|
|
||||||||
Cutting Edge |

* Division of Viral and Rickettsial Diseases, Centers for Disease Control and Prevention, Atlanta, GA 30333; and
Department of Pathology, Emory University, Atlanta, GA 30322
| Abstract |
|---|
|
|
|---|
when stimulated with known ligands for TLR1 and 2, 2 and
6,TLR3, TLR4, TLR5, and TLR9 when compared with those from young mice.
These results support the concept that increased susceptibility to
infections and poor adaptive immune responses in aging may be due to
the decline in TLR expression and function. | Introduction |
|---|
|
|
|---|
65 years (7). Age-related changes
in the adaptive immune system are well-documented and include
diminished and/or altered cytokine patterns, reduction in clonal
expansion and function of Ag-specific T and B cells and a decline in
Ag-presenting cell function (1, 2, 8, 9). The decline in
adaptive immune function leads to decreased efficacy of preventive
vaccination in the elderly. In the case of influenza, although the
vaccine is
7090% effective in preventing illness in healthy
younger adults, it is only 3040% effective in preventing
influenza-like illness in frail elderly individuals (4).
The reduced efficacy of influenza vaccines in the elderly is likely, at
least in part, due to reduced immune responses to vaccination. As the thymus atrophies with age, there are fewer naive T cells available to respond to new pathogens and neoantigens. This shift from naive to memory cells also causes a shift in the cytokine environment. The expression of cell adhesion molecules on APCs and T cells from the aged declines, possibly contributing to immune dysfunction. Humoral immunity also exhibits changes with age, but to a lesser extent, particularly the diminished ability to generate high-affinity protective Abs against infectious agents. It has been suggested that this may be due to inefficient somatic hypermutation in the V gene segments of the Abs, inefficient help by aged Th cells, and the altered cytokine environment.
Similar to the decline in adaptive immune function, the functions of NK cells, macrophages, and neutrophils, crucial cellular components of innate immunity, are decreased with aging (10, 11, 12, 13). In the aged mouse, alveolar macrophages are decreased in number and are not efficient at presenting Ags to T cells, and more macrophages are needed to effectively activate a T cell (5). Neutrophils have impaired chemotaxis, degranulation, and phagocytosis. Because macrophages, NK cells, and neutrophils provide the first line of defense against bacterial and viral infections, the decline in function could possibly explain the increased incidence of bacterial and viral pneumonias and gastrointestinal and skin infections in the aged as well as diminished protective immune responses to pneumococcal and influenza vaccines.
This first line of defense is accomplished through evolutionarily
conserved sets of molecules, namely Toll-like receptors
(TLR)2 that recognize
conserved molecular patterns associated with pathogens. Microbes,
microbial products, and pharmaceuticals that are ligands for TLR2, 3,
4, 5, 6, 7 and 9 have been identified (14, 15, 16, 17). Ligands
for TLR1 and 2, and 2 and 6, are Gram-positive bacteria and yeast cell
wall components, while the predominant Gram-negative bacterial product,
LPS, is a ligand for TLR4. Recent reports have also documented that
dsRNA (poly I:C), bacterial flagellin, immiquimod, and CpG
oligodeoxynucleotides (ODN) are ligands for TLR 3, 5, 7, and 9,
respectively. The interaction between a TLR and its ligand results in
the secretion of anti-bacterial peptides, defensins, and
proinflammatory cytokines such as TNF-
and IL-6, which initiate an
inflammatory response to clear the invading organism. Furthermore, the
inflammatory response results in the recruitment of cells of adaptive
immunity to initiate clearance of the pathogens by generating a
specific immune response. Hence, defects at the level of expression and
function of TLRs with aging could contribute to poor recruitment of
APCs, and T and B cells at the site of inflammation, resulting in
suboptimal adaptive immune responses leading to increased incidence of
illness and complications from infection. To address this, we examined
the expression of all known murine TLRs (TLR 19) on splenic
macrophages and thioglycollate-elicited peritoneal macrophages from
young and aged mice by real-time RT-PCR. These macrophages were
cultured with microbial products that interact with TLR2, TLR3, TLR4,
TLR5, and TLR9 to investigate changes in function with age. We show
that macrophage TLR expression and function decline with aging, which
may impact both the quality and the magnitude of both innate and
adaptive immunity.
| Materials and Methods |
|---|
|
|
|---|
Young (23 mo old) and aged (1824 mo old) female C57BL/6 mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and the National Institute of Aging (Bethesda, MD), respectively, and were maintained in an environmentally controlled facility.
Isolation of splenic and thioglycollate-elicited peritoneal macrophages
Splenic macrophages were isolated by incubating spleen cells at 3 x 106 cells/ml in a final volume of 15 ml in tissue culture-treated Petri plates for 90 min at 37°C with 5% CO2. Nonadherent cells were removed and the plates were washed twice with complete medium (DMEM (Life Technologies, Grand Island, NY) containing 100 U/ml penicillin, 100 µg/ml streptomycin, 1 mM glutamine, and 5% FBS (HyClone Laboratories, Logan, UT)). To induce activated peritoneal macrophages, 1 ml of 3% thioglycollate (Difco, Irvine, CA) was injected i.p. into young or aged mice. Five days later, peritoneal exudate cells, consisting mostly of macrophages (over 90%), were collected in 10 ml of PBS. Macrophages were washed with complete medium. Nonadherent cells were removed by incubating the cell suspensions for 90 min at 37°C with 5% CO2. The purity of macrophage preparations was assessed by flow cytometry using allophycocyanin-conjugated anti-mouse CD11b (Mac-1) mAb (BD Biosciences, San Diego, CA). Cell surface expression of TLR4 was assessed with PE-conjugated mAb against murine TLR4 (e-Bioscience, San Diego, CA).
TLR expression by real-time RT-PCR
RNA was isolated with Tri-Reagent (Sigma-Aldrich, St. Louis, MO)
from splenic macrophages and thioglycollate-elicited peritoneal
macrophages. RNA samples were quantified by spectrophotometric analysis
and were treated with DNase before cDNA synthesis with amplification
grade deoxyribonuclease I (Invitrogen, Carlsbad, CA), according to the
manufacturers instructions. cDNA synthesis was performed with 1 µg
of total RNA using 1.6 µg oligo(dT)15 primer, 20 nM of each dNTP, and
1x reaction buffer (all from Roche, Indianapolis, IN) in a final
volume of 20 µl. cDNA reactions were incubated at 70°C for 10 min
to denature the RNA template and were quench-cooled for 5 min. AMV
reverse transcriptase (40 U) was added and reactions were incubated at
42°C for 60 min. cDNA reactions were diluted 1/10 and 2 µl of the
diluted cDNA reaction was added to a 18-µl Light Cycler PCR
containing 0.5 µM of each primer (Table I
), 1x Light Cycler-Fast Start DNA
Master SYBR-Green mix containing Fast Start Taq polymerase
and appropriate MgCl2 (Table I
). Reactions were
conducted in glass capillaries (Roche) in the Light-Cycler instrument
(Roche), subjected to a 10-min initial hot-start activation of the
Taq polymerase at 95°C, followed by 40 cycles of
amplification (95°C for 10 s, 56°C for 5 s, and 72°C
for 10 s). The correct size of the amplified PCR products (Table I
) was confirmed by gel electrophoresis. Amplification of accurate
targets was confirmed by sequence analysis. For real-time analysis,
samples were quantified by a standard curve generated by amplifying
three serial dilutions in duplicate of each cDNA template with GAPDH
primers as listed in Table I
and the same reaction conditions as
described above. Relative units were determined by generating a GAPDH
curve, amplifying three serial 10-fold dilutions from 2 µl of the
diluted cDNA and allowing the software to accurately determine the
relative units of expression for each of the TLRs amplified as compared
with the GAPDH curve. Removal of contaminating DNA was verified by
adding 2 µl of diluted RNA before cDNA synthesis to an 18-µl Light
Cycler PCR containing GAPDH primers.
|
One million cells, from the same populations used for the RNA
extraction as described above, were stimulated in a 24-well plate in a
final volume of 2 ml with 200 ng of LPS (Sigma-Aldrich), 200 µg of
poly(I:C) (Sigma-Aldrich), 3 x 106
BioParticles of zymosan A (Saccharomyces cerevisiae),
3 x 106 BioParticles of
Staphylococcus aureus (both from Molecular
Probes, Eugene, OR), 20 µg of ODN control (TCCATGAGCTTCCTGATCCT),
ODN containing CpG motifs (TCCATGACGTTCCTGACGTT) obtained from GENSET
(La Jolla, CA), or 1 µg of flagellin from
Salmonella typhimurium (18).
The optimum dose for each ligand indicated above was determined in a
dose-response study to ensure that it is the TLR expression that is
limiting but not the ligand. Cultures were incubated at 37°C with 5%
CO2 for 48 h. Supernatants were collected
and IL-6 and TNF-
levels were determined by ELISA using OptiEIA kits
(BD PharMingen, San Diego, CA).
| Results and Discussion |
|---|
|
|
|---|
Splenic macrophages and thioglycollate-elicited macrophages from young
and aged C57BL/6 mice, which were over 90% pure based on FACS
analysis, were used to assess the expression of TLRs 19 by RT-PCR as
described in Materials and Methods.
TLR and GAPDH PCR products were amplified
and confirmed by gel electrophoresis (Fig. 1
) and sequence analysis.
Fig. 2
shows the relative units of
expression of splenic and thioglycollate-elicited macrophages from
young and aged mice relative to GAPDH determined by the Light
Cycler.
|
|
|
B activation and
proinflammatory cytokine secretion by MyD88-dependent and -independent
pathways. To correlate the expression of TLRs with function,
macrophages from aged and young mice were activated with ligands for
TLR1 and 2, TLR2 and 6, TLR3, TLR4, TLR5, and TLR9 and their function
was assessed by measuring the proinflammatory cytokines, IL-6 and
TNF-
. As shown in Table II
|
production was also
observed from aged splenic macrophages, with responses to LPS
(1.4-fold), poly(I:C) (2.5-fold), CpG ODN (6.3-fold), S.
aureus (2.1-fold), and zymosan A (3.3-fold). Similar to splenic
macrophages, TLR5 ligation with flagellin did not result in TNF-
secretion suggesting that either surface expression of TLR5 was
below the activation threshold and/or poor expression of
other cell surface molecules that play a major role in TLR5
function. Thioglycollate-elicited macrophages from aged mice secreted
significantly less TNF-
in response to LPS (5.6-fold),
poly(I:C) (3.3-fold), zymosan A (2.7-fold), flagellin (6.2-fold), CpG
ODN (3.1-fold), and S. aureus (1.4-fold) stimulation. These
data indicate that proinflammatory cytokine responses decline with
aging when TLR2, 3, 4, 5, and 9 on splenic or thioglycollate-elicited
macrophages are stimulated with their ligands. TNF-
enhances class I
and class II MHC expression and decreased levels in aging could affect
Ag processing and presentation, thus affecting T cell responses
(22). Reduced TNF-
levels in aging may also contribute
to reduced phagocytic activity, reduced NO, reduced tumor cell killing,
and delayed tissue repair process. Decreased expression and function of various TLRs may predispose the elderly to various bacterial and yeast infections. Due to the decline in proinflammatory cytokines, the cardinal signs of inflammation such as fever are absent in the elderly patients. Hence, the increased mortality rates are attributed to lack of presentation of clinical signs at the onset of infection due to poor inflammatory response. S. aureus is the fourth most common pathogen and one of the top 10 causes of death in persons aged >65 years. In addition, the elderly are also highly susceptible to pneumonia and soft tissue infections caused by S. aureus (23). The results of this study indicate that decreased expression and function of TLRs 1, 2, and 6, when ligated with S. aureus contribute to enhanced susceptibility of the elderly to S. aureus infections. Furthermore, decreased function of TLR 2 when ligated with zymosan A (yeast) may help to explain the enhanced susceptibility to infection with C. albicans, Cryptococcus neoformans, Coccidioides immitis, and Aspergillus fumigatus in the elderly individuals (24, 25). The reduced function of macrophages in response to LPS from Escherichia coli used in the current study and LPS from other Gram-negative bacteria which trigger TLR4, may also explain why the elderly are highly susceptible to urinary tract infections caused by E. coli, and Proteus, Klebsiella, and Enterobacter species. The poor inflammatory response induced by the macrophages from the aged mice when stimulated TLR5 through the ligation by flagellin from S. typhimurium coupled with poor responses with LPS may explain why the aged mice and elderly humans are highly susceptible to enteric infections caused by E. coli, and Salmonella, Shigella, and Enterobacter species (26, 27). dsRNA (poly(I:C)) has been shown to be a ligand for TLR3 and poly(I:C) has been used to stimulate NK cells. The decline in TLR3 may be contributing to decreased NK cell function in aging and predisposes the elderly to viral, and intracellular, bacterial infections. An altered cytokine pattern with a bias toward Th2 is a hallmark of aging. Bacterial DNA containing CpG sequences has been shown to interact with TLR9 and induces a Th1 response (Refs. 1 , 2 , and 14 and unpublished results). Hence, reduced expression and function of TLR9 on aged macrophages could be responsible for the altered priming/recall microenvironment resulting in a Th2 bias in aging. Reduced expression and function of TLRs with aging thus impacts both the quality and magnitude of host innate and adaptive immune responses to bacterial and fungal infections by the altered inflammatory and priming environment. Hence, modulation of innate immunity through the up-regulation of TLR expression and function may be important for successful therapeutic and preventive immune intervention strategies for the elderly.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Abbreviations used in this paper: TLR, Toll-like receptor; ODN, oligodeoxynucleotide. ![]()
Received for publication May 28, 2002. Accepted for publication August 27, 2002.
| References |
|---|
|
|
|---|
B by Toll-like receptor 3. Nature 413:732.[Medline]
production in rat macrophages. J. Immunol. 16:3468.
This article has been cited by other articles:
![]() |
S. L. Swain and J. Nikolich-Zugich Key Research Opportunities in Immune System Aging J Gerontol A Biol Sci Med Sci, February 27, 2009; (2009) gln068v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-C. Chiu, V. R. Stolberg, and S. W. Chensue Mononuclear Phagocyte-Derived IL-10 Suppresses the Innate IL-12/IFN-{gamma} Axis in Lung-Challenged Aged Mice J. Immunol., September 1, 2008; 181(5): 3156 - 3166. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-F. Kong, K. Delroux, X. Wang, F. Qian, A. Arjona, S. E. Malawista, E. Fikrig, and R. R. Montgomery Dysregulation of TLR3 Impairs the Innate Immune Response to West Nile Virus in the Elderly J. Virol., August 1, 2008; 82(15): 7613 - 7623. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bujak, H. J. Kweon, K. Chatila, N. Li, G. Taffet, and N. G. Frangogiannis Aging-Related Defects Are Associated With Adverse Cardiac Remodeling in a Mouse Model of Reperfused Myocardial Infarction J. Am. Coll. Cardiol., April 8, 2008; 51(14): 1384 - 1392. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Albert and J. S. Marshall Aging in the absence of TLR2 is associated with reduced IFN-{gamma} responses in the large intestine and increased severity of induced colitis J. Leukoc. Biol., April 1, 2008; 83(4): 833 - 842. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-C. Chiu, V. R. Stolberg, C. M. Freeman, and S. W. Chensue Mononuclear Phagocyte-Derived Interleukin-10 Suppresses the Innate Pulmonary Granuloma Cytokine Response in Aged Mice Am. J. Pathol., September 1, 2007; 171(3): 829 - 837. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Agrawal, S. Agrawal, J.-N. Cao, H. Su, K. Osann, and S. Gupta Altered Innate Immune Functioning of Dendritic Cells in Elderly Humans: A Role of Phosphoinositide 3-Kinase-Signaling Pathway J. Immunol., June 1, 2007; 178(11): 6912 - 6922. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Blaise, N. Vey, C. Faucher, and M. Mohty Current status of reduced intensity conditioning allogeneic stem cell transplantation for acute myeloid leukemia Haematologica, April 1, 2007; 92(4): 533 - 541. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. van Duin, S. Mohanty, V. Thomas, S. Ginter, R. R. Montgomery, E. Fikrig, H. G. Allore, R. Medzhitov, and A. C. Shaw Age-Associated Defect in Human TLR-1/2 Function J. Immunol., January 15, 2007; 178(2): 970 - 975. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Murciano, E. Villamon, A. Yanez, J.-E. O'Connor, D. Gozalbo, and M. L. Gil Impaired immune response to Candida albicans in aged mice. J. Med. Microbiol., December 1, 2006; 55(Pt 12): 1649 - 1656. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Boyd, S. Mathur, Y. Wang, R. M. Bateman, and K. R. Walley Toll-like receptor stimulation in cardiomyoctes decreases contractility and initiates an NF-{kappa}B dependent inflammatory response Cardiovasc Res, December 1, 2006; 72(3): 384 - 393. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Chelvarajan, Y. Liu, D. Popa, M. L. Getchell, T. V. Getchell, A. J. Stromberg, and S. Bondada Molecular basis of age-associated cytokine dysregulation in LPS-stimulated macrophages J. Leukoc. Biol., June 1, 2006; 79(6): 1314 - 1327. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Ujvari and T. Madsen Age, parasites, and condition affect humoral immune response in tropical pythons Behav. Ecol., January 1, 2006; 17(1): 20 - 24. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Guo, S. Garg, K. M. Hill, L. Jayashankar, M. R. Mooney, M. Hoelscher, J. M. Katz, J. M. Boss, and S. Sambhara A Distal Regulatory Region Is Required for Constitutive and IFN-{beta}-Induced Expression of Murine TLR9 Gene J. Immunol., December 1, 2005; 175(11): 7407 - 7418. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jiang, D. Gross, S. Nogusa, P. Elbaum, and D. M. Murasko Depletion of T Cells by Type I Interferon: Differences between Young and Aged Mice J. Immunol., August 1, 2005; 175(3): 1820 - 1826. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Roberts, C. Paddock, L. Vogel, E. Butler, S. Zaki, and K. Subbarao Aged BALB/c Mice as a Model for Increased Severity of Severe Acute Respiratory Syndrome in Elderly Humans J. Virol., May 1, 2005; 79(9): 5833 - 5838. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Chelvarajan, S. M. Collins, J. M. Van Willigen, and S. Bondada The unresponsiveness of aged mice to polysaccharide antigens is a result of a defect in macrophage function J. Leukoc. Biol., April 1, 2005; 77(4): 503 - 512. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. I Lancaster, Q. Khan, P. Drysdale, F. Wallace, A. E Jeukendrup, M. T Drayson, and M. Gleeson The physiological regulation of toll-like receptor expression and function in humans J. Physiol., March 15, 2005; 563(3): 945 - 955. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. VanderMeer, Q. Sha, A. P. Lane, and R. P. Schleimer Innate Immunity of the Sinonasal Cavity: Expression of Messenger RNA for Complement Cascade Components and Toll-like Receptors Arch Otolaryngol Head Neck Surg, December 1, 2004; 130(12): 1374 - 1380. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Pioli, E. Amiel, T. M. Schaefer, J. E. Connolly, C. R. Wira, and P. M. Guyre Differential Expression of Toll-Like Receptors 2 and 4 in Tissues of the Human Female Reproductive Tract Infect. Immun., October 1, 2004; 72(10): 5799 - 5806. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Fayad, H. Zhang, D. Quinn, Y. Huang, and L. Qiao Oral Administration with Papillomavirus Pseudovirus Encoding IL-2 Fully Restores Mucosal and Systemic Immune Responses to Vaccinations in Aged Mice J. Immunol., August 15, 2004; 173(4): 2692 - 2698. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. P. Plackett, E. D. Boehmer, D. E. Faunce, and E. J. Kovacs Aging and innate immune cells J. Leukoc. Biol., August 1, 2004; 76(2): 291 - 299. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Kovacs, T. P. Plackett, and P. L. Witte Estrogen replacement, aging, and cell-mediated immunity after injury J. Leukoc. Biol., July 1, 2004; 76(1): 36 - 41. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Didierlaurent, I. Ferrero, L. A. Otten, B. Dubois, M. Reinhardt, H. Carlsen, R. Blomhoff, S. Akira, J.-P. Kraehenbuhl, and J.-C. Sirard Flagellin Promotes Myeloid Differentiation Factor 88-Dependent Development of Th2-Type Response J. Immunol., June 1, 2004; 172(11): 6922 - 6930. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cuadros, F. J. Lopez-Hernandez, A. L. Dominguez, M. McClelland, and J. Lustgarten Flagellin Fusion Proteins as Adjuvants or Vaccines Induce Specific Immune Responses Infect. Immun., May 1, 2004; 72(5): 2810 - 2816. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Frasca, E. Van der Put, R. L. Riley, and B. B. Blomberg Reduced Ig Class Switch in Aged Mice Correlates with Decreased E47 and Activation-Induced Cytidine Deaminase J. Immunol., February 15, 2004; 172(4): 2155 - 2162. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Kurt-Jones, M. Chan, S. Zhou, J. Wang, G. Reed, R. Bronson, M. M. Arnold, D. M. Knipe, and R. W. Finberg Herpes simplex virus 1 interaction with Toll-like receptor 2 contributes to lethal encephalitis PNAS, February 3, 2004; 101(5): 1315 - 1320. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. D. Boehmer, J. Goral, D. E. Faunce, and E. J. Kovacs Age-dependent decrease in Toll-like receptor 4-mediated proinflammatory cytokine production and mitogen-activated protein kinase expression J. Leukoc. Biol., February 1, 2004; 75(2): 342 - 349. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Janssens and R. Beyaert Role of Toll-Like Receptors in Pathogen Recognition Clin. Microbiol. Rev., October 1, 2003; 16(4): 637 - 646. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Davenport Immunity Challenge Sci. Aging Knowl. Environ., June 11, 2003; 2003(23): oa1 - 1. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Means, F. Hayashi, K. D. Smith, A. Aderem, and A. D. Luster The Toll-Like Receptor 5 Stimulus Bacterial Flagellin Induces Maturation and Chemokine Production in Human Dendritic Cells J. Immunol., May 15, 2003; 170(10): 5165 - 5175. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wu, M. Marko, K. Claycombe, K. E. Paulson, and S. N. Meydani Ceramide-induced and Age-associated Increase in Macrophage COX-2 Expression Is Mediated through Up-regulation of NF-kappa B Activity J. Biol. Chem., March 21, 2003; 278(13): 10983 - 10992. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |