| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
, A Novel Type I IFN, On Cytokine Production by Cells of the Innate Immune System
* Human Genome Sciences, Rockville, MD 20850; and
Istituto Dermopatico dell’Immacolata, Rome, Italy
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
is a recently identified type I IFN that exhibits both
structural and functional homology with the other type I IFN
subclasses. In this study, we have investigated the effect of IFN-
on cells of the innate immune system by comparing cytokine release
following treatment of human cells with either IFN- or two
recombinant IFN subtypes, IFN-
and IFN-
2a. Although IFN-2a
failed to stimulate monocyte cytokine secretion, IFN-, like
IFN-, induced the release of several cytokines from both
monocytes and dendritic cells, without the requirement of a
costimulatory signal. IFN- was particularly effective in inhibiting
inducible IL-12 release from monocytes. Unlike IFN-, IFN- did not
induce release of IFN-
by PBL. Expression of the IFN- mRNA was
observed in resting dendritic cells and monocytes, and it was
up-regulated by IFN- stimulation in monocytes, while IFN- mRNA
was minimally detectable under the same conditions. Monocyte and
dendritic cell expression of IFN- was also confirmed in vivo
in chronic lesions of psoriasis vulgaris and atopic dermatitis.
Finally, biosensor-based binding kinetic analysis revealed that
IFN-, like IFN-, binds strongly to heparin
(Kd: 2.1 nM), suggesting that the cytokine
can be retained close to the local site of production. The pattern of
cytokines induced by IFN- in monocytes, coupled with the unique
induction of IFN- mRNA by IFN-, indicates a potential role for
IFN- in the regulation of immune cell
functions. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
proteins, one IFN-, and one IFN-
have been identified.
Consequently, there is much discussion on the significance of the
existence of so many similar cytokines. The main question at issue is
whether their activity is redundant or they are characterized by unique
functions (6). Studies of the biological effects of
natural IFN subtypes have shown that their activities can vary greatly
(7, 8, 9, 10). IFN-8, for example, is the most potent
antiviral protein (11), while IFN- has a higher potency
in inhibiting the growth of certain tumors and is used in the treatment
of multiple sclerosis (12, 13, 14).
We recently reported the identification and preliminary biological
characterization of IFN-, a 180-aa human cytokine belonging to the
type I IFN family (15). The coding sequence of IFN-
does not have preferential homology with any of the other family
members found in humans, displaying 
30% homology to IFN-,
IFN-, or IFN-. It is characterized by the presence of an
additional cysteine at the C terminus following the four conserved
cysteines, and by an insertion of 12 amino acids between the C and D
region. Alignment of the type I proteins shows that IFN- has an
overall structure typical of the family. Molecular modeling of the
protein displays an organization consisting of five helices and
indicates that two disulfide bonds link the four conserved cysteines as
in the other family members. Although the IFN- gene is
located on the short arm of chromosome 9, where the other type I IFN
genes are located, it resides 6 Mb away from the cluster,
suggesting it evolved separately.
A distinguishing feature of IFN- is the detectable constitutive
expression of its transcript in uninduced cells, particularly
keratinocytes (15). The mRNA expression level of IFN-
can be up-regulated by viral infection, by other type I IFNs and,
characteristically, by IFN-. IFN- binds to the type I IFN
receptor complex, and such interaction induces signaling events typical
of the other type I IFNs, such as the activation of the IFN-stimulated
response elements. The previous study has also demonstrated that
IFN- can protect human cells of fibroblastic origin from infection
with two types of viruses, vesicular stomatitis virus and
encephalomyocarditis virus.
The current work was undertaken to evaluate the biological effects of
IFN- on cells of the immune system. In particular, because the
protein is up-regulated after viral challenge, we have focused our
attention on cells of the innate immunity, which represent the first
line of defense in pathological conditions.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Recombinant human IFN- was expressed and purified from
Escherichia coli, as described (15). The
endotoxin level in the preparation was <2 EU/mg of protein as
determined by the limulus amebocyte lysate method. Recombinant
human IFN-2a and IFN- purified from E. coli were
purchased from PBL Biomedical Laboratories (New Brunswick, NJ);
IFN-, IL-2, IL-4, and GM-SCF were obtained from PeproTech
(Rocky Hill, NJ); LPS, heparin, chondroitin sulfates A, B, and C, and
fucoidan were obtained from Sigma-Aldrich (St. Louis, MO). The
neutralizing mAbs 23738.111 (anti-IL-10), 1825.121
(anti-TNF-), and 24822.111 (anti-monocyte
chemoattractant protein
(MCP)2-1) were
purchased from R&D Systems (Minneapolis, MN). The mAbs specific for
IFN-, 20E07 and 17B09, were generated by the fusion of mouse myeloma
cells P3 x 63Ag8.653 with splenocytes from BALB/c mice immunized
with rIFN-.
Cell cultures
Monocytes were obtained from human PBMC by centrifugation of leukapheresis preparations (BRT, Baltimore, MD) through Histopaque (Sigma-Aldrich) gradients followed by counterflow centrifugal elutriation. Cell purity was >90%. Cells were cultured in complete medium consisting of RPMI 1640 medium (Life Technologies, Rockville, MD) supplemented with 10% heat-inactivated FBS, 2 mM L-glutamine, and 50 µg/ml gentamicin (Biofluids, Rockville, MD). In some experiments, monocytes were prepared by magnetic beads separation: PBMC were first depleted of plasmacytoid dendritic cells by direct magnetic labeling with anti-bromodichloroacetate-4 mAb-conjugated microbeads and a high-gradient magnetic cell sorting device (MiniMACS; Miltenyi Biotec, Auburn, CA). CD14+ cells were then isolated by two-step immunomagnetic cell sorting (MACS). Monocytes obtained by this procedure were >95% pure.
Monocyte-derived dendritic cells were obtained by culturing monocytes for 7–10 days in complete medium supplemented with 1% nonessential amino acids, 1% sodium pyruvate (Biofluids), 5 x 105 M 2-ME (Sigma-Aldrich), 50 ng/ml GM-CSF, and 20 ng/ml IL-4. Over 90% of the cells demonstrated by flow cytometry to express high levels of CD1a and low levels of CD14 and showed characteristic dendrite formations on examination with phase-contrast light microscopy.
Cytokine ELISAs
For measurement of the cytokines TNF-, IL-10, MCP-1,
macrophage-inflammatory protein (MIP)-1, or IFN-, monocytes
(1 x 106 cells/ml), dendritic cells
(0.5 x 106 cells/ml), or PBL (2 x
106 cells/ml) were cultured for 24 h with
complete medium alone or with varying concentrations of IFNs. For
measurement of IL-12 production, monocytes were incubated for 18 h
with IFN- (5 ng/ml) in the presence or absence of varying
concentrations of IFNs. LPS (100 ng/ml) was then added and the cells
were incubated for an additional 24 h. Cell-free supernatants from
the cultures were then harvested and stored at -20°C until use.
ELISAs were performed using kits obtained from BioSource International
(Camarillo, CA) according to the manufacturer’s instructions. The
ELISAs were comprised of a specific capture mAb immobilized on
plates, a specific biotinylated Ab as detector, and
streptavidin-conjugated peroxidase. Conversion of the substrate by the
enzyme was measured at 405 nm. Each value was calculated as the
mean ± SE of triplicate samples.
Immunohistochemistry
Punch skin biopsies were obtained after informed consent from
healthy adult volunteers (n = 2), and from adult
patients with chronic plaque psoriasis (n = 3) or
chronic atopic dermatitis (n = 3). Specimens were
embedded in OCT compound, frozen in liquid nitrogen, and stored at
-80°C until use. Four-micrometer cryostatic sections were fixed in
5% paraformaldehyde for 5 min, treated with 0.3% hydrogen peroxide to
quench endogenous peroxidase activity, incubated with normal horse
serum (Vectastain ABC kit; Vector Laboratories, Burlingame, CA) for 20
min, and finally permeabilized with 0.05% Triton X-100. Single
staining was performed with mAbs against IFN-, 20E07, or 17B09, (5
µg/ml), developed using the avidin-biotin-peroxidase system (Vector
Laboratories) and the 3-amino-9-ethylcarbazole substrate and
counterstained with hematoxylin. Double immunostaining was performed
with the same anti-IFN- mAbs and mAbs anti-CD1a (1:20) (BD
PharMingen, San Diego, CA), anti-CD14 (1:10), anti-CD3 (BD
Biosciences, Mountain View, CA), or anti-FVIII/vWF (1:25) (DAKO,
Glostrup, Denmark), using the avidin-biotin-peroxidase or
avidin-biotin-alkaline phosphatase system together with the chromogens
3-amino-9-ethylcarbazole and Blue Vector (Vector Laboratories) to
reveal the peroxidase and alkaline phosphatase activity, respectively.
No counterstain was applied. As negative control, primary mAbs were
omitted or replaced with an irrelevant isotype-matched mAb.
Heparin-binding ELISA
ELISA microplates (Maxisorp; Nalge Nunc International,
Naperville, IL) were coated with heparin-BSA conjugate (Sigma-Aldrich)
at 5 µg/ml in bicarbonate buffer (0.05 M sodium bicarbonate, pH 9.5)
overnight at 4°C and then blocked for 1 h with 1% BSA
(Sigma-Aldrich) in the same buffer. Serial dilutions of IFN- (250
ng/ml) were added to the wells in diluent buffer (PBS containing 0.1%
Tween 20 and 1% BSA) for 2 h at room temperature. Three
sequential steps followed with intervening wash steps with PBS 0.1%
Tween. First, detection of bound IFN- was achieved by adding an
affinity purified biotinylated rabbit polyclonal anti IFN--specific
Ab at 0.125 µg/ml for 1 h at room temperature. Peroxidase
streptavidin (Vector Laboratories) was then added at a dilution of
1/2000 in diluent buffer for 1 h. Finally,
tetramethylbenzidine substrate (Kirkegaard & Perry,
Gaithersburg, MD) was added and the incubation was continued for 20
min. Plates were read at 450 nm after stopping the reaction with
sulfuric acid. In some experiments, a competitive ELISA was used in
which IFN- (83.3 ng/ml) was preincubated for 2 h in the absence
or presence of varying concentrations of soluble competitors before the
addition of the mixture to the heparin-BSA coated plates.
BIAcore analysis
The technology uses surface plasmon resonance to measure changes in refractive index when a ligand binds to an immobilized moiety. Heparin-binding kinetic analysis was performed on a BIAcore 3000 (BIAcore, Piscataway, NJ). Two flow cells (high and low density surfaces) of a CM5 chip (BIAcore AB) were activated with a mixture of 0.4 M N-ethyl-N-(3 dimethyl-aminopropyl) carbo-diimide and 0.1 M N-hydroxysuccinimide at pH 8.0, after which streptavidin (Sigma-Aldrich) in 10 mM acetate buffer, pH 5.0, was injected. Unreacted groups were blocked with injection of 1 M ethanolamine at pH 9.0, followed by a single injection of 10 mM HCl. Biotinylated heparin-BSA (Sigma-Aldrich), resuspended in HBS-EP buffer (0.01 M HEPES, 0.15 M NaCl, 3 mM EDTA, and 0.005% surfactant P20, pH 7.4) with 0.2 M NaCl, was flowed over the surface to allow binding onto the streptavidin surface. Both flow cells were then conditioned with two wash steps with 10 mM HCl. The high and low density flow cells had net densities of 1000 and 300 resonance units, respectively. Kd determination was over a low density flow cell (16). For kinetic analysis, IFN test samples were dialyzed in HBS-EP and flowed over a low density surface at 25°C and a flow rate of 15 µl/min. The complexes were washed at 15 µl/min with HBS-EP to study the dissociation phase. The surface was regenerated using 10 mM glycine-HCl, pH 1.5, in the presence of 1.5 M NaCl. Background binding was subtracted by flowing the sample over a blank flow cell. For each IFN subtype, a complete set of sensorgrams was recorded with a series of different concentrations (range = 5–0.31 µg/ml). Sets of sensorgrams were analyzed with BIAevaluation Software, version 3.1 (BIAcore), provided with the instrument.
Quantitative PCR analysis
Total RNA (50 ng) was used in a one-step, 50 µl, quantitative
RT-PCR. As a control for genomic contamination, parallel reactions were
set up without reverse transcriptase. The abundance of specific mRNAs
was measured relative to 18S rRNA using the Applied Biosystems Prism
7700 Sequence Detection System. Reactions were conducted at 48°C for
30 min, 95°C for 10 min, followed by 40 cycles of 95°C for 15
s, 60°C for 1 min. Reactions were performed in triplicate. Using
Primer Express Software (Applied Biosystems, Foster City,
CA), primer and probe sets were designed to target the following
human sequences, where the gene named is followed by the sequences of
the two primers and then the probes: IFN-
(GCCCCAAGAGTTTCTGCAATAC, GGCCTGTAGGGACATTTCATAGA,
CAACCTATGAAGAGGGACATCAAGAAGGCC); IFN-
(GACATCCCTGAGGAGATTAAGCA,CTGGAGCATCTCATAGATGGTCAA,
CAGTTCCAGAAGGAGGACGCCGC); 18S (CGGCTACCACATCCAAGGAA,
GCTGGAATTACCGCGGCT, TGCTGGCACCAGACTTGCCCTC).
Probes were labeled at the 5'-end with the reporter dye 6-FAM and on
the 3'-end with the quencher dye TAMRA (BioSource International). The
mRNA level of IFN- or IFN- in each sample, determined in
triplicate, are expressed as the mean level and SD relative to the 18S
ribosomal RNA level (endogenous reference).
Statistical analysis
The statistical significance of differences among groups was analyzed using the unpaired, two-tailed Mann-Whitney test.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The production of cytokines by phagocytic cells at the onset of
infections initiates a series of events leading to the activation of
the other effector populations of the immune system. In our study, we
examined the effect of IFN-, IFN-2a and IFN- on cytokine
release by human monocytes. The other two IFNs were chosen because they
are subtypes currently in clinical use (17, 18) and are
highly effective in inhibiting viral infection and cell proliferation.
Monocytes were purified from peripheral blood and cultured at a
concentration of 1 x 106 cells/ml for 1 day
in the presence of recombinant IFN-, IFN-2a, or IFN- (Fig. 1
). Both IFN- and IFN- were able to
induce release of TNF- even in the absence of a costimulus, such as
IFN- that is often required in this experimental system. In
contrast, IFN-2a was ineffective in promoting TNF- release. To
avoid that plasmacytoid dendritic cells present in the elutriated
monocytes (in average <1%) would account for the observed cytokine
release, in several experiments monocytes were purified using magnetic
separation. Plasmacytoid dendritic cells were first completely removed
from the PBMC using blood dendritic cell Ag-4 mAb-conjugated
microbeads (19) followed by immunomagnetic enrichment of
CD14+ cells. The resulting cell preparations
(>95% monocytes) released TNF- following stimulation with IFN-
and IFN-, as observed with the donor reported in Fig. 1B.
Cytokine release following IFN- incubation was consistently observed
in all donors tested (n = 10); however, the
concentration of cytokine detected in the conditioned media was
donor-dependent. For example, following treatment with 100 ng/ml, cells
from the donors reported in Figs. 1A and
2A released 166 and 423 ng/ml
of TNF-, respectively. IFN- strongly synergized with IFN- to
stimulate TNF- release when the two factors were simultaneously
added to the cultures (Fig. 2B). In contrast, IFN- did
not increase LPS-induced cytokine release (Fig. 2C).
Chemokines, such as MCP-1 and MIP-1, were found to be up-regulated
in IFN--stimulated monocytes (Table I). Interestingly, IL-10 production was
strongly induced by the novel IFN, with an increase up to 40-fold.
|
|
|
Among cytokines produced by monocytes, IL-12 plays an important
role in immunoregulation, being an inducer of IFN- and a generator
of Th1 T cell responses. IL-12 production is therefore normally tightly
regulated. The ability of IFN- to modulate its release was
examined. To obtain release of IL-12 from human monocytes, the
stimulation protocol described by Hayes et al. (20) was
used. Freshly isolated monocytes were cultured overnight with IFN-
in the presence of either IFN- or IFN-, with LPS then added to
the cultures for an additional 24 h. In the donor reported in Fig. 3A, cell stimulation induced
the release of 2231 pg/ml of IL-12, which was inhibited by IFN- in a
concentration-dependent manner. A consistent pattern of inhibition of
inducible IL-12 release was observed in all the donors
(n = 7), and the level of reduction observed with
IFN- was greater than that observed with IFN-.
|
treatment to suppress IL-12 release is dependent
on IL-10 release because it could be blocked by an IL-10-specific mAb
(Fig. 3
B and Table II). To
determine whether other cytokines produced by monocytes, such as
TNF- or MCP-1, participate in the observed inhibitory activity
(21, 22), neutralizing mAbs against TNF- or MCP-1 were
added to the experimental system (Table II). Anti-IL-10 mAb completely
abolished the inhibitory effect of 10 ng/ml IFN- and partially
inhibited the effect of 100 ng/ml. Anti-TNF- or MCP-1 mAbs partially
blocked the inhibitory effect of 10 ng/ml IFN-, but did not have any
effect in neutralizing the activity of 100 ng/ml IFN-. When the
neutralizing mAbs against TNF- and MCP-1 were used together with the
anti-IL-10 mAb to block the activity of 100 ng/ml IFN-, no
additive neutralizing effect was observed.
|
IFN- activity was then analyzed on dendritic cells. As with
monocytes, a direct stimulation of cytokine release was mediated by
IFN- (Fig. 4). Significant levels of
TNF- and IL-10 were detected in the supernatants following culture
for 1 day. In addition, IFN-, like IFN-, enhanced the expression
of Ags correlated with activation and increased Ag-presenting capacity,
such as MHC class II and CD54 (data not shown). Contrary to the
experiments with monocytes, we did not observe inhibition of IL-12
production from LPS-stimulated dendritic cells (data not shown).
Interestingly, McRae et al. (23) have reported that, on
dendritic cells, type I IFNs inhibited IL-12 production induced by CD40
ligation, but not by LPS stimulation.
|
release
Having established a modulatory activity of IFN- on cytokine
release in monocytes, we explored the effect of type I IFNs on IFN-
release from PBL (Fig. 5A). In
four donors, IFN- induced a strong dose-dependent release of
IFN-, while IFN- produced a minimal effect only at 300 ng/ml
(p < 0.001 IFN- vs IFN- treatment). To
define the population responsible for the release of IFN- following
stimulation with the two type I IFNs, PBL from four additional donors
were depleted of T cells using CD3-conjugated magnetic beads (following
separation, T cell content <2%, NK content >30%). The resulting
cell populations enriched for NK cells were stimulated with IFN- or
IFN-. As observed in the previous experiments, IFN- strongly
induced IFN- release and IFN- did not have effect (Fig. 5B). However, IFN- was able to increase NK cytotoxic
activity of PBL, although at a lower level than IFN- or IFN-2a
(not shown).
|
expression in myeloid cells
Previously, we demonstrated that the IFN- mRNA is present in
unstimulated keratinocytes and is inducible by stimulation with a
variety of factors, including type I and type II IFNs
(15). The aim of the next series of experiments was to
determine whether IFN- could also up-regulate IFN- expression in
monocytes, known to be a source of IFN- following viral or
bacterial challenge. Quantitative PCR analysis was conducted with mRNA
from peripheral blood monocytes, freshly purified or following
treatment with IFN-. As shown in Fig. 6A, donor no. 1 and no. 2,
IFN- mRNA was found in resting monocytes (expression ratios,
relative to 18S RNA, 1.1 and 1.9 x 10-5
respectively). Transcript concentrations were enhanced by treatment
with IFN- and the increase was dependent on the time of incubation
with the cytokine reaching a maximum level at 12–24 h. At 48 h of
stimulation, mRNA expression declined to the level found in
unstimulated cells. The up-regulation observed was IFN--specific
because very low levels of IFN- mRNA were observed in the monocytes,
resting or IFN--stimulated. Plasmacytoid dendritic cells, also
called type 2 predendritic cells or plasmacytoid T cells, constitute a
subset of immature dendritic cells present in very low numbers in human
peripheral blood and have the capacity of producing a large amount of
IFN- in response to viral stimulation. To eliminate the
possibility that the minimal contamination of plasmacytoid dendritic
cells in the elutriated monocytes could account, at least partially,
for the IFN- transcript, monocytes were also prepared by
immunomagnetic cell sorting. PBMC were completely depleted of
BDCA-2+ cells (24) and then were
positively selected for CD14 binding. Monocytes obtained from three
donors showed constitutive levels of IFN- (mean expression
ratio = 2.7 x 10-5 ± 1.8) and it was
inducible by IFN- treatment. A representative donor (donor no. 3) is
shown in Fig. 6A.
|
mRNA was also found in monocyte-derived dendritic cells (mean
expression ratio = 4.6 x 10-5 ± 2.2
in four donors), while IFN- mRNA was minimally detectable (mean
expression ratio = 0.3 x 10-5 ± 0.3)
in two of four donors (Fig. 6B). However, in this cell type
treatment with IFN- did not significantly enhance the level of the
transcript (not shown).
Expression of IFN- in inflamed human tissues
To test whether IFN- is expressed in vivo at inflammatory sites
rich in monocytes and dendritic cells, skin lesions from patients with
psoriasis or atopic dermatitis were assayed for IFN-
immunoreactivity. Normal skin from healthy subjects showed only
scattered IFN--positive cells in the dermis (Fig. 7A). In contrast, numerous
IFN--positive cells were observed in sections from psoriasis and
atopic dermatitis, in both the epidermis and dermis (Fig. 7, B and C). In particular, double-staining showed
that the cells expressing IFN- were mostly
CD14+ monocytes and part of
CD1a+ dendritic cells in both diseases (Fig. 7, D and E, and G and
H). IFN- was also expressed by basal and suprabasal
keratinocytes, with the positivity localized along the cell membrane of
these cells, in their cytoplasm and in the intercellular spaces.
Finally, anti-IFN- mAb reacted with the majority of
FVIII+ venules localized in both the superficial
and reticular dermis but not with CD3+ T
lymphocytes (Fig. 7, F and I).
|
is a heparin-binding protein
The intriguing observation of IFN- constitutive expression in
keratinocytes (15) suggests that this IFN may have a local
function in the epidermis. To determine whether IFN- can be retained
at its site of production through interaction with the
glycosaminoglycans present in many tissues, we developed an ELISA-based
assay to measure IFN- binding to heparin. As shown in Fig. 8A, dose-dependent binding of
IFN- to the heparin-BSA complex was observed. The binding is
detected with high sensitivity because it was readily observed with as
little as 1 ng of IFN-. In competition experiments, heparin and
fucoidan, a nonmammalian polysaccharide, strongly inhibited
interaction, while chondroitin sulfate A and B were very weak
inhibitors, and chondroitin sulfate C was ineffective (Fig. 8B). Surface plasmon resonance (BIAcore analysis) allowed
the determination of the affinity binding. Biotinylated heparin-BSA was
immobilized on a streptavidin-activated sensor chip and then IFN-
was injected over the heparin-BSA surface. A typical sensorgram was
obtained (Fig. 9A) with an
association phase and, when IFN- was replaced by running buffer
alone, a dissociation phase. Similar sensorgrams were obtained with
IFN- (Fig. 9B) and IFN- (not shown). The
heparin-binding affinity values of the two type I IFNs were similar:
2.1 nM and 1.4 nM for IFN- and IFN-, respectively. On the
contrary, IFN-2a showed a minimal binding to heparin (not shown).
The affinity value for IFN-, 1.1 nM, was within the range of
previously published results (25).
|
|
and IFN-, are heparin-binding
proteins. IFN- binding is specific because no interaction with other
glycosaminoglycans, such as chondroitin sulfate C, was observed. The
strong competing effect of fucoidan was observed also in other
studies of heparin-binding proteins and is believed to be due to the
highly sulfated and branched structure of the polymer
(26). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, a newly identified subclass of human type I IFN. The
functional profile of the cytokine resembles that of IFN- more than
that of IFN-2a, one of the IFN- subclasses. Like IFN- but in
contrast to IFN-2a, IFN- is able to directly modulate cytokine
release from monocytes and dendritic cells, and to strongly bind
heparin. However, IFN- did not stimulate IFN- release from NK
cells.
Two distinct receptor subunits for type I IFNs have been identified,
IFN- receptor (IFNAR)-1 and IFNAR-2 (reviewed in Refs.
27 and 28). IFNAR-1 has an important role in
signal transduction, whereas IFNAR-2 seems to be the major
ligand-binding component. Although all the type I proteins, including
IFN- (15), bind to the same receptor complex, there is
much experimental evidence demonstrating that the interactions with the
receptor or the induction of signaling pathways can vary, thus
influencing the biological responses (9, 29, 30, 31, 32). The
large differences observed in the immunological activities of IFN
subspecies are suggestive of specific functions characterizing the
different cytokines (7). Our results indicate that
IFN-2a does not have the same modulatory activity on monocytes that
IFN- and IFN- do. In addition, the effect of IFN- on
monocytes, qualitatively similar to that of IFN-, raises the
possibility that this novel IFN shares with IFN- the binding sites
and/or the signaling pathways regulating the monocytic response.
Of particular interest is the ability of IFN- to mediate a
strong increase in IL-10 release and a concomitant inhibition of
inducible IL-12 release. The decrease in IL-12 level was found to be
IL-10-dependent, as demonstrated by the blocking activity of an
IL-10-neutralizing Ab. There are conflicting reports of the role of
type I IFNs on IL-12 production. IFN- and IFN- were found to
increase IL-12 mRNA in human macrophages (4) and
up-regulate the expression of the IL-12R 2 chain in
CD4+ T cells (33). However in other
studies, type I IFNs suppressed IL-12 production in a mixed leukocyte
population and in dendritic cells (23, 34). Further
support for an inhibitory role of class I IFNs comes from in vivo
studies. In virally infected mice, endogenously expressed IFN-
inhibited the ability of LPS to induce IL-12, while neutralization of
IFN- enhanced IL-12 and IFN- production (34).
Lastly, Wang et al. (35) demonstrated that IFN-
inhibits IL-12 production in Staphylococcus aureus
Cowan- plus IFN--stimulated human PBMC in an IL-10-dependent
mechanism. In this study, the authors did not observe enhancement by
IFN- of basal IL-10 production in monocytes and suggested that the
IFN- effect was mediated by inhibition of IFN- priming. In our
experiments, IFN- directly induced IL-10 release from monocytes in
the absence of other stimulatory factors, such as LPS/S.
aureus Cowan or IFN-.
Our findings suggest a potential therapeutic use of IFN- for
autoimmune disorders in which the pathogenesis is linked to an
overproduction of IL-12, including multiple sclerosis, rheumatoid
arthritis, insulin-dependent diabetes, and experimental colitis. It has
been shown that decreased levels of IL-10 and increased IL-12 mRNA in
cells of multiple sclerosis patients are associated with disease
progression (36). IFN- is, indeed, an approved therapy
for this disease and was found able to slow disease progression and
reduce relapses (13, 14). IFN- might also be beneficial
in the treatment of inflammatory syndromes, such as sepsis, where IL-10
plays a down-regulatory role and IL-12 has the opposing effect
(37, 38). These potential therapeutic indications are
further supported by the very low stimulatory effect of IFN- on
IFN- release from PBMC. IFN- is a principal player in the
regulation of both autoimmune and inflammatory disorders, thus a low
level of IFN- secretion might benefit such disease states.
Another interesting characteristic of IFN-, shared with IFN-, is
the high-affinity interaction with heparin. Numerous growth factors,
chemokines, and cytokines bind to heparin or heparan sulfates,
including IFN-, TGF-1, IL-8, IL-2, the p40 subunit of IL-12, and
IL-10 (25, 39, 40, 41, 42, 43). Due to the highly acidic property of
heparin, it is believed that clusters of basic amino acids in the
cytokine sequences promote the interaction with glycosaminoglycans
(44). The sequence of IFN- does not display clusters of
arginines and lysines in the primary sequence. However, it is possible
that the folding of the protein in the secondary structure brings into
proximity discontinuous basic residues. For example, a single amino
acid mutation in the sequence of MIP-1 abolished the
glycosaminoglycan binding activity of the chemokine (45).
The binding of the two cytokines, IFN- and IFN-, to
polysaccharides is likely to keep them close to the production site and
to stimulate antiviral and immune responses focused at the local site
of infection.
A distinct property of IFN- is that its transcript is readily
induced by type II IFN. Monocytic cells are among the main producers of
type I IFNs following viral challenge or stimulation with bacterial
endotoxin. Although secretion of IFN- was observed in murine
peritoneal macrophages treated with IFN- (46), it was
shown that freshly isolated human monocytes did not produce type I IFNs
in response to single IFN- or LPS stimulation, but needed to be
primed by either IFN- or GM-CSF (47). In agreement with
these results, we have demonstrated by quantitative RT-PCR analysis
that human monocytes and dendritic cells have a very low or
undetectable level of IFN- mRNA that is not inducible by IFN-
treatment alone. On the contrary, a significantly higher constitutive
level of IFN- mRNA was observed in the cells. Moreover, the
expression was inducible in monocytes by IFN- treatment. The
presence of IFN- in monocytes and dendritic cells was confirmed in
vivo in the skin affected by psoriasis or atopic dermatitis.
In conclusion, our findings suggest that IFN- may play a role in the
regulation of systemic or local immune functions through its effect on
cells of the innate immune system. The enhancement of IFN-
expression by IFN- could be a negative feedback mechanism to
suppress further activation of T lymphocytes and NK cells via
enhancement of IL-10 and inhibition of IL-12 release in accessory
cells. To completely define the function of IFN- in the immune
system, the effect of this cytokine on the cells regulating adaptive
immunity needs to be characterized.
|
Acknowledgments |
|---|
and Dr. Viktor Roschke for providing the mAbs
anti-IFN-. We thank Tatiana Tsareva, Don Mather, and Victor Kao
for technical help. |
Footnotes |
|---|
2 Abbreviations used in this paper: MCP, monocyte chemoattractant protein; MIP, macrophage-inflammatory protein; IFNAR, IFN- receptor.
Received for publication December 21, 2001. Accepted for publication September 4, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and type I interferons explored by mutational analysis. J. Biol. Chem. 273:8003. species and hybrid proteins. Semin. Oncol. 24:(Suppl. 9):4.
subtypes: IFN-8 has very high antiviral potency. J. Interferon Cytokine Res. 16:1027.[Medline]
but not interferon- on human glioma cells: correlation of receptor binding, 2',5'-oligoadenylate synthetase and protein kinase activity. J. Interferon Res. 10:141.[Medline]
-1b Multiple Sclerosis Study Group. 1993. Interferon -1b is effective in relapsing-remitting multiple sclerosis. Neurology 43:655.-1a for disease progression in relapsing multiple sclerosis. Ann. Neurol. 39:285.[Medline]
, a novel type I IFN expressed in human keratinocytes. J. Biol. Chem. 276:39765.-interferons: 40th anniversary of the discovery of interferons. Cancer Res. 58:2489.-1a on immunosuppressive cytokines in multiple sclerosis. Neurology 50:1294. of LPS-inducible p35 and p40 genes. Blood 86:646. differentially regulates CD40-induced cytokine secretion by human dendritic cells. J. Immunol. 164:23./ induction. J. Exp. Med. 194:1823. to heparan sulfate is restricted to the heparin-like domains and involves carboxylic- but not N-sulfated groups. Biochim. Biophys. Acta 1117:126.[Medline]
requires components of T-cell receptor signaling. Nature 390:629.[Medline]
L subunit of the type I interferon (IFN) receptor determines signaling specificity for IFN-2 and IFN-. J. Biol. Chem. 273:3144. and interferons. J. Mol. Biol. 282:585.[Medline]
/ inhibition of interleukin-12 and interferon- production in vitro and endogenously during viral infection. Proc. Natl. Acad. Sci. USA 94:634.-1b inhibits IL-12 production in peripheral blood mononuclear cells in an IL-10-dependent mechanism: relevance to IFN--1b therapeutic effects in multiple sclerosis. J. Immunol. 165:548. production and lethality in LPS-induced shock in mice. Eur. J. Immunol. 25:672.[Medline]
1 is a heparin binding protein: identification of putative heparin-binding regions and isolation of heparins with varying affinity for TGF-1. J. Cell. Physiol. 152:430.[Medline]
. J. Immunol. 163:2120. interferon induce transcription of interferon mRNA and interferon secretion in murine macrophages. J. Virol. 63:2785.This article has been cited by other articles:
|
|
 |
|
  H. Qiu, Y. Fan, A. G. Joyee, S. Wang, X. Han, H. Bai, L. Jiao, N. Van Rooijen, and X. Yang Type I IFNs Enhance Susceptibility to Chlamydia muridarum Lung Infection by Enhancing Apoptosis of Local Macrophages J. Immunol., August 1, 2008; 181(3): 2092 - 2102. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Kuwashima, F. Nishimura, J. Eguchi, H. Sato, M. Hatano, T. Tsugawa, T. Sakaida, J. E. Dusak, W. K. Fellows-Mayle, G. D. Papworth, et al. Delivery of Dendritic Cells Engineered to Secrete IFN-{alpha} into Central Nervous System Tumors Enhances the Efficacy of Peripheral Tumor Cell Vaccines: Dependence on Apoptotic Pathways J. Immunol., August 15, 2005; 175(4): 2730 - 2740. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Gautier, M. Humbert, F. Deauvieau, M. Scuiller, J. Hiscott, E. E.M. Bates, G. Trinchieri, C. Caux, and P. Garrone A type I interferon autocrine-paracrine loop is involved in Toll-like receptor-induced interleukin-12p70 secretion by dendritic cells J. Exp. Med., May 2, 2005; 201(9): 1435 - 1446. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 |
) or IFN-
) in each sample were
determined by quantitative RT-PCR in triplicates, as reported in
Materials and Methods, with the mean level of and SD
expressed relative to the 18S ribosomal RNA level.
