| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Production in Human NK and T Cells1
* Department of Microbiology, National Public Health Institute, Helsinki, Finland; and
Department of Cytokine Biology, ZymoGenetics, Seattle, WA 98102
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
is a key cytokine that stimulates innate immune responses and directs adaptive T cell response toward Th1 type. IL-15, IL-18, and IL-21 have significant roles as activators of NK and T cell functions. We have previously shown that IL-15 and IL-21 induce the expression of IFN-, T-bet, IL-12R
2, and IL-18R genes both in NK and T cells. Now we have studied the effect of IL-15, IL-18, and IL-21 on IFN- gene expression in more detail in human NK and T cells. IL-15 clearly activated IFN- mRNA expression and protein production in both cell types. IL-18 and IL-21 enhanced IL-15-induced IFN- gene expression. IL-18 or IL-21 alone induced a modest expression of the IFN- gene but a combination of IL-21 and IL-18 efficiently up-regulated IFN- production. We also show that IL-15 activated the binding of STAT1, STAT3, STAT4, and STAT5 to the regulatory sites of the IFN- gene. Similarly, IL-21 induced the binding of STAT1, STAT3, and STAT4 to these elements. IL-15- and IL-21-induced STAT1 and STAT4 activation was verified by immunoprecipitation with anti-phosphotyrosine Abs followed by Western blotting with anti-STAT1 and anti-STAT4 Abs. IL-18 was not able to induce the binding of STATs to IFN- gene regulatory sites. IL-18, however, activated the binding of NF-
B to the IFN- promoter NF-B site. Our results suggest that both IL-15 and IL-21 have an important role in activating the NK cell-associated innate immune response. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
has an important role in the activation of both innate and adaptive immunity. During early phases of infection, NK cell-derived IFN- activates macrophages and promotes adaptive Th1 immunity (1, 2). Direct cellular interaction with APCs and NK or T cells enhances the production of IFN- (3). IFN- is also produced in response to cytokines secreted by macrophages. In response to microbial infection, macrophages produce IFN-
, IL-12, IL-15, and IL-18, which stimulate NK cell-derived IFN- production (4, 5, 6, 7, 8, 9).
IL-15, IL-18, and IL-21 are cytokines that have important functions in NK and T cells. IL-15 and IL-18 are macrophage-derived cytokines while IL-21 is mainly produced by activated T cells (10, 11). IL-15 is essential for peripheral T cell maturation and studies with IL-15 and IL-15R knockout (KO)3 mice have shown that the lack of functional IL-15 system leads also to a severe reduction in NK cell numbers (12, 13, 14). In contrast, IL-15-transgenic mice suffer from fatal leukemia due to early expansions in NK and memory CD8+ T cells (15). NK cell responses are also impaired in IL-18 KO mice (16). In addition, IL-18 is an important cofactor in IFN- gene activation and it is required for both bacteria- and virus-induced IFN- production (5, 8, 17, 18, 19). IL-21 is structurally related to IL-15 and its receptor is expressed mainly on B, NK, and T cells (20). In contrast to IL-15R KO mice, NK and T cells of IL-21R KO mice develop normally (21). However, these mice have impaired NK cell functions (21). The common cytokine receptor -chain (c), shared by the receptors for IL-2, IL-4, IL-7, IL-9, and IL-15, is also a functional component of the IL-21R complex (22, 23). Therefore, it is not surprising that IL-21 activates the Janus kinase/STAT pathway. In contrast to IL-15, which utilizes STAT5 in signaling, IL-21 preferentially activates STAT3 (22, 24, 25).
In the present study, we investigated the role of IL-15, IL-18, and IL-21 in the regulation of IFN- gene expression in human NK and T cells. Our results suggest that synergistic interactions between IL-15, IL-18, and IL-21 play an important role in NK and T cell functions by enhancing IFN- gene expression.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Leukocyte-rich buffy coats were obtained from healthy blood donors (Finnish Red Cross Blood Transfusion Service, Helsinki, Finland). Mononuclear cells were isolated by density gradient centrifugation using Ficoll-Paque (Amersham Pharmacia Biotech, Uppsala, Sweden). Monocytes were removed by adherence and T cells were further purified by nylon wool columns. The purity of T cells was ensured by FACS analysis using anti-CD3, anti-CD14, anti-CD19, and anti-CD56 mAbs (Caltag Laboratories, Burlingame, CA). The T cell population was pure, except it contained 
10% CD56+ NK cells. Purified T cells were activated with 0.5 µg/ml anti-CD3 and 0.5 µg/ml anti-CD28 mAbs (R&D Systems, Abingdon, U.K.) and were cultured in RPMI 1640 medium supplemented with 10% FCS (Integro, Zaandam, The Netherlands), 20 mM HEPES, 2 mM L-glutamine, 0.6 µg/ml penicillin, 60 µg/ml streptomycin, and 100 IU/ml human rIL-2 (R&D Systems) for 5–6 days. T cells were then expanded for 5–6 days in RPMI 1640 supplemented with 100 IU/ml human rIL-2. In each experiment, T cells from two to four donors were used.
Purification of NK cells from PBMCs
Mononuclear cells were isolated by density gradient centrifugation as described above using Ficoll-Paque. NK cells were purified from nonadherent PBMCs by nylon wool columns and two-step density gradient centrifugation by Percoll (Amersham Pharmacia Biotech), followed by purification with magnetic beads coated with anti-CD3, anti-CD14, and anti-CD19 Abs (Dynal Biotech, Oslo, Norway). As determined by flow cytometry with anti-CD3 and anti-CD56 Abs, NK cells were >90% pure.
NK cell line
The human NK-92 cell line was maintained in continuous culture in MEM medium (Life Technologies, Grand Island, NY) supplemented with 12% horse serum (Life Technologies), 12% FCS, 0.2 mM L-inositol, 20 mM folic acid, 40 mM 2-ME, 2 mM L-glutamine, antibiotics, and 100 IU/ml rIL-2.
Cytokines
Human rIL-15 and rIL-18 were purchased from R&D Systems. The cytokine concentrations used, unless otherwise indicated, were 5 ng/ml for IL-15 and 10 ng/ml for IL-18 and IL-21 (ZymoGenetics, Seattle, WA).
IFN- ELISA
Supernatants from cytokine-stimulated cells were analyzed for IFN- production by ELISA using matched Ab pairs for IFN- (Diaclone, Besancone, France) according to the manufacturer’s recommended procedure. The sensitivity limit in the ELISA was 20 pg/ml using human rIFN- (Diaclone) as a standard.
RNA isolation and Northern blot analysis
NK-92 or T cells were treated with different cytokines for 3 h. The cells were collected and total cellular RNA was isolated as previously described (26). Equal amounts of RNA (10 µg) were size fractionated on a 1% formaldehyde-agarose gel, transferred to a nylon membrane (Hybond; Amersham, Buckinghamshire, U.K.), hybridized with an IFN- probe (27), and labeled with [-32P]dCTP (3000 Ci/mmol; Amersham) using a random primed DNA labeling kit (Boehringer Mannheim, Mannheim, Germany). Ethidium bromide staining of ribosomal RNA bands was used to ensure equal RNA loading. The membranes were hybridized under conditions of high stringency (50% formamide, 5x Denhardt’s solution, 5x SSPE, and 0.5% SDS), washed twice at room temperature and once at 60°C in 1x SSC/0.1% SDS for 30 min each time, and exposed to Kodak AR X-Omat films at -70°C using intensifying screens.
Oligonucleotide DNA precipitation
The NK-92 cell line or primary NK and T cells were stimulated with IL-15, IL-18, or IL-21 as indicated in the figures and figure legends. The cells were harvested, washed, and lysed in a buffer containing 10 mM HEPES, 400 mM KCl, 10% glycerol, 2 mM EDTA, 1 mM EGTA, 0.01% Triton X-100, 0.5 mM DTT, 1 mM NaVO4, and protease inhibitors (Complete; Roche, Basel, Switzerland). Cleared cell lysates were incubated with streptavidin-agarose beads coupled to 5'-biotinylated oligonucleotides; IFN- promoter IFN- activation site (GAS) (5'-GGATCCAGTCCTTGAATGGTGTGAAGTAAAAGTGCCTTCAAAGAATCCC), mutated IFN- promoter GAS (5'-GGATCCAGTCCTTGAATGGTGTGAAGTAAAAGTGCCT*CAAAcAATCCC), IFN- first intron GAS (5'-GGATCCTGTTTAAAAATTTTAAGTGAATTTTTTGAGTTTCTTTTAAAATTTT), or NF-B (5'-GGATCCCACTGGGTCTGGAACTCCCCCTGGGAATATTCTCT) oligonucleotides (DNA Technology, Aarhus, Denmark). The binding reactions were performed for 2 h at +4°C in binding buffer containing 10 mM HEPES, 133 mM KCl, 10% glycerol, 2 mM EDTA, 1 mM EGTA, 0.01% Triton X-100, 0.5 mM DTT, 1 mM NaVO4, and protease inhibitors. After washing, the oligonucleotide-bound proteins were released in SDS sample buffer, separated on 10% SDS-PAGE, and transferred onto Immobilon-P membranes (Millipore, Bedford, MA). Rabbit-anti-STAT1, anti-STAT3, anti-STAT4, anti-STAT5 Abs (IFN- GAS precipitated) or anti-p50 and anti-p65 Abs (NF-B precipitated; all from Santa Cruz Biotechnology) were allowed to bind for 1 h at room temperature in PBS containing 5% nonfat milk. Peroxidase-conjugated goat anti-rabbit IgG (1/2000 dilution; DAKO, Glostrup, Denmark) was allowed to bind for 1 h at room temperature and the proteins on membranes were visualized by the ECL system (Amersham).
Anti-phosphotyrosine analysis
Cytokine-stimulated cells were collected and lysed in modified RIPA buffer (150 mM NaCl, 50 mM Tris-HCl (pH 7.4), 1 mM EDTA, and 1% Nonidet P-40) supplemented with protease inhibitors, 1 mM NaF, and 1 mM NaVO4. Cleared cell lysates were immunoprecipitated at +4°C for 18 h with anti-phosphotyrosine Abs: anti-phosphotyrosine (4G10) agarose conjugate (Upstate Biotechnology, Lake Placid, NY), phosphotyrosine-RC20: biotin (Transduction Laboratories, Lexington, KY), and ImmunoPure immobilized streptavidin (Pierce, Rockford, IL). After washing, the precipitated proteins were released to SDS sample buffer and separated on 10% SDS-PAGE. Proteins in gel were transferred onto Immobilon-P membranes (Millipore) and visualized with anti-STAT1 and anti-STAT4 Abs (Santa Cruz Biotechnology).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production in human NK and T cells
We have previously shown that IL-15 or IL-21 stimulation of NK-92 and T cells enhances their IFN- mRNA synthesis (25). However, in vivo cytokines often appear simultaneously and may thus have synergistic effects on their target cells. We stimulated NK-92 cells, human primary NK, and T cells with IL-15, IL-18, and IL-21 alone or in different combinations and analyzed the production of IFN- at protein level. In primary NK cells, IFN- production was clearly up-regulated by IL-15, whereas IL-18 or IL-21 had a modest enhancing effect on IFN- production (Fig. 1A). IL-15 in combination with IL-18 or IL-21 strongly enhanced IFN- production. Similarly, IL-21 plus IL-18 enhanced the IFN- production in primary NK cells (Fig. 1A).
|
production. IL-21 plus IL-15 enhanced IFN- production in both cell types significantly, similarly to that seen in primary NK cells. IL-21 plus IL-18 enhanced IFN- production compared with that of either cytokine alone. In all cell types, the combination of IL-15 plus IL-18 was the most efficient up-regulator of IFN- production.
We also examined cytokine-induced IFN- production at mRNA level in NK-92 cells and activated T cells. IL-15 induced clear IFN- mRNA expression in NK-92 cells whereas IL-18- or IL-21-induced IFN- mRNA synthesis was not detectable (Fig. 2). In T cells, all three cytokines alone weakly induced IFN- expression. IL-15 plus IL-18 or IL-18 plus IL-21 had a synergistic effect on IFN- mRNA expression in both cell types. IL-21 also enhanced IL-15-induced IFN- mRNA synthesis (Fig. 2).
|
regulatory elements
Cytokine-induced IFN- gene expression in NK and T cells requires the activation of the Janus kinase-STAT signaling pathway. Phosphorylated STATs can interact with specific STAT binding sites in the regulatory elements of the IFN- gene (28), which then initiates IFN- mRNA synthesis. To reveal which of the STAT molecules would be responsible for initiating IFN- mRNA synthesis, we conducted oligonucleotide binding experiments with the IFN- gene promoter and first intron GAS sites. NK-92 cells were stimulated with IL-15 or IL-21 for 1, 3, 9, or 24 h and the proteins in whole-cell lysates were precipitated using the GAS oligonucleotides from the IFN- promoter and the first intron. IL-15 clearly activated STAT1, STAT3, STAT4, and STAT5 binding to both of these elements (Fig. 3, A and B). IL-21 induced STAT3 DNA binding to the IFN- gene promoter and first intron GAS (Fig. 3, A and B). In addition, IL-21 induced STAT1 and STAT4 binding to the IFN- promoter GAS (Fig. 3A) and first intron GAS (Fig. 3B). IL-21-induced STAT4 binding to the IFN- promoter GAS was modest compared with that of STAT3 and diminished after 1 h. IL-21 was not able to induce any detectable STAT5 binding (Fig. 3, A and B). Primary NK cells were stimulated with IL-15 or IL-21 for 1 h and the proteins in whole-cell lysates were precipitated using the IFN- promoter GAS oligonucleotide. IL-21 enhanced STAT1, STAT3, and STAT4 binding to IFN- promoter GAS (Fig. 3C). IL-21-induced STAT3 DNA binding was more efficient compared with those of STAT1 or STAT4. STAT5 binding to the IFN- promoter GAS was induced by IL-15 but not by IL-21 in primary NK cells.
|
promoter and first intron GAS. The induction remained at a high level for 24 h. In addition, IL-15 induced STAT1, STAT3, and STAT4 binding to both elements (Fig. 4). IL-21 induced STAT1 and especially STAT3 binding to the IFN- promoter and first intron GAS that lasted up to 24 h (Fig. 4A). IL-21-induced STAT4 binding was clearly detectable at 1 h after cytokine stimulation with both of these elements (Fig. 4).
|
gene promoter GAS inhibits cytokine-induced STAT DNA binding
To verify the specificity of cytokine-induced STAT DNA binding, we conducted oligonucleotide binding experiments with the mutated IFN- promoter GAS element as described in Materials and Methods. NK-92 cells were stimulated with IFN-, IL-12, IL-15, or IL-21 for 1 h and the proteins from whole-cell lysates were precipitated using either wild-type or mutated IFN- promoter GAS oligonucleotides. IFN-, IL-12, IL-15, and IL-21-induced STAT DNA binding was also almost completely inhibited by two mutations in the IFN- promoter GAS (Fig. 5).
|
B binding to the IFN- gene promoter
It has been shown earlier that IL-18 in synergy with IL-12 up-regulates the IFN- gene expression by enhanced binding activity of AP-1 (29). In addition to c-Jun/AP-1, IL-18 also activates the NF-B signaling pathway (30). To analyze whether IL-18 induces NF-B binding, NK-92 cells were stimulated with IL-15, IL-18, or IL-21 for different times and the proteins were precipitated using oligonucleotides from the IFN- promoter NF-B site. As shown in Fig. 6, IL-18 induced NF-B p50 and p65 binding to the IFN- promoter already at 1 h after cytokine stimulation (Fig. 6). IL-15 induced p50 and p65 binding to the IFN- promoter with delayed kinetics compared with that of IL-18. IL-15-induced NF-B binding was seen at 3 h after cytokine stimulation and was detectable up to 24 h. IL-21 was not able to induce the binding of p50 or p65 proteins to the IFN- promoter NF-B site.
|
The primary STATs activated by IL-15 and IL-21 appear to be STAT5 and STAT3, respectively. Since IL-15 and IL-21 also induced STAT1 and STAT4 DNA binding to the IFN- gene regulatory sites, we verified STAT1 and STAT4 activation with anti-phosphotyrosine analysis. NK-92 and T cells were stimulated with IL-15 or IL-21 and proteins in control cell and cytokine-stimulated cell lysates were immunoprecipitated with anti-phosphotyrosine Abs followed by Western blot analysis with anti-STAT1 and anti-STAT4 Abs. As a control, cells were stimulated with IFN-, which is known to activate multiple STAT proteins in lymphocytes (26). As shown in Fig. 7, in unstimulated NK-92 cells (Fig. 7A) or in T cells (Fig. 7B), tyrosine-phosphorylated STAT1 was detected at a basal level but IFN-, IL-15, and IL-21 further enhanced the phosphorylation of STAT1 (Fig. 7). IFN-, IL-15, and IL-21 stimulation clearly induced tyrosine phosphorylation of STAT4 (Fig. 7).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
subunit is closely related to IL-21R and, in addition, IL-21R shares the common cytokine receptor c with IL-15R (20). Despite the shared receptors, IL-15 and IL-21 activate different transcription factors and have diverse effects on different cell types. IL-15 induces the activation of STAT5 in NK and T cells (24), whereas IL-21 preferentially activates STAT3 (22, 25). IL-21 has been shown to promote cytotoxicity and IFN- production of NK cells. On the other hand, IL-21 has been shown to inhibit IL-15-induced proliferation of unstimulated NK cells. Therefore, it may be that IL-21 is involved in the transition of immune response from innate to adaptive immunity (21).
IFN- is a cytokine regulating innate immunity and the development of adaptive Th1 immune response (31, 32). Macrophage-derived IFN-, IL-12, and IL-18 have been shown to be important regulators of IFN- gene expression. Individually these cytokines induce IFN- production relatively poorly. However, IL-18 combined with IFN- or IL-12 effectively activates IFN- production both in NK and T cells (4, 5, 7, 33, 34). In the present report, we have studied the effect of IL-15 and IL-21 on IFN- gene expression. IL-18 was included in our studies since it is required for IFN- gene activation both in bacterial and viral infections (5, 8, 17, 18). We show that IL-15 alone is a more potent up-regulator of IFN- production compared with IL-21 in human NK and T cells. However, IL-15-induced IFN- mRNA synthesis and protein production was clearly enhanced by IL-18 and IL-21. IL-18 or IL-21 alone was weak inducers of IFN- production but the combination of IL-18 and IL-21 induced a marked activation of IFN- gene expression. Our results suggest that synergistic actions of IL-15, IL-18, and IL-21 are important in activating early NK cell responses.
The IFN- gene has multiple binding sites for different transcription factors including AP-1, NF-B, and NFAT, which all contribute to the activation of the IFN- gene transcription in response to TCR and/or cytokine stimulation (2, 28, 29, 35, 36). In addition, the IFN- gene has putative STAT binding sites in its promoter region as well as in the first and third intron of the IFN- gene and IFN- GAS residing in the promoter has two consensus binding sites for STATs (28). We have previously shown that both IFN- and IL-12 activate STAT4 binding to IFN- GAS in human NK cells (4). In this study, we show that IL-15 activates the binding of STAT1, STAT3, STAT4, and STAT5 to IFN- GAS in human NK and T cells. Similarly, IL-21 induced the binding of STAT1, STAT3, and STAT4 to the same element. Our results suggest that IL-15- and IL-21-activated STATs are involved in the activation of the IFN- gene expression. In contrast to IL-15 and IL-21, IL-18 was not able to induce any STAT DNA binding to IFN- regulatory elements (data not shown). Instead, IL-18 induced NF-B binding to IFN- promoter NF-B site. Therefore, it may be that IL-15- or IL-21-activated STATs and IL-18-induced NF-B are needed for the full activation of IFN- gene transcription.
IL-12 plays an important role in modulating both innate and adaptive immune responses. IL-12 induces IFN- production in NK and T cells and it is the major cytokine driving Th1 differentiation (37, 38). IL-12 utilizes STAT4 in signaling and the Th1 response is severely impaired in STAT4 KO mice (39, 40). STAT4 contributes to the regulation of IFN- directly by binding to DNA sequences in the IFN- promoter to increase gene transcription. However, STAT4 affects IFN- expression and thus innate immunity and also the Th1 response indirectly by serving as an essential mediator for IL-12-induced up-regulation of IL-12R, IL-18R, and myeloid differentiation factor MyD88 (41). We have previously shown that both IL-15 and IL-21 enhance innate immune response by inducing IFN-, IL-12R2, and IL-18R gene expression in human NK cells (25). In contrast to NK cells, it was recently shown that IL-21 inhibits IFN- production from developing Th1 cells in mice (42). In addition, we and others have shown that IL-15 and IL-21 activate STAT5 and STAT3 in NK cells, respectively. Our results here show that both IL-15 and IL-21 induce the binding of STAT4 to the IFN- gene regulatory sites as well as tyrosine phosphorylation of STAT4. Interestingly, Wang et al. (43) have shown that IL-2, a cytokine related to IL-15 and IL-21, is also able to activate STAT4 in NK cells. Our results show that IL-15- and IL-21-induced STAT4 activation is weaker compared with that of IL-12 (Fig. 5). However, the production of biologically active IL-12 has been reported only in a few virus infections. IL-15 is produced by macrophages during viral infections and T cell-derived IL-21 production is triggered by macrophages via presentation of viral Ags. It is thus possible that IL-15- or IL-21-induced STAT4 activation contributes to NK cell-derived IFN- production during early phases of viral infections.
In vivo, cytokines are usually present simultaneously in sites of infection and their synergistic effects have often an important role in controlling immune responses. In summary, we demonstrate here that IL-15, IL-18, and IL-21 in different combinations enhance IFN- production in human NK and T cells. The results suggest an important role for IL-15 and IL-21 in the activation of an innate immune response. In addition, IL-15 and IL-21 may serve as mediator cytokines in the transition of an immune response from innate to adaptive immunity.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Mari Strengell, Department of Microbiology, National Public Health Institute, Mannerheimintie 166, FIN-00300 Helsinki, Finland. E-mail address: mari.strengell{at}ktl.fi
3 Abbreviations used in this paper: KO, knockout; GAS, IFN--activated site; c, common -chain.
Received for publication November 8, 2002. Accepted for publication March 31, 2003.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
gene expression during microbial infections. Rec. Res. Dev. Immunol. 1:185.
and IL-18 synergistically enhance IFN- production in human NK cells: differential regulation of Stat4 activation and IFN- gene expression by IFN- and IL-12. Eur. J. Immunol. 31:2236.[Medline]
/ and IL-18 synergistically enhance IFN- gene expression in human T cells. J. Immunol. 160:6032. response to viral infection. Science 297:2063. and IL-18 production in human macrophages by a caspase-1-dependent pathway. J. Immunol. 162:7322. responses during viral infection. J. Immunol. 165:4787. chain. Proc. Natl. Acad. Sci. USA 97:11439.-chain is an indispensable subunit of the IL-21 receptor complex. J. Immunol. 167:1.c-dependent network?. Curr. Biol. 11:175.
activates multiple STAT proteins and up-regulates proliferation-associated IL-2Ra, c-myc, and pim-1 genes in human T cells. Blood 93:1980.. Biochem. J. 303:831.
gene expression: IL-12-induced STAT4 contributes to IFN- promoter activation by up-regulating the binding activity of IL-18-induced activator protein 1. J. Immunol. 168:1146. production and activates IRAK and NFB. Immunity 7:571.[Medline]
. Annu. Rev. Immunol. 15:749.[Medline]
interferon in antimicrobial immunity. Curr. Opin. Microbiol. 4:251.[Medline]
production by T cells. Nature 378:88.[Medline]
-inducing factor, expression in Escherichia coli, and studies on the biologic activities of the protein. J. Immunol. 156:4274.[Abstract]
B and NFAT with the interferon-gamma promoter. J. Biol. Chem. 272:30412.-inducing signaling pathways. J. Immunol. 165:6803.-producing Th1 cells. J. Exp. Med. 196:969.This article has been cited by other articles:
|
|
 |
|
  D. T. Avery, C. S. Ma, V. L. Bryant, B. Santner-Nanan, R. Nanan, M. Wong, D. A. Fulcher, M. C. Cook, and S. G. Tangye STAT3 is required for IL-21-induced secretion of IgE from human naive B cells Blood, September 1, 2008; 112(5): 1784 - 1793. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. J. Leonard, R. Zeng, and R. Spolski Interleukin 21: a cytokine/cytokine receptor system that has come of age J. Leukoc. Biol., August 1, 2008; 84(2): 348 - 356. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Ferrari-Lacraz, R. Chicheportiche, G. Schneiter, N. Molnarfi, J. Villard, and J.-M. Dayer IL-21 promotes survival and maintains a naive phenotype in human CD4+ T lymphocytes Int. Immunol., August 1, 2008; 20(8): 1009 - 1018. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D Fina, M Sarra, R Caruso, G Del Vecchio Blanco, F Pallone, T T MacDonald, and G Monteleone Interleukin 21 contributes to the mucosal T helper cell type 1 response in coeliac disease Gut, July 1, 2008; 57(7): 887 - 892. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Xing, C. J. Cardona, J. Li, N. Dao, T. Tran, and J. Andrada Modulation of the immune responses in chickens by low-pathogenicity avian influenza virus H9N2 J. Gen. Virol., May 1, 2008; 89(5): 1288 - 1299. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. E. Clough, C. J. Wang, E. M. Schmidt, G. Booth, T. Z. Hou, G. A. Ryan, and L. S. K. Walker Release from Regulatory T Cell-Mediated Suppression during the Onset of Tissue-Specific Autoimmunity Is Associated with Elevated IL-21 J. Immunol., April 15, 2008; 180(8): 5393 - 5401. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Athie-Morales, G. M. O'Connor, and C. M. Gardiner Activation of Human NK Cells by the Bacterial Pathogen-Associated Molecular Pattern Muramyl Dipeptide J. Immunol., March 15, 2008; 180(6): 4082 - 4089. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Caprioli, M. Sarra, R. Caruso, C. Stolfi, D. Fina, G. Sica, T. T. MacDonald, F. Pallone, and G. Monteleone Autocrine Regulation of IL-21 Production in Human T Lymphocytes J. Immunol., February 1, 2008; 180(3): 1800 - 1807. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Hart, T. Avin-Wittenberg, and I. Shachar IL-15 regulates immature B-cell homing in an Ly49D-, IL-12 , and IL-18 dependent manner Blood, January 1, 2008; 111(1): 50 - 59. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. D. Davis, K. Skak, M. J. Smyth, P. E.G. Kristjansen, D. M. Miller, and P. V. Sivakumar Interleukin-21 Signaling: Functions in Cancer and Autoimmunity Clin. Cancer Res., December 1, 2007; 13(23): 6926 - 6932. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Hiromura, T. Kishida, H. Nakano, T. Hama, J. Imanishi, Y. Hisa, and O. Mazda IL-21 Administration into the Nostril Alleviates Murine Allergic Rhinitis J. Immunol., November 15, 2007; 179(10): 7157 - 7165. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Liu, G. Lizee, Y. Lou, C. Liu, W. W. Overwijk, G. Wang, and P. Hwu IL-21 synergizes with IL-7 to augment expansion and anti-tumor function of cytotoxic T cells Int. Immunol., October 1, 2007; 19(10): 1213 - 1221. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Trotta, D. Ciarlariello, J. D. Col, J. Allard II, P. Neviani, R. Santhanam, H. Mao, B. Becknell, J. Yu, A. K. Ferketich, et al. The PP2A inhibitor SET regulates natural killer cell IFN-{gamma} production J. Exp. Med., October 1, 2007; 204(10): 2397 - 2405. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Onoda, M. Rahman, H. Nara, A. Araki, K. Makabe, K. Tsumoto, I. Kumagai, T. Kudo, N. Ishii, N. Tanaka, et al. Human CD4+ central and effector memory T cells produce IL-21: effect on cytokine-driven proliferation of CD4+ T cell subsets Int. Immunol., October 1, 2007; 19(10): 1191 - 1199. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Casey and M. F. Mescher IL-21 Promotes Differentiation of Naive CD8 T Cells to a Unique Effector Phenotype J. Immunol., June 15, 2007; 178(12): 7640 - 7648. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. B. Smeltz Profound Enhancement of the IL-12/IL-18 Pathway of IFN-{gamma} Secretion in Human CD8+ Memory T Cell Subsets via IL-15 J. Immunol., April 15, 2007; 178(8): 4786 - 4792. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. M. Hildner, P. Schirmacher, I. Atreya, M. Dittmayer, B. Bartsch, P. R. Galle, S. Wirtz, and M. F. Neurath Targeting of the Transcription Factor STAT4 by Antisense Phosphorothioate Oligonucleotides Suppresses Collagen-Induced Arthritis J. Immunol., March 15, 2007; 178(6): 3427 - 3436. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Frohlich, B. J. Marsland, I. Sonderegger, M. Kurrer, M. R. Hodge, N. L. Harris, and M. Kopf IL-21 receptor signaling is integral to the development of Th2 effector responses in vivo Blood, March 1, 2007; 109(5): 2023 - 2031. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. R. Rodriguez, B. P. Arulanandam, V. L. Hodara, H. M. McClure, E. K. Cobb, M. T. Salas, R. White, and K. K. Murthy Influence of interleukin-15 on CD8+ natural killer cells in human immunodeficiency virus type 1-infected chimpanzees J. Gen. Virol., February 1, 2007; 88(2): 641 - 651. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Pene, L. Guglielmi, J.-F. Gauchat, N. Harrer, M. Woisetschlager, V. Boulay, J.-M. Fabre, P. Demoly, and H. Yssel IFN-{gamma}-Mediated Inhibition of Human IgE Synthesis by IL-21 Is Associated with a Polymorphism in the IL-21R Gene J. Immunol., October 15, 2006; 177(8): 5006 - 5013. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Li, W. Wojciechowski, C. Dell'Agnola, N. E. Lopez, and I. Espinoza-Delgado IFN-{gamma} and T-bet Expression in Human Dendritic Cells from Normal Donors and Cancer Patients Is Controlled through Mechanisms Involving ERK-1/2-Dependent and IL-12-Independent Pathways J. Immunol., September 15, 2006; 177(6): 3554 - 3563. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Cappuccio, M. Elishmereni, and Z. Agur Cancer immunotherapy by interleukin-21: potential treatment strategies evaluated in a mathematical model. Cancer Res., July 15, 2006; 66(14): 7293 - 7300. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Robertson, J. W. Mier, T. Logan, M. Atkins, H. Koon, K. M. Koch, S. Kathman, L. N. Pandite, C. Oei, L. C. Kirby, et al. Clinical and biological effects of recombinant human interleukin-18 administered by intravenous infusion to patients with advanced cancer. Clin. Cancer Res., July 15, 2006; 12(14): 4265 - 4273. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Roda, R. Parihar, A. Lehman, A. Mani, S. Tridandapani, and W. E. Carson III Interleukin-21 Enhances NK Cell Activation in Response to Antibody-Coated Targets J. Immunol., July 1, 2006; 177(1): 120 - 129. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. A. Verri Jr., T. M. Cunha, C. A. Parada, X.-q. Wei, S. H. Ferreira, F. Y. Liew, and F. Q. Cunha IL-15 mediates immune inflammatory hypernociception by triggering a sequential release of IFN-{gamma}, endothelin, and prostaglandin PNAS, June 20, 2006; 103(25): 9721 - 9725. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Strengell, A. Lehtonen, S. Matikainen, and I. Julkunen IL-21 enhances SOCS gene expression and inhibits LPS-induced cytokine production in human monocyte-derived dendritic cells J. Leukoc. Biol., June 1, 2006; 79(6): 1279 - 1285. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Burgess, A. I. Marusina, I. Pathmanathan, F. Borrego, and J. E. Coligan IL-21 Down-Regulates NKG2D/DAP10 Expression on Human NK and CD8+ T Cells J. Immunol., February 1, 2006; 176(3): 1490 - 1497. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Piskin, R. M. R. Sylva-Steenland, J. D. Bos, and M. B. M. Teunissen In Vitro and In Situ Expression of IL-23 by Keratinocytes in Healthy Skin and Psoriasis Lesions: Enhanced Expression in Psoriatic Skin J. Immunol., February 1, 2006; 176(3): 1908 - 1915. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Perez, L. G. Mahaira, P. A. Sotiropoulou, A. D. Gritzapis, E. G. Iliopoulou, D. K. Niarchos, N. T. Cacoullos, Y. G. Kavalakis, A. I. Antsaklis, N. N. Sotiriadou, et al. Effect of IL-21 on NK cells derived from different umbilical cord blood populations Int. Immunol., January 1, 2006; 18(1): 49 - 58. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Mesel-Lemoine, M. Cherai, S. Le Gouvello, M. Guillot, V. Leclercq, D. Klatzmann, V. Thomas-Vaslin, and F. M. Lemoine Initial depletion of regulatory T cells: the missing solution to preserve the immune functions of T lymphocytes designed for cell therapy Blood, January 1, 2006; 107(1): 381 - 388. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Wu, H.-P. Kim, H.-H. Xue, H. Liu, K. Zhao, and W. J. Leonard Interleukin-21 Receptor Gene Induction in Human T Cells Is Mediated by T-Cell Receptor-Induced Sp1 Activity Mol. Cell. Biol., November 15, 2005; 25(22): 9741 - 9752. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Suto, H. Nakajima, N. Tokumasa, H. Takatori, S.-i. Kagami, K. Suzuki, and I. Iwamoto Murine Plasmacytoid Dendritic Cells Produce IFN-{gamma} upon IL-4 Stimulation J. Immunol., November 1, 2005; 175(9): 5681 - 5689. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Takaki, Y. Hayakawa, A. Nelson, P. V. Sivakumar, S. Hughes, M. J. Smyth, and L. L. Lanier IL-21 Enhances Tumor Rejection through a NKG2D-Dependent Mechanism J. Immunol., August 15, 2005; 175(4): 2167 - 2173. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Li, M. Bleakley, and C. Yee IL-21 Influences the Frequency, Phenotype, and Affinity of the Antigen-Specific CD8 T Cell Response J. Immunol., August 15, 2005; 175(4): 2261 - 2269. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Kawana, Y. Kawana, and D. J. Schust Female Steroid Hormones Use Signal Transducers and Activators of Transcription Protein-Mediated Pathways to Modulate the Expression of T-bet in Epithelial Cells: A Mechanism for Local Immune Regulation in the Human Reproductive Tract Mol. Endocrinol., August 1, 2005; 19(8): 2047 - 2059. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. E. Berg, E. Crossley, S. Murray, and J. Forman Relative Contributions of NK and CD8 T Cells to IFN-{gamma} Mediated Innate Immune Protection against Listeria monocytogenes J. Immunol., August 1, 2005; 175(3): 1751 - 1757. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. L. Alves, F. A. Arosa, and R. A. W. van Lier IL-21 Sustains CD28 Expression on IL-15-Activated Human Naive CD8+ T Cells J. Immunol., July 15, 2005; 175(2): 755 - 762. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Perez, L. G. Mahaira, F. J. Demirtzoglou, P. A. Sotiropoulou, P. Ioannidis, E. G. Iliopoulou, A. D. Gritzapis, N. N. Sotiriadou, C. N. Baxevanis, and M. Papamichail A potential role for hydrocortisone in the positive regulation of IL-15-activated NK-cell proliferation and survival Blood, July 1, 2005; 106(1): 158 - 166. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Ing, P. Gros, and M. M. Stevenson Interleukin-15 Enhances Innate and Adaptive Immune Responses to Blood-Stage Malaria Infection in Mice Infect. Immun., May 1, 2005; 73(5): 3172 - 3177. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. L. Vollmer, R. Liu, M. Price, S. Rhodes, A. La Cava, and F.-D. Shi Differential Effects of IL-21 during Initiation and Progression of Autoimmunity against Neuroantigen J. Immunol., March 1, 2005; 174(5): 2696 - 2701. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Mavropoulos, G. Sully, A. P. Cope, and A. R. Clark Stabilization of IFN-{gamma} mRNA by MAPK p38 in IL-12- and IL-18-stimulated human NK cells Blood, January 1, 2005; 105(1): 282 - 288. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. A. Lieberman, E. N. Villegas, and C. A. Hunter Interleukin-15-Deficient Mice Develop Protective Immunity to Toxoplasma gondii Infect. Immun., November 1, 2004; 72(11): 6729 - 6732. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Strengell, I. Julkunen, and S. Matikainen IFN-{alpha} regulates IL-21 and IL-21R expression in human NK and T cells J. Leukoc. Biol., August 1, 2004; 76(2): 416 - 422. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Moroz, C. Eppolito, Q. Li, J. Tao, C. H. Clegg, and P. A. Shrikant IL-21 Enhances and Sustains CD8+ T Cell Responses to Achieve Durable Tumor Immunity: Comparative Evaluation of IL-2, IL-15, and IL-21 J. Immunol., July 15, 2004; 173(2): 900 - 909. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Chtanova, S. G. Tangye, R. Newton, N. Frank, M. R. Hodge, M. S. Rolph, and C. R. Mackay T Follicular Helper Cells Express a Distinctive Transcriptional Profile, Reflecting Their Role as Non-Th1/Th2 Effector Cells That Provide Help for B Cells J. Immunol., July 1, 2004; 173(1): 68 - 78. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Jin, R. Carrio, A. Yu, and T. R. Malek Distinct Activation Signals Determine whether IL-21 Induces B Cell Costimulation, Growth Arrest, or Bim-Dependent Apoptosis J. Immunol., July 1, 2004; 173(1): 657 - 665. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. K. Lathrop, C. A. Huddleston, P. A. Dullforce, M. J. Montfort, A. D. Weinberg, and D. C. Parker A Signal through OX40 (CD134) Allows Anergic, Autoreactive T Cells to Acquire Effector Cell Functions J. Immunol., June 1, 2004; 172(11): 6735 - 6743. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Papadakis, J. L. Prehn, C. Landers, Q. Han, X. Luo, S. C. Cha, P. Wei, and S. R. Targan TL1A Synergizes with IL-12 and IL-18 to Enhance IFN-{gamma} Production in Human T Cells and NK Cells J. Immunol., June 1, 2004; 172(11): 7002 - 7007. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. van der Meer, H.G.M. Lukassen, M.J.C. van Lierop, F. Wijnands, S. Mosselman, D.D.M. Braat, and I. Joosten Membrane-bound HLA-G activates proliferation and interferon-{gamma} production by uterine natural killer cells Mol. Hum. Reprod., March 1, 2004; 10(3): 189 - 195. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Di Carlo, A. Comes, A. M. Orengo, O. Rosso, R. Meazza, P. Musiani, M. P. Colombo, and S. Ferrini IL-21 Induces Tumor Rejection by Specific CTL and IFN-{gamma}-Dependent CXC Chemokines in Syngeneic Mice J. Immunol., February 1, 2004; 172(3): 1540 - 1547. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
