| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
and Fas-Ligand-Dependent Tumor Eradication by Combined Administration of IL-18 and IL-21
* Pediatric Oncology Branch,
Laboratory of Experimental Immunology, and
Data Management Services, National Cancer Institute-Center for Cancer Research, Bethesda, MD 20892; and
Intramural Research Support Program, Science Applications International Corporation-Frederick, Frederick, MD 21702
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
is a critical component of the endogenous and many
cytokine-induced antitumor immune responses. In this study we have
shown that the combination of IL-18 and IL-2 (IL-18/IL-2)
synergistically enhances IFN- production both in vitro and in vivo,
and synergizes in vivo to induce complete durable regression of
well-established 3LL tumors in >80% of treated mice. We have observed
a nascent, but ineffective, host immune response against 3LL that
depends on endogenous IFN- and IL-12 production and the Fas/Fas
ligand (Fas-L) pathway. The combined administration of IL-18/IL-2
engages this endogenous response to induce tumor regression via a
mechanism that is independent of NK and NKT cells or IL-12, but is
critically dependent on CD8+ T cells, IFN-, and the
Fas/Fas-L pathway. These studies demonstrate the importance of IFN-
as well as the Fas/Fas-L pathway in both endogenous and cytokine-driven
antitumor immune responses engaged by IL-18/IL-2 and provide
preclinical impetus for clinical investigation of this potent
anti-tumor combination. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-inducing factor (1, 2). IL-18 enhances T and/or
NK cell cytokine production, proliferation, and cytolytic activity
(3, 4) as well as the expression of Fas ligand
(Fas-L),3 and Fas-L-
or perforin-mediated cytotoxicity (5, 6, 7). Tumor cells
engineered to produce IL-18 are less tumorigenic (8, 9, 10),
and systemic administration of IL-18 protein has demonstrated
considerable therapeutic activity in several murine tumor models
(11, 12, 13). We have reported previously that IL-12, another
potent IFN--inducing immunoregulatory cytokine, synergizes with IL-2
in the treatment of mice bearing established primary and/or metastatic
tumors (14). IL-2 has a wide range of immunoregulatory
and/or anti-tumor effects, and is currently approved by the Food
and Drug Administration for the treatment of patients with metastatic
renal cell carcinoma and melanoma. Therefore, approaches that enhance
the biological effects of IL-2 also may potentiate the therapeutic
benefits of IL-2-based approaches to cancer treatment. IL-2 and IL-18
can synergistically enhance various aspects of immune function,
including IFN- production, proliferation, and cytolytic activity by
T and/or NK cells (15, 16, 17, 18), and IL-18 enhances the
expression of the IL-2R 
-chain on murine T cells (17).
More recently, Son et al. (19) have demonstrated that
IL-18 and IL-2 synergistically enhance proliferation, IFN-
production, and cytotoxicity by human NK cells in vitro and suggested
that this combination may warrant investigation as an anti-tumor
regimen in vivo. The induction of endogenous IFN- production by
IL-18/IL-2 may be particularly important given the critical role
IFN- plays in the development of adaptive anti-tumor immune
responses (20). As suggested previously (19),
these in vitro observations collectively suggest that IL-18 and IL-2
may also interact favorably in the induction of an anti-tumor
immune response. The present studies have now confirmed in vivo for the
first time that systemic administration of IL-18 and intermittent IL-2
synergistically enhances the complete regression of well-established
primary tumor by a mechanism that depends on CD8+
T cells, Fas/Fas-L, and the production of endogenous IFN-. In
addition, these results suggest that IL-18/IL-2 may successfully
amplify a detectable, but ineffectual, endogenous adaptive
anti-tumor response to induce the regression of established
tumors. |
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
C57BL/6 mice were obtained from the Animal Production area of
the National Cancer Institute. GKO/C57BL/6 (GKO) IFN- knockout mice,
immunodeficient C57BL/6J-SCID (SCID) mice, as well as B6 MRLFas (LPR)
and B6C3H/FasL/J (GLD) mice that express mutated, nonfunctional Fas and
Fas-L genes, respectively, were derived from our breeding colonies.
Breeding pairs of C57BL/6-IL-12 p40 knockout
(p40-/-) mice were provided by Dr. J. Magram
(Hoffmann-La Roche, Nutley, NJ) and maintained in our colony. Mice were
maintained in a dedicated pathogen-free environment and generally used
between 8 and 10 wk of age. The transplantable mouse Lewis lung
carcinoma (3LL) cell line or dominant-negative Fas-transfected 3LL
(3LL-DN) was used in all experiments as indicated. Animal care was
provided in accordance with the procedures outlined in the Guide for
the Care and Use of Laboratory Animals (National Institutes of Health
Publication 86-23).
