|
|
||||||||

* Department of Pediatrics, Faculty of Medicine, Fukui Medical University, and
Division of Transfusion Medicine, Fukui Medical University Hospital, Fukui, Japan
| Abstract |
|---|
|
|
|---|
. The production of IL-10, a potent endogenous IL-12
inhibitor, was not affected by MCP-1. Whereas the inhibitory activity
of MCP-1 on IL-12 production by monocytes was sensitive to pertussis
toxin, its effects on DC differentiation were pertussis toxin
resistant. MCP-1 did not affect the surface phenotype and T
cell-stimulating activity of DCs, but most interestingly, naive T cells
stimulated with MCP-1-primed DCs produced much less IFN-
but the
same levels of IL-13. Taken together, our results indicated that MCP-1
modulates the differentiation of monocytes into DCs and may thereby
inhibit Th1 cell development. | Introduction |
|---|
|
|
|---|
Monocyte chemoattractant protein-1
(MCP-1),4 a CC
chemokine initially identified as a monocyte-specific chemoattractant,
has now been shown to attract activated T cells, NK cells, and
basophils, as well as monocytes (9). MCP-1 binds to
seven-transmembrane-spanning proteins, such as CCR2, Duffy Ag/receptor
for chemokines/Duffy, and D6 (10, 11). CCR2 is the only
known functional receptor for MCP-1 and is linked to downstream
signaling pathways through heterotrimeric G proteins (10).
MCP-1 is postulated to play pivotal roles in the pathogenesis of a
variety of diseases characterized by mononuclear cell infiltration,
such as rheumatoid arthritis and bronchial asthma (12, 13). A number of studies have shown that MCP-1-deficient mice
exhibit attenuated Th2-type responses with a shift to Th1, as well as
increased resistance to Leishmania major infection
(14, 15). In contrast, CCR2-knockout mice have a markedly
attenuated T cell IFN-
response, defects in the clearance of
intracellular pathogens, and increased resistance to Th1-mediated
diseases (8, 16, 17, 18). Thus, although the in vivo
observations indicated that MCP-1 and CCR2 are involved in effector T
cell differentiation, their precise role remains to be determined.
Primary immune responses are initiated by dendritic cells (DCs), which inform naive Th cells about invading pathogens, providing an Ag-specific "signal 1" and a costimulatory "signal 2" (19). Because myeloid DCs that develop and mature in different conditions are functionally different, Kalinski et al. (20) proposed a new concept according to which migrating DCs carry an additional "signal 3," regulating the commitment of naive T cells to Th1 or Th2 subsets. It has been reported that, in vivo, activated monocytes may differentiate into DCs migrating to lymphoid tissues (21) and that IL-12 production by activated human monocytes, but not DCs, is suppressed by MCP-1 (22). In the present study, we examined the potential role of MCP-1 in the process of monocyte differentiation into DCs. We demonstrate that MCP-1 significantly regulates the IL-12-producing capacity of monocyte-derived DCs by a mechanism that is resistant to pertussis toxin.
| Materials and Methods |
|---|
|
|
|---|
Human recombinant GM-CSF and IL-4 were kindly provided by Kirin
Beverage (Tokyo, Japan) and Ono Pharmaceutical (Osaka, Japan),
respectively. MCP-1 and macrophage-inflammatory protein-1
(MIP-1
)
were purchased from PeproTech (London, U.K.) (lot-specific
endotoxin concentration was <0.1 ng/µg). Staphylococcus
aureus Cowan strain I cells (SAC) were supplied by Calbiochem (La
Jolla, CA). FITC-dextran and pertussis toxin were obtained from
Sigma-Aldrich (St. Louis, MO) and Wako Biochemicals (Osaka,
Japan), respectively. FITC-conjugated mAbs specific for CD83, CD86, MHC
class II, and CCR2 were purchased from Ancell (Bayport, MN) and DAKO
Japan (Kyoto, Japan), respectively. Anti-CD40 and anti-CD1a mAbs
were purchased from BD PharMingen (San Diego, CA). CD40 ligand
(CD40L)-transfected L cells were a kind gift from Dr. G.
Delespesse (Montreal University, Montreal, Canada). RPMI 1640
(Nissui Pharmaceutical, Tokyo, Japan) was supplemented with 100 U/ml
penicillin G, 100 µg/ml streptomycin, 300 mg/L
L-glutamine, and 10% v/v FCS
(Sigma-Aldrich).
Cell purification and culture conditions
Highly purified monocytes (>95% CD14+)
were obtained from buffy coats of healthy volunteers as described
previously (23). Briefly, PBMC were separated by
Ficoll-Paque Plus (Amersham Pharmacia Biotech, Little Chalfont, U.K.).
Monocytes were enriched by cold aggregation and deprived of T and NK
cells by rosetting with SRBC treated with 2-aminoethylisothiouronium
bromide (Sigma-Aldrich). Enriched monocytes (5 x
106 cells/well) were cultured in a plastic
six-well plate (Falcon, Rutherford, NJ) for 30 min followed by the
removal of trace numbers of nonadherent cells. The adherent cells were
cultured in 1 ml of RPMI 1640/FCS supplemented with 40 ng/ml GM-CSF and
40 ng/ml IL-4 in the presence or absence of MCP-1 (40 ng/ml) or
MIP-1
(40 ng/ml) at 37°C. One milliliter of
fresh medium containing GM-CSF, IL-4, and the chemokines was added on
day 2, 1 ml of medium was replaced with fresh medium containing the
cytokines on day 5, and nonadherent cells were harvested on day 7.
Microscopic analysis showed that >98% of nonadherent cells had
cellular projections. Analysis by flow cytometry revealed that the
preparations consisted of a homogenous (>96%) population of
CD2-CD14low/-CD16-CD40+CD54+CD86lowCD83low/-HLA-DR+
large cells and <1% of CD3+,
CD19+, or CD56+ cells.
Cytokine production
DCs generated in the presence or absence of the chemokines were
extensively washed with PBS three times. Cells (0.5 x
106 cells/ml) were then stimulated with SAC
(0.2%) or irradiated CD40L-transfected L cells (7200 rad, 0.25 x
106 cells/ml) and IFN-
(50 ng/ml) in 0.5 ml of
culture medium in a 48-well culture plate (Falcon). After 48 h of
stimulation, supernatants were collected and stored at -20°C until
assayed for cytokines. For measurement of mRNA expression, the cells
were lysed after 6 h of stimulation and total RNA was isolated
using the RNeasy kit (Qiagen, Hilden, Germany).
T lymphocytes and allogeneic MLR
CD4+ T cells were isolated from PBMC by MACS CD4 MultiSort kit (Miltenyi Biotec, Bergisch Gladbach, Germany), and CD45RA+ cells were negatively selected by depleting CD45RO+ cells with CD45RO MicroBeads using the protocol recommended by the supplier (Miltenyi Biotec). The purity of naive CD4+ T cells was assessed by flow cytometry using anti-CD4 and anti-CD45RA mAbs (Ancell) and was shown to be >98%.
The T cells (1 x 106/ml) used as responder cells were stimulated with different numbers of monocyte-derived DCs in a final volume of 200 µl in a 96-well U-bottom plate (Falcon) for 4 days. Cell proliferation was assessed by adding 1 µCi/well methyl-[3H]thymidine (10 Ci/mmol; Amersham Pharmacia Biotech) during the last 16 h of culture. Triplicate cultures were then harvested onto glass fiber filters, and radioactivity was counted using liquid scintillation. Before the thymidine pulse, supernatants were collected and cytokine content was determined.
Cytokine measurements
IL-12 p70, IL-10, IL-13, and IFN-
were measured by a two-site
sandwich ELISA. Ab pairs and standard recombinant human cytokines for
the ELISA were purchased from Endogen (Woburn, MA) and PeproTech,
respectively. The detection limits for IL-12 p70, IL-10, IL-13, and
IFN-
were 15, 31, 31, and 15 pg/ml, respectively.
Analysis of cytokine mRNA expression
First-strand cDNA was synthesized from 1 µg of the total
amount of RNA using SuperScript II reverse transcriptase (Life
Technologies, Gaithersburg, MD). PCR amplification of IL-12 p40, IL-12
p35, and
-actin was conducted using IL-12 p40, IL-12 p35, and
-actin primers. The primer sequences were as follows: for IL-12 p40,
CCAAGAACTTGCAGCTGAAG (sense) and TGGGTCTATTCCGTTGTGTC (antisense);
for IL-12 p35, AAGATGTACCAGGTGGAGTT (sense) and
AGCTCGTCACTCTGTCAATA (antisense); and for
-actin,
GATCAGCAAGCAGGAGTATG (sense) and ACACGAAAGCAATGCTATCA (antisense).
Semiquantitative conditions were determined experimentally and
nonsaturating conditions were verified using serially diluted cDNA
mixtures. Ethidium bromide-stained PCR products were analyzed on 1.5%
agarose gel by Chemi-imager (Alpha Innotech/Yaman, Tokyo,
Japan).
For more accurate quantification, mRNA levels were determined after
reverse transcription by real-time PCR using TaqMan Pre-Developed Assay
Reagents for gene expression quantification of human IL-12 p40, IL-12
p35, and
-actin (Applied Biosystems Japan, Tokyo, Japan). The change
of reporter fluorescence from each reaction tube was monitored by ABI
PRISM 7000 Sequence Detection System (Applied Biosystems Japan). The
threshold cycle of each gene was determined as the number of PCR
cycles at which an increase in reporter fluorescence was above a
baseline signal. The difference in threshold cycles between the target
gene and
-actin gives the standardized expression level (
Ct).
Subtraction of
Ct of control from
Ct of the MCP-1-treated DCs
gives the 
Ct value that was used to calculate relative expression
levels in the MCP-1-treated DCs with the formula
2-
Ct.
Ag uptake assay
Mannose receptor-mediated endocytosis was measured as the cellular uptake of FITC-dextran (Sigma-Aldrich). DCs (5 x 105) were incubated in HBSS containing FITC-dextran (1 mg/ml) for 0, 30, 60, and 90 min. After incubation, cells were washed three times with cold PBS and fixed in 1% formaldehyde. The uptake of FITC-dextran was determined quantitatively by flow cytometry.
Statistical analysis
All data were expressed as mean ± SEM. Differences between groups were examined for statistical significance using Wilcoxon matched-pairs signed-ranks test. A p value <0.05 denoted a statistically significant difference.
| Results |
|---|
|
|
|---|
Monocytes constitute an important pool of circulating DC
precursors that are recruited at inflammatory sites by various
chemokines, including MCP-1 and MIP-1
(24). We first
investigated whether chemokines modulate the differentiation of
monocytes into DCs. Monocytes were cultured with GM-CSF and IL-4 in the
presence or absence of MCP-1 or MIP-1
for 7 days, and their surface
markers were examined. As reported previously (23),
cytokine-induced DCs expressed CD1a, trace amounts of CD83, and little,
if any, CD14. Neither MCP-1 nor MIP-1
altered the expression levels
of CD14, CD83, and CD1a (Fig. 1
A). Moreover, there was no
significant difference in the expression levels of CD86, ICAM-1, and
MHC class II between DCs induced in the presence of MCP-1 (MCP-1-DCs)
or MIP-1
(MIP-1
-DCs) and those induced in the absence of these
chemokines (control DCs). Endocytic activity of DCs is closely
associated with their maturation stage (19). As shown in
Fig. 1
B, endocytosis of FITC-dextran by MCP-1-DCs or
MIP-1
-DCs was similar to that by control DCs. Taken together,
these data indicated that MCP-1 or MIP-1
did not affect the
differentiation and maturation of DCs in terms of surface phenotypes
and endocytic activity.
