| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Immunomodulation Research Center, University of Ulsan, Ulsan, Korea; and
Louisiana State University Eye Center, Louisiana State University Health Sciences Center School of Medicine, New Orleans, LA 70112
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B activation. This signaling pathway was
specifically inhibited by PDTC and was different from the pathways that
enhanced CD8+ T cell proliferation. The results suggest a
role for the antiapoptotic activities of Bcl-xL and Bfl-1
proteins in 4-1BB-mediated CD8+ T cell survival in
vivo. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Several molecules that play key roles in regulating apoptosis in T
cells have been identified (5), including members of the
Bcl-2 family. Bcl-2-related proteins have either antiapoptotic effects
(e.g., Bclw, Bcl-2, Bcl-xL, and Bfl-1) or
proapoptotic effects (e.g., Bax, Bak, and Bad).
Bcl-xL has been shown to protect cells from
apoptosis evoked by a variety of agents that also activate NF-B
(6, 7). Khoshnan et al. (8) demonstrated that
CD3/CD28-mediated activation of NF-B and up-regulation of
Bcl-xL expression inhibited apoptosis in human
CD4+ T cells. In B lymphocytes, CD40-mediated
cell survival required an NF-B-dependent increase in
Bcl-xL and Bfl-1 expression (9).
Also, Akt mediated survival in CD4+ and
CD8+ double-positive thymocytes and mature T
cells through the regulation of NF-B and
Bcl-xL (10).
Although studies to date have shown that 4-1BB produces signals through
TNFR-associated factor–NF-B-inducing kinase–NF-B (11, 12) and TNFR-associated factor–apoptosis signal-regulating
kinase–p38 mitogen-activated protein kinase
(MAPK)3 or
stress-activated protein kinase/c-Jun N-terminal kinase pathways
(13, 14), 4-1BB-mediated signal transduction pathways
specificfor T cell survival have not yet been defined. To elucidate the
molecular mechanisms by which 4-1BB promotes
CD8+ T cell survival, we have examined expression
of antiapoptotic genes and the signal transduction pathways from 4-1BB
to Bcl-xL in CD8+ T cells.
In this study, we show that 4-1BB induces expression of the survival
genes bcl-xL and bfl-1 through
activation of NF-B.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Male BALB/c mice were obtained from Harlan (Indianapolis, IN).
Animals were maintained under specific pathogen-free conditions.
Anti-CD3 mAb (145-2C11 clone), biotin-labeled and PE-labeled
anti-CD8 mAb, isotype control Ab, and an apoptosis detection kit
were purchased from BD PharMingen (San Diego, CA). Agonistic
anti-4-1BB mAbs (3H3 and 3E1) were kindly provided by Dr. R.
S. Mittler (Emory University, Atlanta, GA). Streptavidin-conjugated
microbeads and LS columns were purchased from Miltenyi Biotec
(Auburn, CA). Cycloheximide (CHX) was purchased from Sigma-Aldrich (St.
Louis, MO). LY294002, 1-pyrrollidinecarbodithioic acid, ammonium salt
(PDTC), SB203580, U0126, and PD98059 were purchased from
Calbiochem-Novabiochem (La Jolla, CA). All Abs for Western blotting
were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). NF-B
consensus and mutant probes for EMSA were also purchased from Santa
Cruz Biotechology.
CD8+ T cell purification
Cell suspensions were prepared from the spleens and lymph nodes of BALB/c mice. Cells were incubated at 37°C for 1 h in flasks to eliminate adherent cells before purification. CD8+ T cells were purified using the MACS magnetic separation system according to the manufacturer’s instructions (Miltenyi Biotec). In brief, cells were resuspended at a concentration of 108 cells/ml in PBS containing 5% FBS, incubated with anti-CD8 mAb conjugated with biotin, and collected by incubating with streptavidin microbeads at 4°C for 15 min. LS columns (Miltenyi Biotec) were used for the selection of CD8+ T cells. CD8+ T cell purity was routinely shown to be >95% by flow cytometry.
T cell stimulation
Purified CD8+ T cells were plated at 106 cells/well in 96-well round-bottom plates with 0.5 µg/ml anti-CD3 mAb (BD PharMingen) for 16 h. After incubation, cells were stained with anti-4-1BB-FITC (3E1-FITC); >70% of the cells routinely showed cell surface expression of 4-1BB by flow cytometry. After 4-1BB expression on the purified CD8+ T cells was verified, the cells were preincubated with or without various pharmacological inhibitors for 1 h, and then with 5 µg/ml agonistic anti-4-1BB mAb (3H3) or rat IgG2a as an isotype control for the indicated periods.
T cell proliferation assay
Purified CD8+ T cells were plated at 5 x 105 cells/well in 96-well round-bottom plates and stimulated as described above. During the final 12 h of culture, the cells were pulsed with 1 µCi/well [3H]thymidine (NEN, Boston, MA). Cellular DNA was harvested and counted by liquid scintillation spectroscopy.
Apoptosis assay
Anti-CD3-treated CD8+ T cells were stimulated with 5 µg/ml 3H3 or rat IgG2a for various times. Apoptosis was evaluated by flow cytometric detection of phosphatidylserine expression after the addition of FITC-labeled Annexin V (BD PharMingen) and propidium iodide.
Western blotting
Purified CD8+ T cells were stimulated as described above and proteins were extracted with lysis buffer (10 mM Tris-HCl (pH 7.4), 50 mM NaCl, 5 mM EDTA, 30 mM NaF, 0.1 mM Na3VO4, 1% Triton X-100, 0.5% Nonidet P-40, 1 mM PMSF, and protease inhibitor mixture). Equal amounts of protein from each sample were diluted with 4x SDS sample buffer, applied to SDS-PAGE gels, separated, and transferred to nitrocellulose membranes (Millipore, Bedford, MA). Each protein of interest was detected with primary Abs and secondary Ab-HRP. Bound Abs were detected by ECL (Amersham Pharmacia Biotech, Little Chalfont, U.K.).
RNase protection assay
Five- to 10-µg samples of total RNA extracted (RNAwiz; Ambion, Austin, TX) from anti-CD3 mAb-treated or anti-CD3 mAb plus anti-4-1BB mAb-treated CD8+ T cells were subjected to an RNase protection assay as specified by the manufacturer, using the mAPO-2 probe set (BD PharMingen). The resulting protected RNAs were resolved on 5% denaturing polyacrylamide gels and exposed to x-ray film.
EMSA
EMSA analysis was conducted as previously described
(15). Briefly, CD8+ T cells were
harvested and washed with PBS containing 1 mM
Na3VO4 and 5 mM NaF. The
cells were then incubated for 5 min on ice in 1 ml of lysis buffer
containing 20 mM HEPES (pH 7.9), 20 mM NaF, 1 mM
Na3VO4, 1 mM EDTA, 1 mM
EGTA, 1 mM DTT, 0.5 mM PMSF, 1 µg/ml leupeptin, 1 µg/ml aprotinin,
and 0.2% Nonidet P-40. After centrifugation at 3000 rpm for 5 min, the
pellets were further treated for 30 min at 4°C with 40 µl of lysis
buffer supplemented with 420 mM NaCl and 20% glycerol and then
subjected to centrifugation at 13,000 rpm for 10 min. The resulting
supernatant was used as the nuclear extract in the EMSA analysis. Next,
4 µg of nuclear extract and 
0.5 ng of labeled oligonucleotides
were incubated for 20 min at room temperature with 1 µg of
poly(dI-dC) in 20 µl of a binding buffer containing 13 mM HEPES (pH
7.9), 65 mM NaCl, 0.15 mM EDTA, 8% glycerol, and 1 mM DTT. The
complexes formed were separated from the free probe by electrophoresis
in a 5% nondenaturing polyacrylamide gel containing 0.5% Tris-borate
EDTA, and the gel was dried and exposed to x-ray film. Double-stranded
synthetic oligonucleotides corresponding to the consensus NF-B
binding element (top strand, AGTTGAGGGGACTTTCCCAGG) and its mutant
element (top strand, AGTTGAGGCGACTTTCCCAGG) were labeled with
[
-32P]ATP by means of polynucleotide kinase
and used as probes for the B site.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Approximately 70% of purified CD8+ T
lymphocytes expressed 4-1BB 16 h after treatment with 0.5 µg/ml
anti-CD3 mAb (Fig. 1
A).
Stimulation of CD8+ T lymphocytes with both
anti-CD3 and anti-4-1BB mAbs enhanced proliferation by
approximately threefold, compared with treatment with anti-CD3 mAb
alone (Fig. 1B). 4-1BB-mediated CD8+ T cell
proliferation was blocked by an NF-B inhibitor (PDTC; 20 µg/ml), a
phosphatidylinositol-3 kinase (PI3K) inhibitor (LY294002; 20
µM), and two MAPK kinase (MEK) inhibitors (5 µM U0126 and 30 µM
PD98059) (Fig. 1C). By contrast, a p38 MAPK inhibitor
(SB203580; 20 µM) had no effect (Fig. 1C). In this study,
inhibitors were added after a 16-h incubation with anti-CD3 mAb and
confirmation of 4-1BB expression, followed by incubation with
anti-4-1BB mAb. The data suggest that 4-1BB-mediated NF-B, MEK,
and PI3K signaling pathways may be involved in 4-1BB-evoked
proliferation. PD98059 and U0126 produced greater inhibition of
anti-CD3-mediated CD8+ T cell proliferation,
compared with the other inhibitors tested. The greater effect of these
two compounds may be the result of inhibition of the TCR signaling
pathway, rather than the 4-1BB pathway, or it may be that these two
inhibitors affect both TCR and 4-1BB signaling pathways.
|
A shows a FACS profile on day
2 of treatment with anti-CD3 or anti-CD3 plus anti-4-1BB.
When CD8+ T cells were incubated with
anti-4-1BB plus anti-CD3, percent survival was 15% greater on
day 2 and 10% greater on day 3, compared with cells incubated with
anti-CD3 alone (Fig. 2B). These results indicate that
4-1BB-mediated expansion of the CD8+ T cell
population may result from both T cell proliferation and T cell
survival. We tested the effects of inhibitors on 4-1BB-mediated cell
survival (Fig. 2C). PDTC blocked the 4-1BB-mediated increase
in cell survival, whereas LY294002 and PD98059 did not. It is
noteworthy that LY294002 and PD98059 inhibited 4-1BB-induced cellular
proliferation, as shown in Fig. 1
C, whereas they had no
effect on cell survival (Fig. 2C).
|
As shown in Fig. 3A,
4-1BB cross-linking increased transcription of two antiapoptotic genes,
bcl-xL and bfl-1, both of which
have been shown to play critical roles in T lymphocyte survival.
Theinduction of bcl-xL and
bfl-1 by 4-1BB was not blocked by pretreatment of cells with
CHX (Fig. 3B), indicating that 4-1BB-mediated signals
increased the expression of bcl-xL and
bfl-1 independently of new protein synthesis.
|
PDTC (20 µg/ml) completely inhibited 4-1BB-induced expression of
bfl-1 (Fig. 4, A
and C) and bcl-xL mRNA (Fig. 4, A and D), indicating that 4-1BB induces
bcl-xL and bfl-1 mRNA
expression via NF-B. Similarly, 4-1BB-mediated increases in
Bcl-xL protein production were inhibited by PDTC
(Fig. 4B). PDTC, an antioxidant compound, is known to
specifically inhibit NF-B via blockade of IB-
phosphorylation
(16). However, in contrast with its inhibition of
4-1BB-induced cellular proliferation (Fig. 1C), LY294002 had
no effect on the 4-1BB-induced up-regulation of bfl-1 (Fig. 5, A and C) or
bcl-xL mRNA (Fig. 5, A and
D). Again, LY294002 did not inhibit the 4-1BB-mediated
increase in Bcl-xL protein production (Fig. 5B). Note that, although overall levels of
Bcl-xL and Bfl-1 expression were decreased by
LY294002, the fold increase between lanes 1 and 2 was similar to that
between lanes 3 and 4 (Fig. 5, A and B). These
data suggest that 4-1BB-mediated induction of
Bcl-xL and Bfl-1 occurred via NF-B activation,
and not through the PI3K pathway.
|
|
C), had no effect on
4-1BB-mediated increases in bfl-1 (Fig. 6, A and C) or
bcl-xL mRNA (Fig. 6, A and
D) or Bcl-xL protein (Fig. 6B). Therefore, we determined whether 4-1BB would activate
extracellular signal-related kinase 1/2 (ERK1/2), which is downstream
of MEK. As shown in Fig. 6E, 4-1BB ligation increased
phosphorylation of ERK1/2, but did not alter ERK1/2 protein levels.
PD98059 inhibited 4-1BB-mediatedphosphorylation of ERK1/2 (Fig. 6E). Taken together, these data suggest that 4-1BB-mediated
activation of the ERK1/2 and/or PI3K pathways is necessary for
4-1BB-induced proliferation, but not for 4-1BB-mediated
Bcl-xL or Bfl-1 expression or cell survival.
Thus, it appears that 4-1BB-generated signals for cell survival are
different from those that mediate cellular proliferation.
|
B activation is not coupled with the MEK or
PI3K pathways
As shown in Fig. 7A,
4-1BB ligation resulted in a rapid degradation of IB- that was
evident within 5 min and persisted for up to 30 min. By 60 min,
however, the levels of IB- protein had increased sharply because
of its rapid turnover rate (17). LY294002 and PD98059 had
no effect on 4-1BB-mediated IB- degradation, confirming that
4-1BB-mediated NF-B activation is not coupled with the PI3K or MEK
pathways. However, IB- degradation was inhibited by PDTC (Fig. 7B). NF-B activity was elevated in
CD8+ T cells treated with anti-CD3 plus
anti-4-1BB, relative to cells treated with anti-CD3 alone (Fig. 7C). In other studies (data not shown), we have seen that
PDTC completely abrogates 4-1BB-induced NF-B activity.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B activation that provides
CD8+ lymphocytes with prolonged survival via
up-regulation of Bcl-xL and Bfl-1 expression. It
would be interesting to test whether inhibitors of
bcl-xL or bfl-1 expression
block 4-1BB-mediated antiapoptotic functions or whether 4-1BB-mediated
costimulation is protective in bcl-2-deficient
mice.
The critical importance of NF-B activation by 4-1BB for
Bcl-xL and Bfl-1 induction in our study is
consistent with recent studies showing NF-B-dependent up-regulation
of Bcl-xL and Bfl-1 expression in other contexts
(7, 8, 9, 10). For instance, CD28-mediated NF-B activation is
essential for Bcl-xL induction and antiapoptotic
effects in primary human CD4+ T lymphocytes
(8). Similarly, NF-B-mediated up-regulation of
Bcl-xL and Bfl-1 is important for CD40 survival
signaling in B lymphocytes (9). Although it has been shown
that the PI3K/Akt pathway plays a role in NF-B activation (19, 20) and subsequent Bcl-xL expression
(10, 21), this pathway is not involved in 4-1BB-mediated
up-regulation of Bcl-xL and Bfl-1 in primary
CD8+ T lymphocytes. LY294002, a PI3K blocker,
abolished 4-1BB-mediated T cell proliferation to the same extent as did
PDTC, an NF-B blocker. However, LY294002 did not block
4-1BB-mediated up-regulation of Bcl-xL, whereas
PDTC did. These data indicate that 4-1BB-induced PI3K and NF-B
signals have separate physiological functions: only the NF-B signal
triggers Bcl-xL and, potentially, Bfl-1
expression. Interestingly, we have also observed that 4-1BB ligation
enhances cell cycle progression and that PI3K and ERK1/2 signals are
specifically responsible for 4-1BB-mediated cell cycle progression, but
not for cell survival in CD8+ T lymphocytes
(S.-J. Park, K.-O. Nam, B. S. Kwon, and H. W. Lee, manuscript in
preparation). We speculate that 4-1BB-evoked cytokine secretion may act
on cytokine receptors on CD8+ T cells in an
autocrine or paracrine manner, thereby promoting cell cycle progression
through the PI3K pathway. The IL-2R is well known to enhance cell cycle
progression and proliferation via the PI3K/Akt/E2F/cyclin pathway
(22, 23).
The present results explain how engagement of the costimulatory
molecule 4-1BB enhances survival of CD8+ T
lymphocytes. Our results show that 4-1BB-stimulated expression of
Bcl-xL and Bfl-1 occurs mainly through NF-B
activation. This mechanism could account for 4-1BB-induced long-term
survival of CD8+T lymphocytes in vivo.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Byoung S. Kwon, Immunomodulation Research Center, University of Ulsan, Ulsan, Korea 680-749. E-mail address: bskwon{at}mail.ulsan.ac.kr
3 Abbreviations used in this paper: MAPK, mitogen-activated protein kinase; CHX, cycloheximide; PDTC, l-pyrrollidinecarbodithioic acid; PI3K, phosphatidylinositol-3 kinase; MEK, MAPK kinase; ERK, extracellular signal-related kinase.
Received for publication May 31, 2002. Accepted for publication August 20, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B cascade is important in Bcl-xL expression and for the anti-apoptotic effects of the CD28 receptor in primary human CD4+ lymphocytes. J. Immunol. 165:1743.B-mediated up-regulation of Bcl-x and Bfl-1/A1 is required for CD40 survival signaling in B lymphocytes. Proc. Natl. Acad. Sci. USA 96:9136.B activation, and Bcl-xL levels in vivo. J. Exp. Med. 191:1721.B. Biochem. Biophys. Res. Commun. 242:613.[Medline]
B. Mol. Cell. Biol. 18:558.B- on serines 32 and 36 controls IB- proteolysis and NF-B activation in response to diverse stimuli. EMBO J. 14:2876.[Medline]
B- activates NF-B without proteolytic degradation of IB-. Cell 86:787.[Medline]
B activation. Proc. Natl. Acad. Sci. USA 96:429.B activation by tumour necrosis factor requires the Akt serine-theonine kinase. Nature 401:82.[Medline]
This article has been cited by other articles:
|
|
 |
|
  Y. H. Kim, B. K. Choi, W. J. Kang, K. H. Kim, S. W. Kang, A. L. Mellor, D. H. Munn, and B. S. Kwon IFN-{gamma}-indoleamine-2,3 dioxygenase acts as a major suppressive factor in 4-1BB-mediated immune suppression in vivo J. Leukoc. Biol., May 1, 2009; 85(5): 817 - 825. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. H. Kim, B. K. Choi, H. S. Oh, W. J. Kang, R. S. Mittler, and B. S. Kwon Mechanisms involved in synergistic anticancer effects of anti-4-1BB and cyclophosphamide therapy Mol. Cancer Ther., February 1, 2009; 8(2): 469 - 478. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. H. Y. Lin, B. J. Sedgmen, T. J. Moraes, L. M. Snell, D. J. Topham, and T. H. Watts Endogenous 4-1BB Ligand Plays a Critical Role in Protection from Influenza-Induced Disease J. Immunol., January 15, 2009; 182(2): 934 - 947. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Murillo, A. Arina, S. Hervas-Stubbs, A. Gupta, B. McCluskey, J. Dubrot, A. Palazon, A. Azpilikueta, M. C. Ochoa, C. Alfaro, et al. Therapeutic Antitumor Efficacy of Anti-CD137 Agonistic Monoclonal Antibody in Mouse Models of Myeloma Clin. Cancer Res., November 1, 2008; 14(21): 6895 - 6906. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. H. Kim, B. K. Choi, K. H. Kim, S. W. Kang, and B. S. Kwon Combination Therapy with Cisplatin and Anti-4-1BB: Synergistic Anticancer Effects and Amelioration of Cisplatin-Induced Nephrotoxicity Cancer Res., September 15, 2008; 68(18): 7264 - 7269. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. G. Mack, A. K. Lanham, B. E. Palmer, L. A. Maier, T. H. Watts, and A. P. Fontenot 4-1BB Enhances Proliferation of Beryllium-Specific T Cells in the Lung of Subjects with Chronic Beryllium Disease J. Immunol., September 15, 2008; 181(6): 4381 - 4388. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Sabbagh, G. Pulle, Y. Liu, E. N. Tsitsikov, and T. H. Watts ERK-Dependent Bim Modulation Downstream of the 4-1BB-TRAF1 Signaling Axis Is a Critical Mediator of CD8 T Cell Survival In Vivo J. Immunol., June 15, 2008; 180(12): 8093 - 8101. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Wang, T. Wen, J.-P. Routy, N. F. Bernard, R. P. Sekaly, and T. H. Watts 4-1BBL Induces TNF Receptor-Associated Factor 1-Dependent Bim Modulation in Human T Cells and Is a Critical Component in the Costimulation-Dependent Rescue of Functionally Impaired HIV-Specific CD8 T Cells J. Immunol., December 15, 2007; 179(12): 8252 - 8263. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Habib-Agahi, T. T. Phan, and P. F. Searle Co-stimulation with 4-1BB ligand allows extended T-cell proliferation, synergizes with CD80/CD86 and can reactivate anergic T cells Int. Immunol., December 1, 2007; 19(12): 1383 - 1394. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. H. Yi, H. Nechushtan, W. J. Bowers, G. R. Walker, Y. Zhang, D. G. Pham, E. R. Podack, H. J. Federoff, K. A. Tolba, and J. D. Rosenblatt Adoptively Transferred Tumor-Specific T Cells Stimulated Ex vivo Using Herpes Simplex Virus Amplicons Encoding 4-1BBL Persist in the Host and Show Antitumor Activity In vivo Cancer Res., October 15, 2007; 67(20): 10027 - 10037. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-J. Lee, R. J. Rossi, S.-K. Lee, M. Croft, B. S. Kwon, R. S. Mittler, and A. T. Vella CD134 Costimulation Couples the CD137 Pathway to Induce Production of Supereffector CD8 T Cells That Become IL-7 Dependent J. Immunol., August 15, 2007; 179(4): 2203 - 2214. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Wolfl, J. Kuball, W. Y. Ho, H. Nguyen, T. J. Manley, M. Bleakley, and P. D. Greenberg Activation-induced expression of CD137 permits detection, isolation, and expansion of the full repertoire of CD8+ T cells responding to antigen without requiring knowledge of epitope specificities Blood, July 1, 2007; 110(1): 201 - 210. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Zhang, R. E. Sadun, R. S. Arias, M. L. Flanagan, S. M. Sachsman, Y.-C. Nien, L. A. Khawli, P. Hu, and A. L. Epstein Targeted and Untargeted CD137L Fusion Proteins for the Immunotherapy of Experimental Solid Tumors Clin. Cancer Res., May 1, 2007; 13(9): 2758 - 2767. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Niu, S. Strahotin, B. Hewes, B. Zhang, Y. Zhang, D. Archer, T. Spencer, D. Dillehay, B. Kwon, L. Chen, et al. Cytokine-Mediated Disruption of Lymphocyte Trafficking, Hemopoiesis, and Induction of Lymphopenia, Anemia, and Thrombocytopenia in Anti-CD137-Treated Mice J. Immunol., April 1, 2007; 178(7): 4194 - 4213. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. D. Saibil, R. G. Jones, E. K. Deenick, N. Liadis, A. R. Elford, M. G. Vainberg, H. Baerg, J. R. Woodgett, S. Gerondakis, and P. S. Ohashi CD4+ and CD8+ T Cell Survival Is Regulated Differentially by Protein Kinase C{theta}, c-Rel, and Protein Kinase B J. Immunol., March 1, 2007; 178(5): 2932 - 2939. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Houtenbos, T. M. Westers, A. Dijkhuis, T. D. de Gruijl, G. J. Ossenkoppele, and A. A. van de Loosdrecht Leukemia-Specific T-Cell Reactivity Induced by Leukemic Dendritic Cells Is Augmented by 4-1BB Targeting Clin. Cancer Res., January 1, 2007; 13(1): 307 - 315. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-W. Lee, Y. Park, A. Song, H. Cheroutre, B. S. Kwon, and M. Croft Functional Dichotomy between OX40 and 4-1BB in Modulating Effector CD8 T Cell Responses J. Immunol., October 1, 2006; 177(7): 4464 - 4472. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Minamimura, W. Gao, and T. Maki CD4+ Regulatory T Cells Are Spared from Deletion by Antilymphocyte Serum, a Polyclonal Anti-T Cell Antibody J. Immunol., April 1, 2006; 176(7): 4125 - 4132. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Pulle, M. Vidric, and T. H. Watts IL-15-Dependent Induction of 4-1BB Promotes Antigen-Independent CD8 Memory T Cell Survival. J. Immunol., March 1, 2006; 176(5): 2739 - 2748. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Rabu, A. Quemener, Y. Jacques, K. Echasserieau, P. Vusio, and F. Lang Production of Recombinant Human Trimeric CD137L (4-1BBL): CROSS-LINKING IS ESSENTIAL TO ITS T CELL CO-STIMULATION ACTIVITY J. Biol. Chem., December 16, 2005; 280(50): 41472 - 41481. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Rasooly, G. U. Schuster, J. P. Gregg, J.-H. Xiao, R. A. S. Chandraratna, and C. B. Stephensen Retinoid X Receptor Agonists Increase Bcl2a1 Expression and Decrease Apoptosis of Naive T Lymphocytes J. Immunol., December 15, 2005; 175(12): 7916 - 7929. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Bukczynski, T. Wen, C. Wang, N. Christie, J.-P. Routy, M.-R. Boulassel, C. M. Kovacs, K. S. MacDonald, M. Ostrowski, R.-P. Sekaly, et al. Enhancement of HIV-Specific CD8 T Cell Responses by Dual Costimulation with CD80 and CD137L J. Immunol., November 15, 2005; 175(10): 6378 - 6389. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-C. Lee, S.-A. Ju, H.-N. Pack, S.-K. Heo, J.-H. Suh, S.-M. Park, B.-K. Choi, B. S. Kwon, and B. S. Kim 4-1BB (CD137) Is Required for Rapid Clearance of Listeria monocytogenes Infection Infect. Immun., August 1, 2005; 73(8): 5144 - 5151. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Hendriks, Y. Xiao, J. W. A. Rossen, K. F. van der Sluijs, K. Sugamura, N. Ishii, and J. Borst During Viral Infection of the Respiratory Tract, CD27, 4-1BB, and OX40 Collectively Determine Formation of CD8+ Memory T Cells and Their Capacity for Secondary Expansion J. Immunol., August 1, 2005; 175(3): 1665 - 1676. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Zhang and Y.-W. He The Antiapoptotic Protein Bcl-xL Is Dispensable for the Development of Effector and Memory T Lymphocytes J. Immunol., June 1, 2005; 174(11): 6967 - 6973. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Arens, P. A. Baars, M. Jak, K. Tesselaar, M. van der Valk, M. H. J. van Oers, and R. A. W. van Lier Cutting Edge: CD95 Maintains Effector T Cell Homeostasis in Chronic Immune Activation J. Immunol., May 15, 2005; 174(10): 5915 - 5920. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-O. Nam, H. Kang, S.-M. Shin, K.-H. Cho, B. Kwon, B. S. Kwon, S.-J. Kim, and H.-W. Lee Cross-Linking of 4-1BB Activates TCR-Signaling Pathways in CD8+ T Lymphocytes J. Immunol., February 15, 2005; 174(4): 1898 - 1905. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Lun, P. L. Zhang, P. K. Pellitteri, A. Law, T. L. Kennedy, and R. E. Brown Nuclear Factor-kappaB Pathway as a Therapeutic Target in Head and Neck Squamous Cell Carcinoma: Pharmaceutical and Molecular Validation in Human Cell Lines Using Velcade and siRNA/NF-{kappa}B. Ann. Clin. Lab. Sci., January 1, 2005; 35(3): 251 - 258. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Ito, Q. Li, A. B. Shreiner, R. Okuyama, M. N. Jure-Kunkel, S. Teitz-Tennenbaum, and A. E. Chang Anti-CD137 Monoclonal Antibody Administration Augments the Antitumor Efficacy of Dendritic Cell-Based Vaccines Cancer Res., November 15, 2004; 64(22): 8411 - 8419. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Dawicki, E. M. Bertram, A. H. Sharpe, and T. H. Watts 4-1BB and OX40 Act Independently to Facilitate Robust CD8 and CD4 Recall Responses J. Immunol., November 15, 2004; 173(10): 5944 - 5951. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Arens, K. Schepers, M. A. Nolte, M. F. van Oosterwijk, R. A.W. van Lier, T. N.M. Schumacher, and M. H.J. van Oers Tumor Rejection Induced by CD70-mediated Quantitative and Qualitative Effects on Effector CD8+ T Cell Formation J. Exp. Med., June 7, 2004; 199(11): 1595 - 1605. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. E. Gamadia, E. M. M. van Leeuwen, E. B. M. Remmerswaal, S.-L. Yong, S. Surachno, P. M. E. Wertheim-van Dillen, I. J. M. ten Berge, and R. A. W. van Lier The Size and Phenotype of Virus-Specific T Cell Populations Is Determined by Repetitive Antigenic Stimulation and Environmental Cytokines J. Immunol., May 15, 2004; 172(10): 6107 - 6114. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. K. Choi, J. S. Bae, E. M. Choi, W. J. Kang, S. Sakaguchi, D. S. Vinay, and B. S. Kwon 4-1BB-dependent inhibition of immunosuppression by activated CD4+CD25+ T cells J. Leukoc. Biol., May 1, 2004; 75(5): 785 - 791. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Petrovas, Y. M. Mueller, I. D. Dimitriou, P. M. Bojczuk, K. C. Mounzer, J. Witek, J. D. Altman, and P. D. Katsikis HIV-Specific CD8+ T Cells Exhibit Markedly Reduced Levels of Bcl-2 and Bcl-xL J. Immunol., April 1, 2004; 172(7): 4444 - 4453. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. M. Bertram, W. Dawicki, B. Sedgmen, J. L. Bramson, D. H. Lynch, and T. H. Watts A Switch in Costimulation from CD28 to 4-1BB during Primary versus Secondary CD8 T Cell Response to Influenza In Vivo J. Immunol., January 15, 2004; 172(2): 981 - 988. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Nencioni, K. Lauber, F. Grunebach, L. Van Parijs, C. Denzlinger, S. Wesselborg, and P. Brossart Cyclopentenone Prostaglandins Induce Lymphocyte Apoptosis by Activating the Mitochondrial Apoptosis Pathway Independent of External Death Receptor Signaling J. Immunol., November 15, 2003; 171(10): 5148 - 5156. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