Generation of dominant-negative Fas 3LL transfectants
For construction of recombinant Fas expression vectors, the 1039-bp full-length Fas and 610-bp dominant-negative Fas that does not contain the intracellular signaling domain were amplified by RT-PCR from 3LL total RNA using the forward primer Fas-5A (GCTGTTTTCCCTTGCTGCAGAC) and the reverse primer Fas-3A (CTCCTCTCTTCATGGCTGGAAC) or Fas-3B (CTACCAGCACTTTCTTTTCCGGTA), respectively. PCR-amplified products were ligated into the Unidirectional Eukaryotic TA Cloning Expression Vector (Invitrogen, San Diego, CA). The integrity of the insert was confirmed by sequencing. The expression vectors coding full-length Fas or dominant-negative Fas were transfected into 3LL tumor cells using Lipofectamine (Life Technologies, Gaithersburg, MD) according to the manufacturer’s instructions. Briefly, 3LL cells (1 x 105) were plated in a six-well plate in 2 ml complete medium and incubated at 37°C in a 5% CO2 incubator until the cells were 50–80% confluent. The cells were transfected with 2 µg recombinant expression vector DNA and 5 µl Lipofectamine for 6 h, passaged, and cultured continuously in the presence of 800 µg/ml geneticin from days 3–14. Geneticin-resistant clones were selected by limiting dilution, and flow cytometry was used to select clones that exhibited high levels of Fas expression. 3LL cells transfected with control vector alone were also selected under high concentrations of geneticin (1000 µg/ml) and used as a negative control.
Reagents
Recombinant murine IL-18 was purchased from PeproTech (Rocky
Hill, NJ). For in vivo administration, aliquots of stock IL-18 were
diluted with HBBS containing 0.1% (v/v) sterile-filtered C57BL/6 mouse
serum. Recombinant human IL-2 was provided by Chiron (Emeryville, CA).
After reconstitution with sterile water, IL-2 was diluted with HBSS
containing 0.1% C57BL/6 mouse serum. Recombinant mouse IFN- (sp.
act., 4.7 x 106 U/mg) was provided by
Genentech (South San Francisco, CA). Recombinant murine TNF- (sp.
act., 1.2 x 107 U/mg), anti-murine Fas
(Jo2) Ab, and hamster IgG isotype control were purchased from BD
PharMingen (San Diego, CA). Monoclonal mouse anti-mouse CD8
(19/178) and rat anti-mouse CD4 (GK 1.5), derived from hybridoma
supernatants, were used for in vivo depletion of
CD8+ and CD4+ T
lymphocytes. NK1.1+ NK and NK/T cell populations
were depleted in vivo with optimally titrated mouse anti-mouse
NK1.1 (clone PK136/HB191; American Type Culture Collection, Manassas,
VA). For those experiments 200 µl of a 1/2 dilution of anti-NK1.1
ascites was injected i.p. on days 4 and 9 after the injection of 3LL
tumor, and the effects of this regimen were analyzed 6 days after the
last injection of Ab.
Cytokine production
Single-cell suspensions of C57BL/6 murine splenocytes in RPMI
1640 (BioWhittaker, Walkersville, MD) supplemented with 10% FBS
(Intergen, Purchase, NY) and additives including 1% sodium pyruvate,
1% L-glutamine, 1% penicillin/streptomycin, and 1%
nonessential amino acids (BioWhittaker) were aliquoted (1 x
106 ml cells/well) in 24-well, flat-bottom plates
(Costar, Cambridge, MA) in complete medium containing IL-18 (100 ng/ml)
with or without IL-2 (600 IU/ml) or medium alone in duplicate. Cells
were incubated for 48 h, and supernatants were assayed for IFN-
by ELISA (R&D Systems, Minneapolis, MN). To investigate the impact of
combined systemic administration of IL-18 and IL-2 on IFN-
production in vivo, tumor-bearing mice were treated as outlined below.
Serum samples obtained via cardiac puncture from mice euthanized as
indicated below were also assayed for IFN- by ELISA.
Flow cytometry
The expression of Fas on 3LL tumor cells was analyzed using flow cytometry. Cells (5 x 105) were stained with PE-labeled anti-mouse Fas Ab (Jo2) or PE-labeled hamster IgG isotype control Ab at 4°C for 20 min. After washing, cells were analyzed on a FACScan (BD Biosciences, Mountain View, CA) flow cytometer using CellQuest software. The depletion of NK and NKT cell subsets in vivo was monitored using anti-mouse NK1.1 (PK136) and anti-mouse IgG2a to detect any cells that may have been masked by possible binding of residual NK1.1 Ab via flow cytometric analysis of single-cell leukocyte suspensions prepared from the liver and spleen. C57BL/6 mice were euthanized by cervical dislocation. Single-cell splenocyte suspensions were prepared by mechanical disruption and lysis to remove mature RBC using ACK lysing buffer (Quality Biological, Gaithersburg, MD). The resultant cell pellet was suspended in staining buffer (HBSS with 0.1% BSA (Sigma-Aldrich, St. Louis, MO) and 0.1% sodium azide (Sigma-Aldrich)) for analysis via flow cytometry as described above. Liver leukocyte suspensions were prepared via portal vein perfusion with HBSS, followed by mechanical disruption. The resulting single-cell suspension was collected by centrifugation at 800 x g for 10 min at 4°C and washed twice with cold HBSS, and the resulting pellet was resuspended in 40% Percoll (Amersham Pharmacia Biotech, Piscataway, NJ) in DMEM (BioWhittaker). This single-cell suspension was gently centrifuged for 20 min at 1000 x g, and the resulting leukocyte pellet was washed twice in cold HBSS, lysed as described above to remove RBC, and suspended in staining buffer for flow cytometric analysis as described above.
Cytotoxicity assay
Tumor target cells (1 x 104) were labeled with 111indium-oxine as previously described (21) and incubated in a volume of 200 µl complete medium/well in 96-well, flat-bottom plates with various concentrations of anti-Fas Ab (Jo2) in the presence of P815 (1 x 105 cells) to promote Ab cross-linking. After 18 h of incubation, supernatants were harvested and counted in a gamma spectrophotometer (model 1480; Wallac, Gaithersburg, MD). Specific killing (percent cytotoxicity) was calculated as [(experimental release - spontaneous release)/(maximal release - spontaneous release)] x 100. All samples conditions were run in triplicate.
Tumor models and in vivo treatment
Cohorts of 10 mice/group were used in the present studies unless
otherwise noted. Mice received s.c. mid-flank injections of
106 3LL tumor cells and formed well-established
tumors before the initiation of therapy. To investigate the impact of
combined administration of IL-18 and IL-2 on the production of IFN-
in vivo in a tumor-bearing host, IL-18 (2.5 µg) or vehicle alone was
administered i.p. twice daily on days 8–11 and 14–17, and IL-2
(300,000 IU) or vehicle alone was delivered i.p. once daily on days 8,
10, 14, and 17 after tumor implantation. On day 18 cohorts of mice from
the respective treatment groups (six mice per group) were euthanized,
and serum samples were obtained from individual mice via cardiac
puncture and assayed for IFN- as noted above.
To investigate the anti-tumor activity of combined systemic administration of IL-18 and IL-2, IL-18 (2.5 µg) or vehicle alone was administered i.p. twice daily on days 8–12, 15–19, and 22–26, and IL-2 (300,000 IU) or vehicle alone was delivered i.p. once daily on days 8, 10, 12, 15, 17, 19, 22, and 25 after tumor implantation. In a subsequent experiment IL-18 (2.5 µg) or vehicle alone was administered twice daily as described above on days 8–12 and 15–19, and IL-2 (300,000 IU) or vehicle alone was delivered once daily on days 8, 10, 12, 15,18, and 22 after tumor implantation. The results of these experiments were pooled for analysis of the therapeutic activity of IL-18 with or without IL-2.
To define the role of an intact immune system and, more specifically,
IFN- and IL-12 in the anti-tumor activity of IL-18/IL-2, we
compared the therapeutic efficacy of this regimen in tumor-bearing
wild-type, GKO, p40-/-, and SCID mice treated
as described above with three cycles of IL-18 and IL-2. The role of
specific T cell subsets in mediating the anti-tumor activity of
IL-18/IL-2 was assessed by concurrent Ab depletion of
CD4+ or CD8+ T cells. Mice
were treated as described above with three cycles of IL-18 and IL-2.
CD4+ and CD8+ T cell
subsets were selectively depleted by the i.p. administration of 790
µg rat anti-mouse CD4 or 163 µg mouse anti-mouse CD8 on
days 4, 8, 12, 14, 16, 18, 21, 23, and 25 after tumor cell
implantation, regimens shown to ablate CD4+ or
CD8+ T cells, respectively. The roles of NK and
NKT cell subsets in mediating the anti-tumor activity of IL-18/IL-2
were assessed by concurrent depletion of NK1.1+
NK and NKT cells. Mice were treated as described above with three
cycles of IL-18 and IL-2. NK and NKT cell subsets were concurrently
depleted by administration of mouse anti-mouse NK1.1 on days 4 and
9 after tumor cell implantation. The effectiveness of the depletion of
NK (NK1.1+ CD3-) and NKT
(NK1.1+ CD3+) cell subsets
was monitored as described below in the liver and/or spleen.
The role of the Fas/Fas-L pathway in the anti-tumor activity of IL-18/IL-2 was also investigated by comparing the therapeutic efficacy of this regimen in tumor-bearing wild-type, LPR, and GLD mice treated as described above with three cycles of IL-18 and IL-2. The role of tumor vs host Fas responsiveness was investigated in wild-type vs LPR mice (with dysfunctional Fas) bearing established wild-type 3LL or 3LL-DN Fas (overexpressing dominant negative nonfunctional Fas) tumors treated as described above with three cycles of IL-18 and IL-2.
Statistical methods
Estimated tumor volumes were obtained by multiplying the largest tumor dimension by the square of the smallest dimension. Tumor volumes among the respective groups were compared with Wilcoxon’s rank-sum test. Kaplan-Meier curves were plotted for survival analyses, and differences in survival distributions were evaluated with the log-rank test. Proportions of mice achieving complete durable tumor regression were compared with Fisher’s exact test. Interpretations regarding survival and tumor regression outcomes were in complete interpretative agreement. For simplicity we reported only p values obtained from Fisher’s exact tests. All p values were two-tailed and were considered significant at p < 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production by murine splenocytes
treated in vitro with IL-18 with or without IL-2
We initially investigated the impact of IL-18 and IL-2 on IFN-
production by murine splenocytes. We found that IL-18 and IL-2
synergistically enhanced IFN- production, with splenocytes treated
with IL-18 and IL-2 producing dramatically more IFN- (1820 pg/ml)
than those treated with IL-18 (101 pg/ml), IL-2 (5 pg/ml), or medium
(none detected) alone (Fig. 1
A).
|
production in vivo by IL-18 and
IL-2
Given the ability of IL-18 and IL-2 to synergistically enhance the
production of IFN- by murine splenocytes in vitro, we next
investigated whether a similar effect was observed in vivo in a
tumor-bearing host. In this setting, in mice bearing a locally
advanced, 3LL tumor we found that the combined systemic administration
of IL-18 and IL-2 markedly enhanced circulating serum IFN- levels
(mean, 8892 pg/ml) compared with those observed in either control mice
(not detected) or mice treated with IL-18 (mean, 4472 pg/ml) or IL-2
(not detected) alone (Fig. 1
B).
Systemic administration of IL-18 and IL-2 synergistically enhances the complete regression of established 3LL tumors
In light of their ability to synergistically up-regulate the
production of IFN-, a cytokine known to be central to the
development of adaptive anti-tumor immune responses
(20), we speculated that IL-18 and IL-2 might also
synergize for the induction of an anti-tumor immune response
against a well-established primary tumor. In fact, twice-daily
administration of IL-18 in combination with intermittent administration
of IL-2 synergistically induced the complete regression of
well-established 3LL tumors (Fig. 2).
Sixteen of 20 mice (80%) treated with IL-18 plus IL-2 achieved
curative responses compared with 5 of 20 mice (25%) treated with
either IL-18 or IL-2 alone and 1 of 20 control mice (5%) treated with
vehicle alone (Fig. 2; p = 0.001, IL-18 plus IL-2 vs
IL-18 or IL-2 alone). An additional mouse in the IL-18 plus IL-2 group
had undergone complete tumor regression, but was excluded from
consideration after dying secondary to a traumatic injection. Notably,
we also have found that 50% of mice cured of their original tumor with
IL-18/IL-2 are resistant to rechallenge with viable 3LL cells compared
with 0% of rechallenge control mice, demonstrating that immunologic
memory responses are generated in these mice as the result of an
initial adaptive immune response.
|
, and IL-12 in the anti-tumor immune
response induced by systemic administration of IL-18/IL-2
The potential mechanisms mediating the potent anti-tumor
activity of IL-18/IL-2, including the role of an intact immune system,
and the Th1 cytokines IFN- and IL-12 were subsequently investigated.
Tumors were significantly larger on day 23 after implantation in
vehicle-treated SCID (p = 0.0001) and GKO
(p = 0.0002) mice and to a lesser degree in
p40-/- (p = 0.0015)
mice compared with wild-type controls (Fig. 3A). Median tumor volumes
among these groups were as follows: wild-type control, 150
mm3; p40-/- control, 2197
mm3; GKO control, 7822 mm3;
and SCID control, 6804 mm3 (Fig. 3A).
Thus, a significant, but incomplete, endogenous immune response against
3LL occurs in vivo, and this response is critically dependent on
endogenous IFN- and to a lesser degree on IL-12 production. An
appreciable incidence of complete durable tumor regression was induced
only in wild-type mice treated with IL-18/IL-2 (6 of 10 mice; 60%) or
p40-/- mice treated with IL-18/IL-2 (4 of 10
mice; 40%; Fig. 3B). No complete responses were induced by
IL-18/IL-2 in either GKO or SCID mice. Thus, the ability of IL-18/IL-2
to induce complete responses in wild-type mice was significantly
(p = 0.011) greater than its effect in GKO or
SCID mice, but not in p40-/- mice
(p = 0.656). Collectively, these findings
demonstrate that the production of both IFN- and IL-12 is an
important component of the endogenous host immune response against an
established 3LL tumor, but that only IFN- is critical for the
anti-tumor response engaged by systemic administration of
IL-18/IL-2.
|
The roles of specific T cell subsets in the anti-tumor
activity of IL-18/IL-2 were defined in 3LL-bearing mice concurrently
depleted of CD4+ vs CD8+ T
lymphocytes (Fig. 4). Complete durable
tumor regression was only induced by IL-18/IL-2 in nondepleted (8 of
10, 80%) or CD4-depleted (10 of 10, 100%) mice, while mice depleted
of CD8+ T cells were completely refractory (0 of
10, 0%) to the anti-tumor effects of IL-18/IL-2. Thus, concurrent
depletion of CD8+, but not
CD4+, T cells ablates the anti-tumor activity
of IL-18/IL-2 vs established 3LL. In subsequent studies we investigated
the role of NK vs NKT cells as mediators of the anti-tumor activity
of IL-18/IL-2 vs 3LL. Although administration of NK1.1 markedly
depleted both NK
(NK1.1+CD3-; Fig. 5A) and NKT
(NK1.1+CD3+; Fig. 5B) cells in the liver and NK cells in the spleen (not
shown), concurrent depletion of NK and/or NKT cells had no impact on
the therapeutic efficacy of IL-18/IL-2 (Fig. 6). One surviving control mouse and
another mouse in the group treated with IL-18/IL-2 and anti-NK1.1
had large progressive tumors at the last follow-up. All other surviving
mice in the respective groups were tumor free. Complete durable tumor
regression was induced in 12 of 15 (80%) mice treated with IL-18/IL-2
vs eight of 11 (73%) mice treated with IL-18/IL-2 and concurrently
depleted of NK and NKT cells via administration of anti-NK1.1 Ab
and zero of 10 (0%) control mice treated with vehicle alone.
|
|
|
In light of the role of CD8+ T cells, we
speculated that the Fas/Fas-L pathway might contribute to the
anti-tumor activity of IL-18/IL-2. Notably, the tumor volumes were
significantly larger on day 21 postimplantation among LPR
(p = 0.0003) and GLD (p
= 0.0002) mice treated with vehicle alone than in wild-type controls
(Fig. 7A). Median tumor
volumes among these groups were as follows: wild-type controls, 322
mm3; GLD controls, 5372.5
mm3; and LPR controls, 5994
mm3. Among wild-type, LPR, or GLD mice treated
with IL-18/IL-2 or vehicle alone (Fig. 7B), an appreciable
incidence of complete durable tumor regression was induced only in
wild-type mice (9 of 10, 90%). The effectiveness of IL-18/IL-2 was
significantly greater in wild-type C57BL/6 mice than in LPR
(p = 0.001) or GLD (p =
0.005) mice. One GLD mouse treated with IL-18/IL-2 was excluded from
analysis after it became sick and had to be euthanized on day 45. These
findings demonstrate a critical role for the Fas/Fas-L system in both
the endogenous immune response against 3LL and the anti-tumor
effects induced by IL-18/IL-2.
|
Having demonstrated that an intact Fas/Fas-L pathway was an
essential component of both the endogenous immune response against
established 3LL and the anti-tumor mechanisms engaged by
administration of IL-18/IL-2, we subsequently investigated the relative
roles of tumor vs host cell Fas responsiveness in mediating the
efficacy of this combination. Notably, although in vitro treatment of
3LL with IFN- with or without TNF- potently up-regulates the
expression of Fas on the surface of 3LL as assessed by flow cytometry
(Fig. 8), this does not translate to
enhanced sensitivity to Fas-mediated killing upon subsequent exposure
to Jo2 Ab (data not shown). Nonetheless, 3LL tumor cells engineered to
overexpress cell surface Fas are exquisitely sensitive to Jo2,
demonstrating that these cells possess the intracellular signaling
mechanisms necessary to undergo Fas-mediated killing (J. K. Lee,
T. C. Back, and R. H. Wiltrout, manuscript in preparation). To
definitively address the role of tumor vs host cell Fas responsiveness
in the anti-tumor activity of IL-18/IL-2, we established 3LL tumor
cells (3LL-DN) engineered to overexpress a dominant-negative Fas
molecule lacking the intracellular signaling domain. These 3LL-DN tumor
cells overexpress cell surface Fas as detected by flow cytometry, but
are completely resistant to Fas-mediated killing in response to in
vitro treatment with Jo2 (data not shown). Although IL-18/IL-2 induces
complete regression of tumors established with either wild-type 3LL (10
of 15, 67%) or dominant-negative 3LL (9 of 10, 90%) established in
wild-type mice, it only rarely induces complete regression of either
3LL (1 of 9, 11%) or 3LL-DN (1 of 10, 10%) tumors established in LPR
mice with dysfunctional Fas (Fig. 9;
wild-type host/wild-type 3LL tumor vs wild-type host/dominant-negative
3LL tumor, p = 0.3449; wild-type host/wild-type 3LL
tumor vs LPR host/wild-type 3LL tumor, p = 0.0131 or
LPR host/dominant-negative 3LL tumor, p = 0.0119;
wild-type host/dominant-negative 3LL tumor vs LPR host/wild-type 3LL
tumor, p = 0.0011 or LPR host/dominant-negative 3LL
tumor, p = 0.0011). These studies demonstrate that
although an intact endogenous Fas/Fas-L pathway is a critical component
of the anti-tumor mechanisms induced by IL-18/IL-2 host but not
tumor, cell Fas responsiveness is a necessary component of these
mechanisms.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-inducing cytokines, such
as IL-12. IL-12 and IL-2 synergistically enhance various aspects of T
and/or NK cell function, including proliferation, IFN- production,
and cytolytic activity in vitro (22). Further, we have
previously reported (14, 23) that systemic administration
of IL-12/pulse IL-2 induces rapid and complete regression of even
well-established primary and/or metastatic tumor in up to 88–100% of
treated mice compared with 20% or fewer complete responses among mice
treated with either single agent alone, and does so via mechanisms that
are dependent on the induction of endogenous IFN- production.
IL-18 is another potent IFN--inducing cytokine (1, 2)
with substantial preclinical anti-tumor activity
(8, 9, 10, 11, 12, 13). Tumor cells engineered to produce IL-18 are
significantly less tumorigenic in vivo (8, 9, 10), and
systemic administration of IL-18 protein has demonstrated therapeutic
activity in several murine tumor models (11, 12, 13). Although
combined systemic administration of IL-18/IL-12 protein is
prohibitively toxic in murine tumor models (12),
synergistic anti-tumor effects are achieved with systemic delivery
of IL-12 in conjunction with IL-18 gene therapy (8), or
systemic IL-18 in combination with IL-12 gene therapy
(24), with appreciable reductions in toxicity. Concurrent
vaccination with tumor cells engineered to overexpress IL-12 and IL-18
synergistically inhibits the establishment of wild-type tumor cells,
and induces the regression of some early established tumors implanted
at a distant site (25). Further, combined peritumoral
injection of IL-18/IL-1
-converting enzyme/IL-12 cDNA has been
reported to enhance the complete regression of established tumors
(26). We have shown here that IL-18 and IL-2
synergistically enhance the production of IFN- by murine
splenocytes, and a previous report suggests that IL-18 and IL-2 may do
so more effectively than the combination of IL-12 and IL-2
(15). Several other studies also have demonstrated that
IL-18 may markedly potentiate the effects of IL-2 on several aspects of
T and/or NK cell function in vitro (15, 16, 17, 18), suggesting
that in combination these cytokines also may demonstrate synergistic
anti-tumor activity. In a model of well-established primary tumor,
where IL-18 or IL-2 alone has only modest therapeutic activity, we have
now demonstrated that IL-18 and IL-2 synergize to induce complete and
durable tumor regression in >80% of treated mice, and that
immunologic memory responses are generated in many of these mice cured
of their tumors with IL-18/IL-2. It is notable that this regimen
consisting of 5-day cycles of IL-18 administered in conjunction with
pulsatile intermittent dosing of IL-2 is not only therapeutically
effective, but well tolerated as well. This contrasts quite markedly
with the severe pulmonary toxicity observed in mice treated chronically
with continuous cycles of both IL-18 and IL-2 for 10 days without
interruption (27). In conjunction with our previous report
regarding the potent anti-tumor activity of IL-12/pulse IL-2 and
the severe toxicity of chronically administered IL-12 and IL-2 compared
with IL-12/pulse IL-2 (14, 23), these observations suggest
that careful evaluation of specific schedules and dosing regimens will
probably be required to optimize the tolerance and therapeutic
potential of new combination cytokine regimens as they are translated
into the clinical setting.
The present studies also demonstrate that there is an active, but
ultimately ineffective, endogenous immune response against 3LL, and
that this response is critically dependent on IFN- and IL-12
production. Although others have reported that the anti-tumor
activity of IL-18 gene therapy is IL-12 independent (24)
and IFN- dependent (9, 25, 26) in several murine tumor
models, systemic administration of IL-18 protein alone induces tumor
regression via mechanisms independent of both endogenous IL-12 and
IFN- production (12). We have shown here that combined
systemic administration of IL-18 and IL-2 engages and amplifies this
endogenous immune response against 3LL and induces tumor regression via
mechanisms that are dependent on IFN-, but not IL-12 production.
Thus, the current findings demonstrate that the anti-tumor
mechanisms engaged by IL-18/IL-2 may contrast with those induced by
IL-18 alone, and that although IL-12 is an important component of the
endogenous immune response against 3LL, it does not appear to be
central to the anti-tumor activity of IL-18/IL-2.
Both NK and T cell subsets have been shown to play a role in the anti-tumor activity of IL-18 alone in various murine tumor models. Several IL-18-based gene therapy approaches induce tumor regression via mechanisms dependent on CD8+ and/or CD4+ T cells (9, 26), while peritumoral injection of adenovirus-overexpressing IL-18 induces tumor regression via mechanisms that are dependent on NK, but not CD4+ and CD8+ T, cells (8). Diminished infiltration of CD8+ T cells is noted in the local tumor site of mice treated with systemic IL-18 protein, and the induction of tumor regression is mediated by NK cell-dependent mechanisms (12, 13). Thus, the role of CD8+ T cells in the anti-tumor activity of IL-18/IL-2 contrasts with the central role of NK cells in mediating the therapeutic efficacy of IL-18 protein alone.
Because CD8+ T cells are vital for the anti-tumor activity of IL-18/IL-2, we speculated that the Fas/Fas-L pathway might play a role in mediating the tumor regression induced by this combination. IL-18 alone can activate cytolytic CD8+ T cells (16) and Fas-L mediated cytolytic activity by T and/or NK cells in vitro (5, 6, 7). Our results revealed that the Fas/Fas-L pathway is also an important component of the endogenous immune response against established 3LL as well as an essential mediator of the anti-tumor activity of IL-18/IL-2. Nonetheless, IL-18/IL-2 administration modestly prolongs the survival of 3LL-bearing LPR or GLD mice compared with mice treated with vehicle alone, suggesting that although the ability of IL-18/IL-2 to induce complete tumor regression is critically dependent on Fas and Fas-L, mechanisms that can at least delay tumor growth independent of Fas/Fas-L can be engaged by IL-18/IL-2. In contrast, administration of IL-18 protein alone limits tumor establishment via mechanisms that are dependent on Fas-L, but not Fas (11), and administration of IL-12 protein efficiently induces 3LL tumor regression via mechanisms that are independent of Fas/Fas-L (J. M. Wigginton and R. H. Wiltrout, unpublished observations). Collectively, these findings demonstrate that the Fas/Fas-L pathway is an important component of both the endogenous and cytokine-induced immune responses against 3LL and show that the spectrum of anti-tumor mechanisms induced by IL-18/IL-2 differs from those mechanisms that have been attributed to the therapeutic effects of treatment with IL-18 or IL-12 alone. We have shown previously that combined administration of IL-12/pulse IL-2 inhibits tumor neovascularization and induces vascular endothelial injury and complete tumor regression via mechanisms that are critically dependent on the presence of an intact Fas/Fas-L pathway (23). Consistent with these observations, our studies using wild-type vs LPR (with dysfunctional host Fas) mice bearing established wild-type 3LL vs 3LL-DN (engineered to overexpress dominant-negative, nonfunctional Fas) tumors demonstrate that although tumor cell Fas responsiveness is not an essential component of the anti-tumor mechanisms engaged by IL-18/IL-2, host Fas responsiveness is essential for complete tumor regression induced by IL-18/IL-2. Notably, investigators recently have demonstrated a critical role for the Fas/Fas-L pathway in mediating the potent anti-angiogenic activity of thrombospondin-1 in vivo as well (28). Collectively, these observations and an increasing body of literature evidence suggest that the Fas/Fas-L pathway may play a critical role in a range of endogenous mechanisms governing tumor neovascularization as well as the spectrum of anti-tumor mechanisms induced by potent immunoregulatory cytokines such as IL-12 and IL-18. The specific impact of IL-18/IL-2 on endothelial and other host cell targets as well as the overall process of tumor neovascularization remains to be defined and is a focus of active investigation in our laboratory.
As has been observed during the evolution of combination chemotherapy
strategies, optimal therapeutic enhancement of host anti-tumor
mechanisms with biologics will most likely be achieved with rationally
designed approaches combining various agents with complementary
mechanisms of action. These may include cytokines administered in
combination or in conjunction with other biologics, such as targeted
inhibitors of tumor neovascularization or intracellular signal
transduction. Such approaches offer the prospect for more potent
anti-tumor activity with reduced toxicity compared with approaches
using high doses of various single agents alone. The present studies
describe an approach using IL-2 administered in conjunction with IL-18,
a potent IFN--inducing cytokine (1, 2), which results
in profound anti-tumor activity that depends on
CD8+ T cells, IFN-, and the Fas/Fas-L pathway.
These results demonstrate the engagement of a novel therapeutic
mechanism and suggest that clinical investigation of the
immunoregulatory and anti-tumor activities of combined
administration of IL-18 and IL-2 may be warranted.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jon M. Wigginton, Pediatric Oncology Branch, National Cancer Institute, Building 560, Room 31-93, Frederick, MD 21702-1201. E-mail address: jw121b{at}nih.gov
3 Abbreviation used in this paper: Fas-L, Fas ligand.
Received for publication January 22, 2002. Accepted for publication August 14, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
interferon production. Infect. Immun. 57:590. production by T cells. Nature 378:88.[Medline]
-inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine natural killer cell clones. J. Immunol. 157:3967.[Abstract]
-inducing factor, a novel cytokine, enhances Fas ligand-mediated cytotoxicity of murine T helper 1 cells. Cell. Immunol. 173:230.[Medline]
inducing factor, interleukin-18 (IL-18). Gene Ther. 6:808.[Medline]
-inducing factor elicits antitumor immunity in association with interferon- production. J. Immunol. 21:48.
-inducing factor gene transfection into Lewis lung carcinoma cells reduces tumorigenicity in vivo. Jpn. J. Cancer Res. 88:501.[Medline]
-inducing factor/IL-18 administration mediates IFN- and IL-12-independent antitumor effects. J. Immunol. 160:1742.-inducing factor/interleukin-18 in mice bearing syngeneic Meth A sarcoma malignant ascites. Cancer Immunol. Immunother. 43:361.[Medline]
-inducing factor (IGIF) is a costimulatory factor on the activation of Th1 but not Th2 cells and exerts its effect independently of IL-12. J. Immunol. 158:1541.[Abstract]
-inducing factor, expression in Escherichia coli, and studies on the biologic activities of the protein. J. Immunol. 156:4274.[Abstract]
production, and expansion of natural killer cells. Cancer Res. 61:884.-dependent tumor surveillance system in immunocompetent mice. Proc. Natl. Acad. Sci. USA 95:7556. and Fas/FasL are required for the antitumor and antiangiogenic effects of IL-12/pulse IL-2 therapy. J. Clin. Invest. 108:51.[Medline]
converting enzyme cDNA. Proc. Natl. Acad. Sci. USA 96:13351.This article has been cited by other articles:
|
|
 |
|
  R. Salcedo, J. A. Hixon, J. K. Stauffer, R. Jalah, A. D. Brooks, T. Khan, R.-M. Dai, L. Scheetz, E. Lincoln, T. C. Back, et al. Immunologic and Therapeutic Synergy of IL-27 and IL-2: Enhancement of T Cell Sensitization, Tumor-Specific CTL Reactivity and Complete Regression of Disseminated Neuroblastoma Metastases in the Liver and Bone Marrow J. Immunol., April 1, 2009; 182(7): 4328 - 4338. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Robertson, J. M. Kirkwood, T. F. Logan, K. M. Koch, S. Kathman, L. C. Kirby, W. N. Bell, L. M. Thurmond, J. Weisenbach, and M. M. Dar A Dose-Escalation Study of Recombinant Human Interleukin-18 Using Two Different Schedules of Administration in Patients with Cancer Clin. Cancer Res., June 1, 2008; 14(11): 3462 - 3469. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Matsubara, K. Takeda, T. Kodama, A. Joetham, N. Miyahara, T. Koya, C. H. Swasey, M. Okamoto, A. Dakhama, and E. W. Gelfand IL-2 and IL-18 Attenuation of Airway Hyperresponsiveness Requires STAT4, IFN-{gamma}, and Natural Killer Cells Am. J. Respir. Cell Mol. Biol., March 1, 2007; 36(3): 324 - 332. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Subleski, V. L. Hall, T. C. Back, J. R. Ortaldo, and R. H. Wiltrout Enhanced Antitumor Response by Divergent Modulation of Natural Killer and Natural Killer T Cells in the Liver. Cancer Res., November 15, 2006; 66(22): 11005 - 11012. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Robertson, J. W. Mier, T. Logan, M. Atkins, H. Koon, K. M. Koch, S. Kathman, L. N. Pandite, C. Oei, L. C. Kirby, et al. Clinical and biological effects of recombinant human interleukin-18 administered by intravenous infusion to patients with advanced cancer. Clin. Cancer Res., July 15, 2006; 12(14): 4265 - 4273. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Khan, J. K. Stauffer, R. Williams, J. A. Hixon, R. Salcedo, E. Lincoln, T. C. Back, D. Powell, S. Lockett, A. C. Arnold, et al. Proteasome Inhibition to Maximize the Apoptotic Potential of Cytokine Therapy for Murine Neuroblastoma Tumors J. Immunol., May 15, 2006; 176(10): 6302 - 6312. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Nowak, F. Kopp, K. Roelofs-Haarhuis, X. Wu, and E. Gleichmann Oral nickel tolerance: fas ligand-expressing invariant NK T cells promote tolerance induction by eliciting apoptotic death of antigen-carrying, effete B cells. J. Immunol., April 15, 2006; 176(8): 4581 - 4589. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Acres, M. Gantzer, C. Remy, N. Futin, N. Accart, O. Chaloin, J. Hoebeke, J.-M. Balloul, and S. Paul Fusokine Interleukin-2/Interleukin-18, a Novel Potent Innate and Adaptive Immune Stimulator with Decreased Toxicity Cancer Res., October 15, 2005; 65(20): 9536 - 9546. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Ortaldo, R. T. Winkler-Pickett, E. W. Bere Jr, M. Watanabe, W. J. Murphy, and R. H. Wiltrout In Vivo Hydrodynamic Delivery of cDNA Encoding IL-2: Rapid, Sustained Redistribution, Activation of Mouse NK Cells, and Therapeutic Potential in the Absence of NKT Cells J. Immunol., July 15, 2005; 175(2): 693 - 699. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Luo, H. Zhou, M. Mizutani, N. Mizutani, C. Liu, R. Xiang, and R. A. Reisfeld A DNA Vaccine Targeting Fos-Related Antigen 1 Enhanced by IL-18 Induces Long-lived T-Cell Memory against Tumor Recurrence Cancer Res., April 15, 2005; 65(8): 3419 - 3427. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Salcedo, J. K. Stauffer, E. Lincoln, T. C. Back, J. A. Hixon, C. Hahn, K. Shafer-Weaver, A. Malyguine, R. Kastelein, and J. M. Wigginton IL-27 Mediates Complete Regression of Orthotopic Primary and Metastatic Murine Neuroblastoma Tumors: Role for CD8+ T Cells J. Immunol., December 15, 2004; 173(12): 7170 - 7182. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Smyth, J. Swann, J. M. Kelly, E. Cretney, W. M. Yokoyama, A. Diefenbach, T. J. Sayers, and Y. Hayakawa NKG2D Recognition and Perforin Effector Function Mediate Effective Cytokine Immunotherapy of Cancer J. Exp. Med., November 15, 2004; 200(10): 1325 - 1335. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Chandrasekar, K. Vemula, R. M. Surabhi, M. Li-Weber, L. B. Owen-Schaub, L. E. Jensen, and S. Mummidi Activation of Intrinsic and Extrinsic Proapoptotic Signaling Pathways in Interleukin-18-mediated Human Cardiac Endothelial Cell Death J. Biol. Chem., May 7, 2004; 279(19): 20221 - 20233. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Brady, Y. Hayakawa, M. J. Smyth, and S. L. Nutt IL-21 Induces the Functional Maturation of Murine NK Cells J. Immunol., February 15, 2004; 172(4): 2048 - 2058. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Kikuchi-Maki, S.-i. Yusa, T. L. Catina, and K. S. Campbell KIR2DL4 Is an IL-2-Regulated NK Cell Receptor That Exhibits Limited Expression in Humans but Triggers Strong IFN-{gamma} Production J. Immunol., October 1, 2003; 171(7): 3415 - 3425. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Luo, H. Zhou, M. Mizutani, N. Mizutani, R. A. Reisfeld, and R. Xiang Transcription factor Fos-related antigen 1 is an effective target for a breast cancer vaccine PNAS, July 22, 2003; 100(15): 8850 - 8855. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Ortaldo and H. A. Young Expression of IFN-{gamma} Upon Triggering of Activating Ly49D NK Receptors In Vitro and In Vivo: Costimulation with IL-12 or IL-18 Overrides Inhibitory Receptors J. Immunol., February 15, 2003; 170(4): 1763 - 1769. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
, Values obtained for individual mice; 
, mean
value for each respective treatment group (B).