|
We next examined the production of cytokine by DCs generated in
the presence of the selected chemokines. DCs were stimulated with
either CD40L-transfected L cells or SAC, as T cell-dependent and
-independent stimuli, respectively. Because the levels of IL-12 p70
released from DCs stimulated with CD40L transfectants alone were too
low to be detected by ELISA (data not shown), we took advantage of a
study showing that costimulation with IFN-
enhances IL-12 production
of DCs (25). As shown in Fig. 2
A, when stimulated with a
combination of CD40L transfectants and IFN-
, MCP-1-DCs produced
consistently less IL-12 p70 than control DCs (mean ± SEM:
70.2 ± 9.1% suppression; p < 0.001;
n = 11), whereas there was no significant difference in
the IL-12 p70 production between MIP-1
-DCs and control DCs. Most
strikingly, the inhibitory effect of MCP-1 on the acquisition of IL-12
p70-producing capacity was not observed in response to stimulation with
SAC alone or together with IFN-
(Fig. 2
A). Unlike IL-12
p70, addition of MCP-1 or MIP-1
during the differentiation of DCs
did not affect the acquisition of IL-10-producing capacity (Fig. 2
B).
|
. As illustrated in Fig. 3
|
Our findings, in agreement with Braun et al.
(22), that the addition of MCP-1 at the time of DC
stimulation did not suppress IL-12 production (Fig. 4
A) prompted us to examine the
expression of CCR2 and the effect of MCP-1 over time, during the 7-day
culture of monocytes with IL-4 and GM-CSF. As seen in Fig. 4
B, the expression of CCR2 was up-regulated during the first
2 days of culture and then gradually decreased. Interestingly, low but
significant levels of CCR2 were consistently detected on DCs (at day
7), despite the fact that these cells were refractory to the
suppressive effect of MCP-1 on IL-12 production. Similarly, addition of
MCP-1 during the last 2 days of culture (days 57), when CCR2 levels
were still relatively high, did not affect the IL-12-producing capacity
of DCs (Fig. 4
C). In keeping with these findings, the
presence of MCP-1 during only the first 5 days of culture was
sufficient for IL-12 inhibition; however, maximal suppression was
observed when MCP-1 was present during the entire 7-day culture period
(Fig. 4
D). Finally, the addition of MCP-1 could be delayed
to day 2 without altering its suppressive activity (Fig. 4
C).
|
As previously reported (22), we found that
MCP-1-mediated suppression of IL-12 production by monocytes was
sensitive to pertussis toxin (Fig. 5
A). To determine whether or
not the suppressive effect of MCP-1 on IL-12 production observed in our
study was also dependent on the same signaling pathway, DCs were
generated in the presence or absence of pertussis toxin and MCP-1.
After 7 days of culture, cells were extensively washed and stimulated
with CD40L transfectants together with IFN-
. As shown in Fig. 5
B, DCs generated in the presence of pertussis toxin alone
showed reduced production of IL-12 and enhanced production of IL-10
(p < 0.05). MCP-1 treatment further suppressed
IL-12 production but did not affect IL-10 production (Fig. 5
C). Thus, these data indicated that the effects of MCP-1 on
the acquisition of IL-12-producing capacity are not sensitive to
pertussis toxin.
|

Because DCs play an exclusive role in the activation and
differentiation of naive T cells, we examined the ability of MCP-1-DCs
to stimulate allogeneic naive T cells. As expected from the results in
Fig. 1
, there was no significant difference in cell proliferation
between naive CD4+ T cells stimulated with
MCP-1-DCs and those stimulated with control DCs or MIP-1
-DCs (Fig. 6
A). Consistent with the
IL-12-producing capacity of the various DCs used in these experiments,
naive CD4+ T cells stimulated with MCP-1-DCs
produced much less IFN-
than those stimulated with control DCs (Fig. 6
B). Most interestingly, MCP-1-DCs and control DCs induced
the same levels of IL-13 production by the naive T cells (Fig. 6
C). IL-4 was not detectable in the cultures of the naive T
cells stimulated with either MCP-1-DCs or control DCs. Thus,
these data indicated that MCP-1-DCs inhibited Th1 cell development
without increasing Th2 cytokine production.
|
| Discussion |
|---|
|
|
|---|
, but normal levels of IL-13, compared
with control DCs. MCP-1 is known to play a key role in the accumulation of monocytes in inflammatory sites and may also participate in their constitutive recruitment to peripheral tissues during steady state (14). It is of note that transgenic mice overexpressing MCP-1, under the keratin promoter, show local accumulation of cells with DC morphology in the basal layer of the epidermis (26). This accumulation may result from the direct recruitment of immature DCs or the migration of monocytes followed by local differentiation to DCs. Our results suggested that, in addition to recruiting monocytes at inflammatory sites, MCP-1 also regulates their differentiation into DCs.
In contrast to monocytes, contradictory results have been reported in
terms of the biological activities of MCP-1 on DCs, such as calcium
influx and chemotaxis (27, 28). In the present study, the
late exposure to MCP-1 during the induction of DCs did not affect the
acquisition of IL-12-producing capacity despite the significant, albeit
low, level of CCR2 expression (Fig. 5
). Given that mature
monocyte-derived DCs lose CCR2 expression (29, 30), it is
likely that the MCP-1 signaling pathway becomes less functional during
DC maturation. Hence, early exposure to MCP-1 seems critical in
dictating the functional phenotype of DCs.
MCP-1 might inhibit the acquisition of IL-12-producing capacity by
inducing the production of IL-10, TGF-
1, or
PGE2 during the cytokine-driven differentiation
of monocytes into DCs (31). However, IL-10 levels in the
MCP-1-priming culture were very low and similar to those in control
cultures (data not shown), and IL-10 would have allowed monocytes to
differentiate toward
CD14+CD1a- macrophages
rather than DCs (32). Consistent with the notion that
IL-10 is the most potent autocrine inhibitor of proinflammatory
cytokine production (31, 33), neutralization of endogenous
IL-10 upon stimulation enhances IL-12 p70 production even without MCP-1
treatment (Ref. 22 and data not shown). Thus, neutralizing
experiments by anti-IL-10 mAb did not lead to a conclusive role of
endogenous IL-10 in the MCP-1-mediated suppression of IL-12 production.
TGF-
1, which favors the differentiation of monocytes into Langerhans
cells, down-regulates IL-12 production by DCs stimulated with bacterial
products but not CD40L (34). PGE2
enhances the expression of costimulatory molecules on DCs and increases
their ability to stimulate T cells (35). Based on these
considerations, none of the above factors alone could fully explain the
inhibitory effect of MCP-1 on IL-12 production by DCs. However, further
studies are required to formally rule out the involvement of these
factors in the present observation.
Several studies demonstrated the physical association of pertussis
toxin-sensitive G
i to several chemokine
receptors, including CCR2 (36). Consistent with a previous
report (22), MCP-1-mediated IL-12 suppression of monocytes
was sensitive to pertussis toxin treatment, whereas the effect of MCP-1
on the acquisition of IL-12-producing ability of DCs was not (Fig. 5
).
Given that CCR2 receptor couples to multiple G proteins and the
coupling is cell type specific (37), the effect of MCP-1
on DC differentiation may be attributed to pertussis toxin-insensitive
G proteins, such as Gq
or
G16
. Because MCP-1-deficient mice show reduced
Th2 response, whereas CCR2 knockout mice have markedly reduced Th1
response, the phenotypic discrepancy between the two types of mice
suggests that there is a second, as-yet-unidentified receptor for MCP-1
whereby Th2 responses are induced (38). In this context,
MCP-1 might inhibit IL-12 production by DCs via another
G
i-uncoupled receptor. The difference in
signal transduction machinery between monocytes and DCs may also
explain the different inhibitory effect of MCP-1 on IL-12 production
induced by SAC plus IFN-
.
The inhibitory effect of MCP-1 on IL-12 production by DCs was
exclusively observed in response to CD40 stimulation but not SAC
stimulation. Moreover, MCP-1-mediated inhibition of CD40 signaling did
not interfere with all signaling pathways emanating from CD40, because
CD40-induced IL-10 production and up-regulation of costimulatory
molecules were not impaired by MCP-1 (Fig. 2
and data not shown). McRae
et al. (39) reported that, similar to MCP-1, IFN-
selectively inhibits CD40-dependent IL-12 secretion by DCs without
affecting LPS-dependent cytokine production. It has been shown that
engagement of human IFN-1R results in the activation of tyrosine
kinase-2 and STAT3, as well as STAT2 (40), and that CCR2
dimerization recruits Janus kinase 2 and STAT3 (36).
Although the molecular mechanism whereby IFN-
regulates IL-12
production has not been determined, it is possible that MCP-1-mediated
inhibition may use similar mechanisms. Further study is required to
clarify the precise mechanism.
After Ag uptake, DCs undergo maturation and migrate from peripheral
tissues to the paracortical T cell zone of the draining lymph node
within 24 h (41). Our results showed that the
MCP-1-induced decrease in IL-12 production by DCs was preserved for 2
days after removal of the chemokine (Fig. 4
C), suggesting
that the IL-12-producing potential determined in the peripheral tissues
persists in DCs present in lymphoid organs. Several studies
demonstrated that mature DCs produce conspicuous amounts of MCP-1
(42) and lose functional CCR2 expression (29, 30), and that high levels of MCP-1 are detected within lymphoid
tissues (15). MCP-1 produced in peripheral inflammatory
sites seems to influence DCs, whereas that produced in lymphoid tissues
will not affect cytokine production by mature DCs.
Several in vitro and in vivo studies have shown that MCP-1 acts at various steps of T cell differentiation and may influence T cell effector function (4, 7, 8, 14, 15, 16, 17, 18). Furthermore, MCP-1 may or may not enhance naive CD4+ T cell differentiation into Th2 cells (4, 6). Our study suggests another scenario; i.e., MCP-1 indirectly suppresses naive T cells to differentiate into Th1 effector cells by modulating the ability of DC to produce IL-12. Because DCs in the respiratory mucosa function as major APCs during secondary as well as primary immune response (43), MCP-1-primed DCs may also suppress the effector phase of Th1 response in peripheral inflammatory sites. More recently, Traynor et al. (44) reported that MCP-1 can promote both Th1 and Th2 responses in vivo depending on the timing of MCP-1 induction, type of pathogen or Ag, route of inoculation, and the tissue site. In keeping with the findings, MCP-1 may interfere with Th1-mediated responses where IL-12 secretion is predominantly dependent on the CD40/CD40L pathway, but not with the innate immune response of DCs to Gram-positive bacterial infection.
In conclusion, the present study documented the regulatory role of MCP-1 in the differentiation of monocytes toward DCs. The present findings suggest that MCP-1 supplies an important immunomodulatory signal to DCs and that the modulatory effect of MCP-1 may also dictate the cytokine profile in Th response induced by DCs. Further investigation of the role of chemokines in regulating DC function will have important practical implications for the use of chemokine antagonists in the treatment of allergic and autoimmune diseases.
| Footnotes |
|---|
2 N.O. and M.Y. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Dr. Yusei Ohshima, Department of Pediatrics, Faculty of Medicine, Fukui Medical University, Shimoaizuki, Matsuoka, Fukui, Japan, 910-1193. E-mail address: yohshima{at}fmsrsa.fukui-med.ac.jp ![]()
4 Abbreviations used in this paper: MCP-1, monocyte chemoattractant protein-1; CD40L, CD40 ligand; DC, dendritic cell; MIP-1
, macrophage-inflammatory protein-1
; SAC, Staphylococcus aureus Cowan strain I cell; MCP-1-DC, DC induced in the presence of MCP-1; MIP-1
-DC, DC induced in the presence of MCP-1
. ![]()
Received for publication April 25, 2002. Accepted for publication August 19, 2002.
| References |
|---|
|
|
|---|
+ dendritic cells. Nat. Immunol. 1:83.[Medline]
production in C-C chemokine receptor 2 (CCR2) knockout mice: role of CCR2 in linking the innate and adaptive immune responses. J. Immunol. 165:7072.
). Curr. Opin. Immunol. 9:17.[Medline]
1 prevents the noncognate maturation of human dendritic Langerhans cells. J. Immunol. 162:4567.
dimers released by activation of G
i-coupled receptors. Proc. Natl. Acad. Sci. USA 94:14495.
differentially regulates CD40-induced cytokine secretion by human dendritic cells. J. Immunol. 164:23.This article has been cited by other articles:
![]() |
M. Del Corno, A. Michienzi, A. Masotti, L. Da Sacco, G. F. Bottazzo, F. Belardelli, and S. Gessani CC chemokine ligand 2 down-modulation by selected Toll-like receptor agonist combinations contributes to T helper 1 polarization in human dendritic cells Blood, July 23, 2009; 114(4): 796 - 806. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Z. Long, J. I. Santos, T. Estrada Garcia, M. Haas, M. Firestone, J. Bhagwat, H. L. DuPont, E. Hertzmark, J. L. Rosado, and N. N. Nanthakumar Vitamin A Supplementation Reduces the Monocyte Chemoattractant Protein-1 Intestinal Immune Response of Mexican Children J. Nutr., October 1, 2006; 136(10): 2600 - 2605. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. Henke, C. G. Pearce, D. M. Moaveni, A. J. Moore, E. M. Lynch, C. Longo, M. Varma, N. A. Dewyer, K. B. Deatrick, G. R. Upchurch Jr, et al. Targeted Deletion of CCR2 Impairs Deep Vein Thombosis Resolution in a Mouse Model. J. Immunol., September 1, 2006; 177(5): 3388 - 3397. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Rothenbacher, S. Muller-Scholze, C. Herder, W. Koenig, and H. Kolb Differential Expression of Chemokines, Risk of Stable Coronary Heart Disease, and Correlation with Established Cardiovascular Risk Markers Arterioscler Thromb Vasc Biol, January 1, 2006; 26(1): 194 - 199. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. O. Flores-Villanueva, J. A. Ruiz-Morales, C.-H. Song, L. M. Flores, E.-K. Jo, M. Montano, P. F. Barnes, M. Selman, and J. Granados A functional promoter polymorphism in monocyte chemoattractant protein-1 is associated with increased susceptibility to pulmonary tuberculosis J. Exp. Med., December 19, 2005; 202(12): 1649 - 1658. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yasutomi, Y. Ohshima, N. Omata, A. Yamada, H. Iwasaki, Y. Urasaki, and M. Mayumi Erythromycin Differentially Inhibits Lipopolysaccharide- or Poly(I:C)-Induced but Not Peptidoglycan-Induced Activation of Human Monocyte-Derived Dendritic Cells J. Immunol., December 15, 2005; 175(12): 8069 - 8076. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Appel, V. Mirakaj, A. Bringmann, M. M. Weck, F. Grunebach, and P. Brossart PPAR-{gamma} agonists inhibit toll-like receptor-mediated activation of dendritic cells via the MAP kinase and NF-{kappa}B pathways Blood, December 1, 2005; 106(12): 3888 - 3894. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Lopez, S. K. Adris, A. I. Bravo, Y. Chernajovsky, and O. L. Podhajcer IL-12 and IL-10 Expression Synergize to Induce the Immune-Mediated Eradication of Established Colon and Mammary Tumors and Lung Metastasis J. Immunol., November 1, 2005; 175(9): 5885 - 5894. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Spight, B. Zhao, M. Haas, S. Wert, A. Denenberg, and T. P. Shanley Immunoregulatory effects of regulated, lung-targeted expression of IL-10 in vivo Am J Physiol Lung Cell Mol Physiol, February 1, 2005; 288(2): L251 - L265. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Teuscher, M. E. Poynter, H. Offner, A. Zamora, T. Watanabe, P. D. Fillmore, J. F. Zachary, and E. P. Blankenhorn Attenuation of Th1 Effector Cell Responses and Susceptibility to Experimental Allergic Encephalomyelitis in Histamine H2 Receptor Knockout Mice Is Due to Dysregulation of Cytokine Production by Antigen-Presenting Cells Am. J. Pathol., March 1, 2004; 164(3): 883 - 892. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Helmby and R. K. Grencis IFN-{gamma}-Independent Effects of IL-12 During Intestinal Nematode Infection J. Immunol., October 1, 2003; 171(7): 3691 - 3696. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |