B, Representative immunoblot of Rac1 and 2 expression by peritoneal neutrophils. Note: There is no compensatory increase in Rac2 expression in the Rac1 null neutrophils. Racc designates the conditional allele, Rac+ designates the wild-type (WT) allele, and Rac- designates the null allele.

 
Deficient cellular inflammatory exudate and neutrophil chemotactic responses

The number of circulating leukocytes and neutrophils were equivalent in unstimulated wild-type and Rac1c/-LysMcre/+mice (Table I). However, 3 h following induction of peritonitis, circulating neutrophil and corresponding leukocyte counts increased significantly in wild-type controls but not in Rac1c/-LysMcre/+ mice (Table I; p < 0.04). Whereas the peripheral blood neutrophil counts increased more than 3-fold from 1.67 ± 1.8 x 109/L to 6.2 ± 1.2 x 109/L in wild-type mice, only a small change in the neutrophil count was observed in the Rac1c/-LysMcre/+mice from 1.57 ± 1.0 x 109/L to 2.8 ± 0.6 x 109/L (Table I). The acute increase in peripheral blood neutrophil counts in response to an inflammatory stimulus largely reflects mobilization from the bone marrow storage pool (20). The impaired response of Rac1c/-LysMcre/+mice suggests that neutrophils lacking Rac1 are not able to leave the bone marrow at the same rate as wild-type control neutrophils.


View this table:
[in this window]
[in a new window]
 
Table I. Circulating leukocytes and neutrophils before and 3 h after sodium periodate injection (SP)

 
Since Rac2-deficient neutrophils have defects in their migratory capacity (14), we assessed the ability of Rac1 null neutrophils to migrate to a site of inflammation in vivo (14). In a peritoneal inflammation model (14), we observed a >50% reduction in neutrophil accumulation 3 h after sodium periodate injection into the peritoneum of Rac1c/-LysMcre/+mice (Fig. 3A). This strongly suggests that Rac1 plays an important role in the steps required for neutrophil accumulation at sites of inflammation. Reduced numbers of peritoneal exudate neutrophils in Rac1 null mice could in part reflect the smaller numbers of neutrophils seen in peripheral blood following induction of peritonitis. To determine whether impaired neutrophil migration might also contribute to residual exudate formations, we assessed neutrophil chemotaxis to fMLP in vitro. The fMLP-directed movement of Rac1-deficient bone marrow neutrophils was reduced by almost 50% as compared with control littermates both at 1 and 10 µM fMLP (Fig. 3B). This result implicates Rac1 as a key mediator of neutrophil chemotaxis.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 3. Analysis of Rac1 null neutrophil function. A, In vivo response to sodium periodate-induced inflammation. Peritoneal neutrophils were counted 3 h after i.p. injection of 1 ml of sodium periodate. Mean ± SD (n = 6; *, p < 0.01). B, Bone marrow neutrophil chemotaxis was assessed in a Transwell migration assay using gradients of fMLP as described (mean ± SEM of five mice per group; *, p < 0.05). C, Reduced fMLP-induced actin polymerization kinetics in mouse neutrophils lacking Rac1. Note the slower rate of actin polymerization in Rac1 null neutrophils compared with control neutrophils (representative of three experiments; *, p < 0.01)

 
Altered F-actin generation

Since the Rac small GTPases have been implicated as key regulators of the actin cytoskeleton and to determine the underlying role by which Rac1 regulates the chemotactic process of neutrophils, we assessed fMLP-induced actin polymerization in Rac1 null neutrophils using flow cytometry. Rac1 null neutrophils demonstrated a significant reduction in fMLP-induced F-actin formation and the kinetics of assembly were delayed compared with those of wild-type controls (Fig. 3C). This reduced early actin polymerization, which is crucial to the chemotactic process (21), may in part explain the observed defects in neutrophil chemotaxis and in vivo recruitment to sites of acute inflammation.

Superoxide production is normal in Rac1-deficient neutrophils

Since Rac1 and Rac2 have each been implicated as key regulators of superoxide production in studies using cell-free assays and since Rac2 null neutrophils have deficiencies in superoxide generation, we assessed whether Rac1 is also required for superoxide generation in intact primary neutrophils. Neutrophils from Rac2 null mice previously described (14) along with C57BL/6J controls were compared with Rac1 null neutrophils and matching littermate controls. NADPH oxidase activity was measured in bone marrow neutrophils stimulated with either PMA or fMLP. Rac1 null neutrophils demonstrated no significant impairment in superoxide production in response to PMA when compared with wild-type littermates in contrast to the marked defect observed in Rac2 null neutrophils (Fig. 4A). fMLP-induced superoxide production was also similar in wild-type and Rac1 null mice (Fig. 4). This again contrasts with the substantially diminished NADPH oxidase activity in fMLP-stimulated Rac2 null neutrophils, which have both a delay in reaching maximal enzyme activity (Fig. 4B) as well as an overall decrease in oxidant production (Fig. 4C). There was no significant difference between wild-type littermate controls and wild-type C57BL/6J controls, indicating that strain differences were not important in these measurements (data not shown).



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 4. Rac1 is not required for superoxide production. A, The rate of superoxide production by bone marrow neutrophils following stimulation with 0.2 µg/ml PMA was monitored by the superoxide dismutase-inhibitable reduction of cytochrome c. The units for Vmax are equal to nanomoles of superoxide per minute per 107 cells (mean ± SEM of five mice per group (*, p < 0.01, Bonferroni’s test). Although the overall magnitude of PMA-elicited NADPH oxidase activity was decreased in Rac2 null mice, the overall kinetics were not affected (data not shown). B, fMLP-induced superoxide production in bone marrow neutrophils is only perturbed in neutrophils lacking Rac2 but not Rac1. The time course of superoxide production for neutrophils lacking Rac1 was similar to that of wild-type cells in contrast to Rac2 null neutrophils. A representative kinetic plot for the fMLP-induced superoxide production is presented. RLU, Relative luminescence units. C, Data shows the relative luminescence units integrated over 60 s as measured in fMLP-stimulated neutrophils using superoxide dismutase-inhibitable isoluminol chemiluminescence. The three neutrophil genotypes are as indicated (mean ± SEM of six mice per group; *, p < 0.01).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Neutrophils are critical cells of the innate immune system carrying out a coordinated set of functions following their recruitment and migration to sites of infection which result in the elimination of invading pathogens. Neutrophil migration and oxygen radical generation through the NADPH oxidase are regulated by two members of the small GTPase Rac family, Rac1 and Rac2. The critical importance of Rac2 in neutrophil chemotaxis and NADPH oxidase function has been established in vivo using Rac2 null mice (4, 14). Because Rac1 and Rac2 have 92% homology (5) as well as similar biochemical functions in reconstituted systems in vitro (22), it has been hypothesized that there is significant functional overlap between these two proteins. However, the level of in vivo redundancy between these two proteins has not been studied previously. In this report, we investigate the specific roles of Rac1 in neutrophil function using a conditional gene targeting approach to generate mice with Rac1 null neutrophils.

Rac1 is a key regulator of neutrophil actin assembly and migration

Our studies demonstrate that Rac1 null neutrophils have defects in regulation of the actin cytoskeleton and in neutrophil migration similar to defects seen in Rac2 null neutrophils (14). However, our data also confirm that Rac2 cannot compensate completely for Rac1 deletion and vice versa. Although it is possible that the similar phenotypes may be due to a reduction in total Rac (Rac1 and Rac2), recent evidence (4) demonstrates that Rac1 and Rac2 are differentially activated downstream of chemoattractant receptors, suggesting that Rac1 and Rac2 may have nonoverlapping roles in signaling pathways between membrane receptors and downstream targets. The notion of distinct functions for Rac1 and 2 is further supported by our observation that NADPH oxidase activity is normal in the absence of Rac1, whereas Rac2 deletion results in severely diminished oxidase activity (4).

It is important to note that although Rac2 is the predominant Rac isoform in human neutrophils (10), it has recently been demonstrated that between 20 and 25% of total Rac in human neutrophils is Rac1 (4). This suggests that although Rac2 is the predominant isoform, Rac1 may also participate in regulating neutrophil function.

Role of Rac in superoxide generation

Cell-free NADPH oxidase studies have used Rac1 and 2 interchangeably to reconstitute a functional oxidase complex (9, 10, 23). Dorseuil et al. (24), using a yeast two- hybrid system, demonstrated that nonprenylated Rac2 has a 6-fold higher affinity for p67phox, a key oxidase complex protein, than nonprenylated Rac1. These data suggest that Rac2 may be the preferential Rac for regulating the NADPH oxidase complex. Heyworth et al. (10) also demonstrated that recombinant prenylated Rac2 is more efficient at regulating the NADPH oxidase complex than Rac1 in the presence of neutrophil cytosol. This suggests that there could be a preferential interaction of Rac2 with cytosolic components that promote assembly of the active NADPH oxidase complex. Our results demonstrate for the first time, in primary intact neutrophils, that Rac1 is not required for NADPH oxidase function in vivo.

Mechanisms for nonoverlapping functions

Two possible mechanisms may explain why Rac1 and Rac2 are not able to completely compensate for the loss of the alternate isoform in chemoattractant-activated F-actin assembly and chemotaxis. First, the majority of sequence heterogeneity between these two proteins occurs in the C-terminal hypervariable region that has been implicated in the targeting of the small GTPases to subcellular membrane domains (5). Michaelson et al. (5) have demonstrated that activated Rac1 and 2 differentially localize to unique domains in fibroblast and epithelial cells; Rac2 accumulates predominantly on endomembranes whereas Rac1 is located predominantly at the plasma membrane. Localized targeting of each Rac isoform to unique membrane domains may be essential for normal regulation of cell migration and chemotaxis since actin-mediated cell locomotion is composed of a complex series of events involving cycles of actin polymerization and depolymerization localized to discrete cellular domains. Although actin polymerization at the leading edge is believed to drive membrane protrusion (21), actin assembly in other cytoplasmic regions including at cell-extracellular tissue matrix receptor sites (integrins) and rearward recycling membrane domains are also critical to normal cell locomotion (25). This may explain why these proteins have similar functional biochemical properties in vitro but are unable to compensate for the others loss in vivo.

Another possibility is that Rac1 and Rac2 may have different downstream targets. The C-terminal domain of Rac is also involved in binding to downstream effector targets. Rac1 has a 2-fold greater ability to bind and a 5-fold greater ability to stimulate the kinase activity of PAK1 compared with Rac2 (26). PAK1 translocates to areas of active cytoskeletal rearrangement (27) and microinjection of active PAK1 resulted in the induction of lamellipodia and membrane ruffling in fibroblasts (28). Furthermore, recent studies have demonstrated that the Rac2 C-terminal polybasic TRQQKRP motif is required for normal Rac2 localization and function (6). These data suggest that differential targeting and unique downstream protein targets may explain the nonoverlapping roles of these isoforms.

In conclusion, this study demonstrates that in intact neutrophils, Rac1 and 2 play significant roles in regulation of the actin cytoskeleton and neutrophil migration, but that Rac2 is the isoform responsible for regulating the NADPH oxidase complex. The lack of balancing compensation by the remaining Rac isoform in the knockout mice, the preferential role of Rac2 as the isoform involved in NADPH oxidase, and recent reports of the differential activation of Rac1 and Rac2 (4) strongly suggest that Rac1 and Rac2 each have unique roles in neutrophil functions.


    Footnotes
 
1 This work was supported by Canadian Institutes of Health Research grants (to M.G. and G.P.D.) and National Institutes of Health Grants HL54188 (to D.J.K.), ROI HL45635 (to M.D.), and POI HL069974 (to M.D.). M.G. is a Canadian Institutes of Health Research Clinician Scientist. Back

2 Address correspondence and reprint requests to Dr. Michael Glogauer, University of Toronto, Room 241, 150 College Street, Toronto, Ontario, Canada M5S 1A8. E-mail address: michael.glogauer{at}utoronto.ca Back

3 Abbreviation used in this paper: ES, embryonic cell. Back

Received for publication December 12, 2002. Accepted for publication March 20, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hall, A.. 1992. Ras-related GTPases and the cytoskeleton. Mol. Biol. Cell 3:475.[Abstract]
  2. Haataja, L., J. Groffen, N. Heisterkamp. 1997. Characterization of RAC3, a novel member of the Rho family. J. Biol. Chem. 272:20384.[Abstract/Free Full Text]
  3. Heyworth, P. G., B. P. Bohl, G. M. Bokoch, J. T. Curnutte. 1994. Rac translocates independently of the neutrophil NADPH oxidase components p47phox and p67phox: evidence for its interaction with flavocytochrome b558. J. Biol. Chem. 269:30749.[Abstract/Free Full Text]
  4. Li, S., A. Yamauchi, C. C. Marchal, J. K. Molitoris, L. A. Quilliam, M. C. Dinauer. 2002. Chemoattractant-stimulated rac activation in wild-type and rac2-deficient murine neutrophils: preferential activation of rac2 and rac2 gene dosage effect on neutrophil functions. J. Immunol. 169:5043.[Abstract/Free Full Text]
  5. Michaelson, D., J. Silletti, G. Murphy, P. D’Eustachio, M. Rush, M. R. Philips. 2001. Differential localization of Rho GTPases in live cells: regulation by hypervariable regions and RhoGDI binding. J. Cell Biol. 152:111.[Abstract/Free Full Text]
  6. Tao, W., M. D. Filippi, J. R. Bailey, S. J. Atkinson, B. Connors, A. Evan, D. A. Williams. 2002. The TRQQKRP motif located near the C-terminus of Rac2 is essential for Rac2 biologic functions and intracellular localization. Blood 100:1679.[Abstract/Free Full Text]
  7. Dharmawardhane, S., G. M. Bokoch. 1997. Rho GTPases and leukocyte cytoskeletal regulation. Curr. Opin. Hematol. 4:12.[Medline]
  8. Abo, A., E. Pick, A. Hall, N. Totty, C. G. Teahan, A. W. Segal. 1991. Activation of the NADPH oxidase involves the small GTP-binding protein p21rac1. Nature 353:668.[Medline]
  9. Knaus, U. G., P. G. Heyworth, T. Evans, J. T. Curnutte, G. M. Bokoch. 1991. Regulation of phagocyte oxygen radical production by the GTP-binding protein Rac 2. Science 254:1512.[Abstract/Free Full Text]
  10. Heyworth, P. G., U. G. Knaus, J. Settleman, J. T. Curnutte, G. M. Bokoch. 1993. Regulation of NADPH oxidase activity by Rac GTPase activating protein(s). Mol. Biol. Cell 4:1217.[Abstract]
  11. Ambruso, D. R., C. Knall, A. N. Abell, J. Panepinto, A. Kurkchubasche, G. Thurman, C. Gonzalez-Aller, A. Hiester, M. deBoer, R. J. Harbeck, et al 2000. Human neutrophil immunodeficiency syndrome is associated with an inhibitory Rac2 mutation. Proc. Natl. Acad. Sci. USA 97:4654.[Abstract/Free Full Text]
  12. Kim, C., M. C. Dinauer. 2001. Rac2 is an essential regulator of neutrophil nicotinamide adenine dinucleotide phosphate oxidase activation in response to specific signaling pathways. J. Immunol. 166:1223.[Abstract/Free Full Text]
  13. Williams, D. A., W. Tao, F. Yang, C. Kim, Y. Gu, P. Mansfield, J. E. Levine, B. Petryniak, C. W. Derrow, C. Harris, et al 2000. Dominant negative mutation of the hematopoietic-specific Rho GTPase, Rac2, is associated with a human phagocyte immunodeficiency. Blood 96:1646.[Abstract/Free Full Text]
  14. Roberts, A. W., C. Kim, L. Zhen, J. B. Lowe, R. Kapur, B. Petryniak, A. Spaetti, J. D. Pollock, J. B. Borneo, G. B. Bradford, et al 1999. Deficiency of the hematopoietic cell-specific Rho family GTPase Rac2 is characterized by abnormalities in neutrophil function and host defense. Immunity 10:183.[Medline]
  15. Glogauer, M., J. Hartwig, T. Stossel. 2000. Two pathways through Cdc42 couple the N-formyl receptor to actin nucleation in permeabilized human neutrophils. J. Cell Biol. 150:785.[Abstract/Free Full Text]
  16. Sugihara, K., N. Nakatsuji, K. Nakamura, K. Nakao, R. Hashimoto, H. Otani, H. Sakagami, H. Kondo, S. Nozawa, A. Aiba, M. Katsuki. 1998. Rac1 is required for the formation of three germ layers during gastrulation. Oncogene 17:3427.[Medline]
  17. Onda, H., A. Lueck, P. W. Marks, H. B. Warren, D. J. Kwiatkowski. 1999. Tsc2+/- mice develop tumors in multiple sites that express gelsolin and are influenced by genetic background. J. Clin. Invest. 104:687.[Medline]
  18. Clausen, B. E., C. Burkhardt, W. Reith, R. Renkawitz, I. Forster. 1999. Conditional gene targeting in macrophages and granulocytes using LysMcre mice. Transgenic Res. 8:265.[Medline]
  19. Allport, J. R., Y. C. Lim, J. M. Shipley, R. M. Senior, S. D. Shapiro, N. Matsuyoshi, D. Vestweber, F. W. Luscinskas. 2002. Neutrophils from MMP-9- or neutrophil elastase-deficient mice show no defect in transendothelial migration under flow in vitro. J. Leukocyte Biol. 71:821.[Abstract/Free Full Text]
  20. Jagels, M. A., T. E. Hugli. 1994. Mechanisms and mediators of neutrophilic leukocytosis. Immunopharmacology. Immunopharmacology 28:1.[Medline]
  21. Stossel, T. P.. 1994. The machinery of cell crawling. Sci. Am. 271:54.[Medline]
  22. Dinauer, M. C.. 2003. Regulation of neutrophil function by Rac GTPases. Curr. Opin. Hematol. 10:8.[Medline]
  23. Diekmann, D., A. Abo, C. Johnston, A. W. Segal, A. Hall. 1994. Interaction of Rac with p67phox and regulation of phagocytic NADPH oxidase activity. Science 265:531.[Abstract/Free Full Text]
  24. Dorseuil, O., L. Reibel, G. M. Bokoch, J. Camonis, G. Gacon. 1996. The Rac target NADPH oxidase p67phox interacts preferentially with Rac2 rather than Rac1. J. Biol. Chem. 271:83.[Abstract/Free Full Text]
  25. Lauffenburger, D. A., A. F. Horwitz. 1996. Cell migration: a physically integrated molecular process. Cell 84:359.[Medline]
  26. Knaus, U. G., G. M. Bokoch. 1998. The p21Rac/Cdc42-activated kinases (PAKs). Int. J. Biochem. Cell Biol. 30:857.[Medline]
  27. Dharmawardhane, S., L. C. Sanders, S. S. Martin, R. H. Daniels, G. M. Bokoch. 1997. Localization of p21-activated kinase 1 (PAK1) to pinocytic vesicles and cortical actin structures in stimulated cells. J. Cell Biol. 138:1265.[Abstract/Free Full Text]
  28. Sells, M. A., U. G. Knaus, S. Bagrodia, D. M. Ambrose, G. M. Bokoch, J. Chernoff. 1997. Human p21-activated kinase (Pak1) regulates actin organization in mammalian cells. Curr. Biol. 7:202.



This article has been cited by other articles:


Home page
BloodHome page
K. Szczur, Y. Zheng, and M.-D. Filippi
The small Rho GTPase Cdc42 regulates neutrophil polarity via CD11b integrin signaling
Blood, November 12, 2009; 114(20): 4527 - 4537.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Murthy, A. Adamcakova-Dodd, S. S. Perry, L. A. Tephly, R. M. Keller, N. Metwali, D. K. Meyerholz, Y. Wang, M. Glogauer, P. S. Thorne, et al.
Modulation of reactive oxygen species by Rac1 or catalase prevents asbestos-induced pulmonary fibrosis
Am J Physiol Lung Cell Mol Physiol, November 1, 2009; 297(5): L846 - L855.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Zhang, C. Sun, M. Glogauer, and G. M. Bokoch
Human Neutrophils Coordinate Chemotaxis by Differential Activation of Rac1 and Rac2
J. Immunol., August 15, 2009; 183(4): 2718 - 2728.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Haruta, R. A. Bush, S. Kjellstrom, C. Vijayasarathy, Y. Zeng, Y.-Z. Le, and P. A. Sieving
Depleting Rac1 in mouse rod photoreceptors protects them from photo-oxidative stress without affecting their structure or function
PNAS, June 9, 2009; 106(23): 9397 - 9402.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
S. Corbetta, S. Gualdoni, G. Ciceri, M. Monari, E. Zuccaro, V. L. J. Tybulewicz, and I. de Curtis
Essential role of Rac1 and Rac3 GTPases in neuronal development
FASEB J, May 1, 2009; 23(5): 1347 - 1357.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Mehta, M. Glogauer, S. Becart, A. Altman, and K. M. Coggeshall
Adaptor Protein SLAT Modulates Fc{gamma} Receptor-mediated Phagocytosis in Murine Macrophages
J. Biol. Chem., May 1, 2009; 284(18): 11882 - 11891.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
N. Sawada, H.-H. Kim, M. A. Moskowitz, and J. K. Liao
Rac1 Is a Critical Mediator of Endothelium-Derived Neurotrophic Activity
Sci. Signal., March 10, 2009; 2(61): ra10 - ra10.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Guo, J. A. Cancelas, D. Hildeman, D. A. Williams, and Y. Zheng
Rac GTPase isoforms Rac1 and Rac2 play a redundant and crucial role in T-cell development
Blood, September 1, 2008; 112(5): 1767 - 1775.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
N. Sawada, S. Salomone, H.-H. Kim, D. J. Kwiatkowski, and J. K. Liao
Regulation of Endothelial Nitric Oxide Synthase and Postnatal Angiogenesis by Rac1
Circ. Res., August 15, 2008; 103(4): 360 - 368.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J. C. Gomez, J. Soltys, K. Okano, M. C. Dinauer, and C. M. Doerschuk
The Role of Rac2 in Regulating Neutrophil Production in the Bone Marrow and Circulating Neutrophil Counts
Am. J. Pathol., August 1, 2008; 173(2): 507 - 517.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. Yan, S. Chen, Y. Zhang, X. Li, Y. Li, X. Wu, J. Yuan, A. G. Robling, R. Karpur, R. J. Chan, et al.
Rac1 mediates the osteoclast gains-in-function induced by haploinsufficiency of Nf1
Hum. Mol. Genet., April 1, 2008; 17(7): 936 - 948.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
G. Hu, R. D. Ye, M. C. Dinauer, A. B. Malik, and R. D. Minshall
Neutrophil caveolin-1 expression contributes to mechanism of lung inflammation and injury
Am J Physiol Lung Cell Mol Physiol, February 1, 2008; 294(2): L178 - L186.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. Zemans and G. P. Downey
Role of caveolin-1 in regulation of inflammation: different strokes for different folks
Am J Physiol Lung Cell Mol Physiol, February 1, 2008; 294(2): L175 - L177.
[Full Text] [PDF]


Home page
Am. J. Pathol.Home page
A. Zarbock and K. Ley
Mechanisms and Consequences of Neutrophil Interaction with the Endothelium
Am. J. Pathol., January 1, 2008; 172(1): 1 - 7.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
C. X. Sun, M. A.O. Magalhaes, and M. Glogauer
Rac1 and Rac2 differentially regulate actin free barbed end formation downstream of the fMLP receptor
J. Cell Biol., October 22, 2007; 179(2): 239 - 245.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Woods, G. Wang, H. Dupuis, Z. Shao, and F. Beier
Rac1 Signaling Stimulates N-cadherin Expression, Mesenchymal Condensation, and Chondrogenesis
J. Biol. Chem., August 10, 2007; 282(32): 23500 - 23508.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
J. Reutershan, R. Stockton, A. Zarbock, G. W. Sullivan, D. Chang, D. Scott, M. A. Schwartz, and K. Ley
Blocking p21-activated Kinase Reduces Lipopolysaccharide-induced Acute Lung Injury by Preventing Polymorphonuclear Leukocyte Infiltration
Am. J. Respir. Crit. Care Med., May 15, 2007; 175(10): 1027 - 1035.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
X. Chen, T. D. Abair, M. R. Ibanez, Y. Su, M. R. Frey, R. S. Dise, D. B. Polk, A. B. Singh, R. C. Harris, R. Zent, et al.
Integrin {alpha}1{beta}1 Controls Reactive Oxygen Species Synthesis by Negatively Regulating Epidermal Growth Factor Receptor-Mediated Rac Activation
Mol. Cell. Biol., May 1, 2007; 27(9): 3313 - 3326.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. V. Miletic, D. B. Graham, V. Montgrain, K. Fujikawa, T. Kloeppel, K. Brim, B. Weaver, R. Schreiber, R. Xavier, and W. Swat
Vav proteins control MyD88-dependent oxidative burst
Blood, April 15, 2007; 109(8): 3360 - 3368.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. A. Clemens, L. E. Lenox, T. Kambayashi, N. Bezman, J. S. Maltzman, K. E. Nichols, and G. A. Koretzky
Loss of SLP-76 Expression within Myeloid Cells Confers Resistance to Neutrophil-Mediated Tissue Damage while Maintaining Effective Bacterial Killing
J. Immunol., April 1, 2007; 178(7): 4606 - 4614.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Fumagalli, H. Zhang, A. Baruzzi, C. A. Lowell, and G. Berton
The Src Family Kinases Hck and Fgr Regulate Neutrophil Responses to N-Formyl-Methionyl-Leucyl-Phenylalanine
J. Immunol., March 15, 2007; 178(6): 3874 - 3885.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
H. Oda, H. Suzuki, K. Sakai, S. Kitahara, M. S. Patrick, Y. Azuma, K. Sugi, T. Kitamura, J. Kaye, and M. Shirai
Rac1-mediated Bcl-2 induction is critical in antigen-induced CD4 single-positive differentiation of a CD4+CD8+ immature thymocyte line
J. Leukoc. Biol., February 1, 2007; 81(2): 500 - 508.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M.-D. Filippi, K. Szczur, C. E. Harris, and P.-Y. Berclaz
Rho GTPase Rac1 is critical for neutrophil migration into the lung
Blood, February 1, 2007; 109(3): 1257 - 1264.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
W. Ming, S. Li, D. D. Billadeau, L. A. Quilliam, and M. C. Dinauer
The Rac Effector p67phox Regulates Phagocyte NADPH Oxidase by Stimulating Vav1 Guanine Nucleotide Exchange Activity
Mol. Cell. Biol., January 1, 2007; 27(1): 312 - 323.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Szczur, H. Xu, S. Atkinson, Y. Zheng, and M.-D. Filippi
Rho GTPase CDC42 regulates directionality and random movement via distinct MAPK pathways in neutrophils
Blood, December 15, 2006; 108(13): 4205 - 4213.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. A. Kalfa, S. Pushkaran, N. Mohandas, J. H. Hartwig, V. M. Fowler, J. F. Johnson, C. H. Joiner, D. A. Williams, and Y. Zheng
Rac GTPases regulate the morphology and deformability of the erythrocyte cytoskeleton
Blood, December 1, 2006; 108(12): 3637 - 3645.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Utomo, X. Cullere, M. Glogauer, W. Swat, and T. N. Mayadas
Vav Proteins in Neutrophils Are Required for Fc{gamma}R-Mediated Signaling to Rac GTPases and Nicotinamide Adenine Dinucleotide Phosphate Oxidase Component p40(phox)
J. Immunol., November 1, 2006; 177(9): 6388 - 6397.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Cheretakis, R. Leung, C. X. Sun, Y. Dror, and M. Glogauer
Timing of neutrophil tissue repopulation predicts restoration of innate immune protection in a murine bone marrow transplantation model
Blood, October 15, 2006; 108(8): 2821 - 2826.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. N. Pestonjamasp, C. Forster, C. Sun, E. M. Gardiner, B. Bohl, O. Weiner, G. M. Bokoch, and M. Glogauer
Rac1 links leading edge and uropod events through Rho and myosin activation during chemotaxis
Blood, October 15, 2006; 108(8): 2814 - 2820.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. P. Wheeler, C. M. Wells, S. D. Smith, F. M. Vega, R. B. Henderson, V. L. Tybulewicz, and A. J. Ridley
Rac1 and Rac2 regulate macrophage morphology but are not essential for migration
J. Cell Sci., July 1, 2006; 119(13): 2749 - 2757.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Cheng, B. A. Diebold, Y. Hughes, and J. D. Lambeth
Nox1-dependent Reactive Oxygen Generation Is Regulated by Rac1
J. Biol. Chem., June 30, 2006; 281(26): 17718 - 17726.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Satoh, H. Ogita, K. Takeshita, Y. Mukai, D. J. Kwiatkowski, and J. K. Liao
Requirement of Rac1 in the development of cardiac hypertrophy
PNAS, May 9, 2006; 103(19): 7432 - 7437.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Kurihara, Y. Tohyama, S. Matsusaka, H. Naruse, E. Kinoshita, T. Tsujioka, Y. Katsumata, and H. Yamamura
Effects of Peripheral Cannabinoid Receptor Ligands on Motility and Polarization in Neutrophil-like HL60 Cells and Human Neutrophils
J. Biol. Chem., May 5, 2006; 281(18): 12908 - 12918.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
L. Vidali, F. Chen, G. Cicchetti, Y. Ohta, and D. J. Kwiatkowski
Rac1-null Mouse Embryonic Fibroblasts Are Motile and Respond to Platelet-derived Growth Factor
Mol. Biol. Cell, May 1, 2006; 17(5): 2377 - 2390.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
P. L. Hordijk
Regulation of NADPH Oxidases: The Role of Rac Proteins
Circ. Res., March 3, 2006; 98(4): 453 - 462.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
C. Kim and M. C. Dinauer
Impaired NADPH oxidase activity in Rac2-deficient murine neutrophils does not result from defective translocation of p47phox and p67phox and can be rescued by exogenous arachidonic acid
J. Leukoc. Biol., January 1, 2006; 79(1): 223 - 234.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Wang, L. Yang, M.-D. Filippi, D. A. Williams, and Y. Zheng
Genetic deletion of Cdc42GAP reveals a role of Cdc42 in erythropoiesis and hematopoietic stem/progenitor cell survival, adhesion, and engraftment
Blood, January 1, 2006; 107(1): 98 - 105.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Desire, J. Bourdin, N. Loiseau, H. Peillon, V. Picard, C. De Oliveira, F. Bachelot, B. Leblond, T. Taverne, E. Beausoleil, et al.
RAC1 Inhibition Targets Amyloid Precursor Protein Processing by {gamma}-Secretase and Decreases A{beta} Production in Vitro and in Vivo
J. Biol. Chem., November 11, 2005; 280(45): 37516 - 37525.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Sun, K. G. Buki, O. Ettala, J. P. Vaaraniemi, and H. K. Vaananen
Possible Role of Direct Rac1-Rab7 Interaction in Ruffled Border Formation of Osteoclasts
J. Biol. Chem., September 16, 2005; 280(37): 32356 - 32361.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
R. Pankov, Y. Endo, S. Even-Ram, M. Araki, K. Clark, E. Cukierman, K. Matsumoto, and K. M. Yamada
A Rac switch regulates random versus directionally persistent cell migration
J. Cell Biol., August 29, 2005; 170(5): 793 - 802.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Ueyama, M. Eto, K. Kami, T. Tatsuno, T. Kobayashi, Y. Shirai, M. R. Lennartz, R. Takeya, H. Sumimoto, and N. Saito
Isoform-Specific Membrane Targeting Mechanism of Rac during Fc{gamma}R-Mediated Phagocytosis: Positive Charge-Dependent and Independent Targeting Mechanism of Rac to the Phagosome
J. Immunol., August 15, 2005; 175(4): 2381 - 2390.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
S. A. Benitah, M. Frye, M. Glogauer, and F. M. Watt
Stem Cell Depletion Through Epidermal Deletion of Rac1
Science, August 5, 2005; 309(5736): 933 - 935.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. J. Cho, B. Zhang, V. Kaartinen, L. Haataja, I. de Curtis, J. Groffen, and N. Heisterkamp
Generation of rac3 Null Mutant Mice: Role of Rac3 in Bcr/Abl-Caused Lymphoblastic Leukemia
Mol. Cell. Biol., July 1, 2005; 25(13): 5777 - 5785.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. B. Snapper, P. Meelu, D. Nguyen, B. M. Stockton, P. Bozza, F. W. Alt, F. S. Rosen, U. H. von Andrian, and C. Klein
WASP deficiency leads to global defects of directed leukocyte migration in vitro and in vivo
J. Leukoc. Biol., June 1, 2005; 77(6): 993 - 998.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. T. Kneass and R. B. Marchase
Protein O-GlcNAc Modulates Motility-associated Signaling Intermediates in Neutrophils
J. Biol. Chem., April 15, 2005; 280(15): 14579 - 14585.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
A. Makino, M. Glogauer, G. M. Bokoch, S. Chien, and G. W. Schmid-Schonbein
Control of neutrophil pseudopods by fluid shear: role of Rho family GTPases
Am J Physiol Cell Physiol, April 1, 2005; 288(4): C863 - C871.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Yamauchi, C. C. Marchal, J. Molitoris, N. Pech, U. Knaus, J. Towe, S. J. Atkinson, and M. C. Dinauer
Rac GTPase Isoform-specific Regulation of NADPH Oxidase and Chemotaxis in Murine Neutrophils in Vivo: ROLE OF THE C-TERMINAL POLYBASIC DOMAIN
J. Biol. Chem., January 14, 2005; 280(2): 953 - 964.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. He, M. Nanamori, H. Sang, H. Yin, M. C. Dinauer, and R. D. Ye
Reconstitution of Chemotactic Peptide-Induced Nicotinamide Adenine Dinucleotide Phosphate (Reduced) Oxidase Activation in Transgenic COS-phox Cells
J. Immunol., December 15, 2004; 173(12): 7462 - 7470.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. X. Sun, G. P. Downey, F. Zhu, A. L. Y. Koh, H. Thang, and M. Glogauer
Rac1 is the small GTPase responsible for regulating the neutrophil chemotaxis compass
Blood, December 1, 2004; 104(12): 3758 - 3765.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Yamauchi, C. Kim, S. Li, C. C. Marchal, J. Towe, S. J. Atkinson, and M. C. Dinauer
Rac2-Deficient Murine Macrophages Have Selective Defects in Superoxide Production and Phagocytosis of Opsonized Particles
J. Immunol., November 15, 2004; 173(10): 5971 - 5979.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Nijhara, P. B. van Hennik, M. L Gignac, M. J. Kruhlak, P. L. Hordijk, J. Delon, and S. Shaw
Rac1 Mediates Collapse of Microvilli on Chemokine-Activated T Lymphocytes
J. Immunol., October 15, 2004; 173(8): 4985 - 4993.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. T. Quinn and K. A. Gauss
Structure and regulation of the neutrophil respiratory burst oxidase: comparison with nonphagocyte oxidases
J. Leukoc. Biol., October 1, 2004; 76(4): 760 - 781.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
M. A. M. Gakidis, X. Cullere, T. Olson, J. L. Wilsbacher, B. Zhang, S. L. Moores, K. Ley, W. Swat, T. Mayadas, and J. S. Brugge
Vav GEFs are required for {beta}2 integrin-dependent functions of neutrophils
J. Cell Biol., July 19, 2004; 166(2): 273 - 282.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
Y. Gu, M.-D. Filippi, J. A. Cancelas, J. E. Siefring, E. P. Williams, A. C. Jasti, C. E. Harris, A. W. Lee, R. Prabhakar, S. J. Atkinson, et al.
Hematopoietic Cell Regulation by Rac1 and Rac2 Guanosine Triphosphatases
Science, October 17, 2003; 302(5644): 445 - 449.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Glogauer, M.
Right arrow Articles by Kwiatkowski, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Glogauer, M.
Right arrow Articles by Kwiatkowski, D. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS