HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Nishikomori, R. Articles by Strober, W. Search for Related Content PubMed PubMed Citation Articles by Nishikomori, R. Articles by Strober, W.

Activated STAT4 Has an Essential Role in Th1 Differentiation and Proliferation That Is Independent of Its Role in the Maintenance of IL-12R2 Chain Expression and Signaling

Ryuta Nishikomori^1,*, Takashi Usui^*, Chang-Yu Wu, Akio Morinobu, John J. O’Shea and Warren Strober^2,*

^* Mucosal Immunity and Clinical Immunology Sections, Laboratory of Clinical Investigation, National Institute of Allergy and Infectious Diseases, and Lymphocyte Cell Biology Section, Arthritis and Rheumatism Branch, National Institute of Arthritis, Musculoskeletal, and Skin Diseases, National Institutes of Health, Bethesda, MD 20892

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
In this study we demonstrated that CD4⁺ T cells from STAT4^-/- mice exhibit reduced IL-12R expression and poor IL-12R signaling function. This raised the question of whether activated STAT4 participates in Th1 cell development mainly through its effects on IL-12 signaling. In a first approach to this question we determined the capacity of CD4⁺ T cells from STAT4^-/- bearing an IL-12R2 chain transgene (and thus capable of normal IL-12R expression and signaling) to undergo Th1 differentiation when stimulated by Con A and APCs. We found that such cells were still unable to exhibit IL-12-mediated IFN- production. In a second approach to this question, we created Th2 cell lines (D10 cells) transfected with STAT4-expressing plasmids with various tyrosinephenylalanine mutations and CD4⁺ T cell lines from IL-122^-/- mice infected with retroviruses expressing similarly STAT4 mutations that nevertheless express surface IL-12R2 chains. We then showed that constructs that were unable to support STAT4 tyrosine phosphorylation (in D10 cells) as a result of mutation were also incapable of supporting IL-12-induced IFN- production (in IL-12R2^-/- cells). Thus, by two complementary approaches we demonstrated that activated STAT4 has an essential downstream role in Th1 cell differentiation that is independent of its role in the support of IL-12R2 chain signaling. This implies that STAT4 is an essential element in the early events of Th1 differentiation.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
It is now well established that CD4⁺ T cells differentiate into two subsets characterized by their distinct cytokine secretion patterns: Th1 cells secreting IFN-, IL-2, and TNF- and Th2 cells secreting IL-4, IL-5, IL-6, IL-9, IL-10, and IL-13 (1). Among the factors controlling such differentiation are the cytokines present in the milieu of the T cells during initial priming (2). In the case of murine Th1 differentiation, APC-derived IL-12 plays a key role in this respect, as shown by the fact that knockout mice deficient in IL-12 p40 or either of the chains comprising the IL-12R have highly impaired Th1 responses (3, 4, 5). In addition, during normal T cell differentiation, down-regulation of the IL-12R2 chain and thus cessation of IL-12 signaling accompanies alternative differentiation into Th2 cells (6, 7). Recently, however, evidence has emerged that IL-12 may not be the primary event of Th1 differentiation (8). This consists of the finding that stimulation of T cells through the TCR leads to the expression of the transcription factor T-bet, which then results in IL-12/STAT4-independent accessibility of the IFN- promoter and induction of IL-12R2 chain expression (8, 9). IL-12/STAT4 signaling then supervenes to sustain nascent Th cell growth and survival as well as to up-regulate IFN- transcription.

One key component of the above description of Th1 differentiation not yet completely understood is the cellular events linking IL-12 to downstream IFN- transcription. Thus, while IL-12 signaling leads to activation of a number of STATs and p38 mitogen-activated protein kinase (10, 11, 12), it is felt that the most important factor is STAT4. This derives from the fact that STAT4 is the only STAT uniquely activated by IL-12, and STAT4 knockout mice exhibit diminished Th1 differentiation (13, 14). However, it should be noted that, while a STAT4 footprint has been detected in the IFN- gene (15, 16), it is still unclear whether STAT4 binding to the promoter/enhancer region of IFN- gene is necessary for IFN- transcription. In addition, STAT4^-/-CD4⁺ cells are low IFN--producing cells that manifest decreased expression of the IL-12R2 chain of the IL-12R (17). These considerations leave open the possibility that the main function of activated STAT4 is to facilitate IL-12 signaling and that other transcription factors are able to maintain IFN- transcription in the absence of STAT4 if IL-12 signaling via the IL-12R2 chain remains intact.

In the present studies we have investigated this question using two complementary approaches. First, we determined the ability of cells bearing a transgene expressing the IL-12R2 chain to transduce a signal leading to Th1 differentiation in the absence of STAT4, i.e., in CD4⁺ cells from a STAT4 knockout mouse. Second, we determined the ability of mouse IL-12R2 chain to function as a signaling molecule in mouse T cells lacking endogenous 2 chain expression after transfection or retroviral delivery of constructs encoding IL-12R2 chains containing tyrosinephenylalanine mutations and thus exhibiting partial or complete absence of STAT4 tyrosine phosphorylation. This allowed us to determine both the sites of STAT4 activation and, more importantly, the relation of such activation to Th1 development.

The results obtained from both approaches showed that activated STAT4 is directly involved in IL-12-dependent Th1 differentiation and proliferation. Thus, even under circumstances in which IL-12 signaling can be shown to occur via the IL-12R2 chain, the absence of activated STAT4 leads to cells with impaired IL-12-induced IFN- production and reduced or absent proliferation. These studies provide unequivocal evidence supporting the key role of activated STAT4 in IL-12-induced Th1 differentiation that is independent of its role in the induction and maintenance of IL-12R2 chain expression and signaling.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Reagents

Human rIL-2 and mouse IL-12 were obtained from the National Cancer Institute (Frederick, MD) and R&D Systems (Minneapolis, MN), respectively. OVA peptide (323–339) was purchased from American Peptide Company (Santa Clara, CA). Culture media for D10.G4.1 cells and primary mouse T cells were identical to those described previously (18).

Cells and cell cultures

Mouse Th2 clone D10.G4.1 (D10) cells were purchased from American Type Culture Collection (Manassas, VA). D10 cells and D10 cells transfected with various constructs were stimulated and maintained as previously described (18). CD4⁺CD62L^high cells from IL-12R2 chain^-/- DO11.10 mouse spleens were isolated with the use of mouse CD4⁺ beads (Miltenyi Biotec, Auburn, CA) and/or by flow cytometry sorting with anti-mouse CD4-FITC (clone RM4-4; BD PharMingen, San Diego, CA) and anti-CD62L-PE (BD PharMingen). For retroviral infection, sorted cells (1 x 10⁵/ml) were stimulated with 3 µM OVA peptide (323–399), 30-Gy irradiated syngeneic BALB/c splenocytes (2.5 x 10⁶/ml), IL-12 (2 ng/ml), and human IL-2 (50–100 U/ml). For STAT4^-/-CD4⁺ cell priming, isolated CD4⁺ cells (0.25 x 10⁵/ml) were stimulated with Con A (2.5 µg/ml) plus irradiated APCs (2.5 x 10⁶/ml) plus IL-12 (2 ng/ml) plus anti-IL-4 (20 µg/ml) (Th1) or IL-4 (200 U/ml) (Th2). Three days later, Con A was neutralized with -methyl mannoside (10 mg/ml) and the CD4⁺ T cell lines were washed extensively and expanded. Both retrovirus-infected T cell lines and Con A-stimulated T cell lines were >98% CD4 positive.

Mice

BALB/c background IL-12R2 chain knockout mice were produced as previously described (5). BALB/c background OVA-specific TCR-transgenic DO11.10 mice were crossed with BALB/c background IL-12R2 chain knockout mice to obtain BALB/c background IL-12R2 chain knockout/DO11.10 mice. BALB/c background STAT4^-/- mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and bred in our animal facility. STAT4^-/- IL-12R2 chain transgenic mice were created by crossing STAT4^-/- mice with BALB/c background IL-12R2 chain transgenic mice (18).

Plasmid constructs

VAhCD2 minigene vector and mouse IL-12R2 chain were kindly provided by Dr. D. Kioussis and Dr. U. Gubler, respectively (19, 20). MSCV retroviral vector was purchased from Clontech Laboratories (Palo Alto, CA) (21). FLAG epitope tag sequence was inserted before the stop codon of mouse IL-12R2 chain cDNA as previously described (18). Site-directed mutagenesis was performed using QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) as per the manufacturer’s protocol. Single tyrosine site to phenylalanine mutations (677F, 693F, 727F, 737–738F, 748F, 757F, 778F, 804F, 811F, and 866F) were introduced and confirmed by sequencing. The confirmed sequences were reinserted into mouse IL-12R2 chain cDNA together with a FLAG epitope by using nearby restriction enzyme sites, and the whole cDNAs with mutations thus obtained were subcloned further into a VAhCD2 minigene vector (EcoRI and SmaI) or a MSCV retroviral vector (EcoRI and HindIII (blunt ended by Klenow enzyme)). For multiple site-directed mutagenesis, sequential mutagenesis from tyrosine to phenylalanine was performed, confirmed by sequencing, and put back into mouse IL-12R2 chain cDNA with FLAG epitope by using unique restriction sites (NdeI (1960), BclI (2296), MscI (2506), and NotI). The sequences of final cDNAs were confirmed by sequencing, and the whole cDNAs thus obtained were subcloned into a VAhCD2 minigene vector or a MSCV retroviral vector.

Stable transfection

D10 cells were transfected as previously described (18). Briefly, D10 cells were electroporated with 20 µg linearized VAhCD2 minigene vectors with various IL-12R2 chain mutants and 1 µg pSV2neo, and 16 h later the cells were stimulated with Ag and 30-Gy irradiated syngeneic splenocytes. Forty-eight hours after stimulation the cells were plated into 96-well plates and selected by resistance to 500 µg/ml G418. Two weeks later the positive clones were screened by anti-FLAG Ab by Western blotting and/or anti-mouse IL-12R2 chain mAb by flow cytometry.

Retroviral gene transfer

The Phoenix-Eco packaging cell line was kindly provided by Dr. G. P. Nolan (22). Retroviral infection for IL-12R2 chain mutants were performed according to Dr. Nolan’s protocol. Briefly, 2 x 10⁶ Phoenix Eco cells were transfected with 5 µg MSCV retroviral vector with various IL-12R2 chain mutant cDNA by a CaPO₄ method. Forty-eight hours after transfection viral supernatants were harvested and Ag-stimulated primary mouse T cells were infected with supernatants including 2 µg/ml polybrene (Sigma-Aldrich, St. Louis, MO) by spin infection (1200 x g for 60 min); the infected cells were then incubated for 14 h at 32°C and incubated for an additional 10 h at 37°C. After one more infection procedure, cells were expanded with media with 50 U/ml human IL-2 and additional cytokines as described above.

Flow cytometry

Flow cytometry was performed as previously described (18). For mouse IL-12R2 chain staining, hamster anti-mouse IL-12R2 chain (PDL-HAM10B9) hamster anti-trinitrophenol mAb (BD PharMingen) was used. As a control for these labeled Abs, biotinylated goat anti-hamster IgG (H and L chains; Jackson ImmunoResearch Laboratories, West Grove, PA) and streptavidin PE (BD PharMingen) were used. To amplify the signal intensity of IL-12R2 chain expression in retroviral infection experiments, anti-streptavidin and streptavidin PE were added as described by Cohen et al. (23).

Western blotting

Immunoprecipitation Western blotting for STAT4 was performed as previously described (18). Western blotting for STAT3 was performed with anti-phosphorylated (Y705) STAT3 mAb (Santa Cruz Biotechnology, Santa Cruz, CA), HRP-conjugated anti-mouse IgG (Zymed Laboratories, San Francisco, CA), and SuperSignal West Femto Maximum Sensitivity Substrate (Pierce, Rockford, IL) to detect phosphorylated STAT3.

Real time RT-PCR (TaqMan)

Total RNA was isolated by STAT60 RNA isolation kit (Tel-Test, Friendswood, TX) using the manufacturer’s protocol. Reverse transcriptase reaction was performed with Superscriptase II (Life Technologies, Rockville, MD) with random primers. Real-time PCR was performed for 18S rRNA (PE Applied Biosystems, Foster City, CA), Pim-1 (probe, 5'-CCCTCCTTTGAAGAAATCCGG-3'; primers, 5'-TGTCCCTGAGACCGTCAGATC-3'and 5'-GCAGGAGGTCACCCTGCAT-3'), IL-18R1 (probe, CATGATCACACCTTGGAATTCTGGCCA; primers, 5'- AAGCTCGCCCAGAGTCACTTT-3' and 5'-ACGTTCCCTCATCCTCCATCT-3'), and IFN-regulating factor (IRF)³-1 (probe, 5'-CCTCCGAAGCCGCAACAGACG-3'; primers, 5'-GATAGCACCACTGATCTGTATAACCTACA-3' and 5'-TCTTCGGCTATCTTCCCTTCCT-3'). The expression level of these genes was measured by Ct method after justifying it by using serially diluted samples. The expression level was normalized by 18S rRNA and expressed as fold induction in comparison to that of STAT4^-/-CD4⁺ cells with IL-12R2 chain transgene primed in Th2 condition without IL-12 stimulation. The data shown were geometric means and SD of three independent experiments. Statistical analysis was performed by Student’s t test.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
STAT4 is required for Th1 differentiation irrespective of its role in the maintenance of IL-12R complex

In initial studies we determined the expression of IL-12R1 and 2 chains in STAT4^-/-CD4⁺ T cells stimulated under Th1 priming conditions. As shown in Fig. 1A, 5 days after stimulation of CD4⁺ T cells with Con A and APCs (in the presence of IL-12 and anti-IL-4) there was a 50% reduction in expression of the IL-12R1 chain in cells from STAT4^-/- mice as compared with STAT4^+/+ wild-type (WT) mice. In addition, such stimulation led to a 3-fold reduction in IL-12R2 chain expression in cells from STAT4^-/- vs STAT4^+/+ mice. Finally, as shown in Fig. 1B, this decreased receptor expression was functionally manifest as a major decrease in STAT3 phosphorylation. Similar results were obtained when cells from STAT4^-/- mice were stimulated with anti-CD3/anti-CD28, both with respect to 2 chain expression and STAT3 activation. In addition, in this case Janus kinase 2 activation was also determined and was shown to be decreased. Thus, as alluded to above, the failure of CD4⁺ T cells from STAT4^-/- mice to undergo Th1 differentiation could be due to a STAT4 effect on receptor expression rather than to a downstream effect on IFN- transcription.

View larger version (36K): [in this window] [in a new window]   FIGURE 1. A, IL-12R2 chain expression by CD4+ T cell lines (Th1 or Th2) derived from STAT4-/- mice. CD4+ T cells isolated from splenocytes of WT, IL-12R2 chain transgenic (IL-12R2Tg), STAT4-/-, and STAT4-/- mice with IL-12R2 transgene (STAT4-/-/IL-12R2Tg) mice were stimulated with Con A (2.5 µg/ml) plus IL-2 (50 U/ml) plus APCs either in the presence of IL-12 (2 ng/ml) plus anti-IL-4 mAb (20 µg/ml) (Th1) or in the presence of IL-4 (200 U/ml) (Th2). Three days after stimulation, cell lines were neutralized with -methyl mannoside (10 mg/ml) for 1 h, washed extensively, and expanded with additional cytokines and Abs. Two days later, IL-12R2 chain expression was examined by flow cytometry. Histograms of gated CD4+ cells (>98% CD4+) are shown. Data shown are representative of two independent experiments. B, STAT3 tyrosine phosphorylation of STAT4-/- mice with or without IL-12R2 chain transgene. CD4+ T cell lines from WT, IL-12R2 chain transgenic mice (2Tg), STAT4-/- mice, and STAT4-/- mice with IL-12R2 chain transgene (STAT4-/-/2Tg) were cultured under Th1 or Th2 conditions as mentioned above. At day 6, the cell lines obtained were stimulated with or without IL-12 (5 ng/ml), after which immunoprecipitation Western blotting for STAT3 was performed on whole cell lysates; 150 mg of whole lysates were loaded into each lane. C, Proliferation of STAT4-/- CD4+ T cell lines in response to IL-12. CD4+ T cell lines were generated as mentioned above. Six days after stimulation the cell lines were harvested, washed extensively, and recultured with varying concentration of IL-12 (0–10 ng/ml) for 24 h; cultures were pulsed with 1 µCi of [3H]thymidine during the last 6 h. Error bars indicate SD of triplicate cultures. Data shown are representative of two independent experiments.

Having thus established that we could replete IL-12R2 chain expression and IL-12 signaling in CD4⁺ T cells from STAT4^-/- mice with an IL-12R2 chain transgene, we determined whether the maintenance of IL-12R2 chain expression enabled these cells to differentiate into Th1 cells and to proliferate in response to IL-12. As shown in Table I, in T cells initially primed by Con A and APC under Th1 conditions and restimulated by plate-bound anti-CD3, Con A plus APCs, or IL-12 plus IL-18, IFN production is as low in cells from STAT4^-/- mice expressing an IL-12R2 transgene as in cells from STAT4^-/- mice not expressing this transgene, whereas both cells from STAT4^+/+ mice and cells from STAT4^+/+ mice bearing the IL-12R2 chain transgene secrete large amounts of IFN-. Similarly, as shown in Fig. 1C, whereas cells from STAT4^+/+ mice primed under Th1 conditions and then restimulated exhibit a dose-dependent increase in proliferation in the presence of IL-12 that is enhanced at each dose in cells from STAT4^+/+ mice bearing an IL-12R2 transgene, neither cells from STAT4^-/- mice nor cells from STAT4^-/- mice bearing an IL-12R2 transgene undergo proliferation in response to IL-12. The same situation is found with respect to cells primed under Th2 conditions; however, in this case, as might be expected, cells from STAT4^+/+ mice (lacking significant IL-12R2 chain expression) do not exhibit IL-12-induced proliferation, whereas cells from STAT4^+/+ mice bearing an IL-12R2 chain transgene do undergo dose-dependent IL-12-induced proliferation. In contrast, cells from STAT4^-/- mice do not undergo IL-12-induced proliferation whether or not they bear an IL-12R2 chain transgene. Taken together, these data provide strong evidence that STAT4 is essential for IL-12-induced Th1 differentiation and proliferation independent of its effect on IL-12R2 signaling.

View this table: [in this window] [in a new window]   Table I. IFN- production by STAT4-/-CD4+ cells expressing an IL-12R2 chain transgene cultured under Th1 conditionsa

Tyrosine residues on the cytoplasmic segment of the IL-12R2 chain involved in STAT3/STAT4 tyrosine phosphorylation. While the above data provide persuasive evidence supporting an essential role of STAT4 in Th1 differentiation, they are limited by their reliance on cells from STAT4^+/+ mice which could be developmentally impaired; in addition, they do not address the details of IL-12R2 chain-mediated STAT4 activation and how the latter relates to Th1 differentiation. On this basis we determined which of the tyrosine sites in the cytoplasmic region of the IL-12R2 chain is necessary for STAT4 (and STAT3) tyrosine phosphorylation and then, having determined these sites, we assessed their relation to STAT4 tyrosine phosphorylation and Th1 differentiation/proliferation (see Fig. 2A for a map of the cytoplasmic tyrosine sites in mouse and human IL-12R2 chains).

View larger version (27K): [in this window] [in a new window]   FIGURE 2. A, Schematic presentations of the mouse and human IL-12R2 chains. Cytoplasmic tyrosines of both chains are shown and counterpart tyrosines on mouse and human IL-12R2 chains are connected by dotted lines. Transmembrane region (TM), Box I, and Box II are also shown (19 ). B, IL-12R2 chain expression on D10 cells stably transfected with plasmid vectors encoding mouse IL-12R2 chain mutants with one cytoplasmic tyrosine mutated. Stably transfected D10 cells were stained with mouse IL-12R2 chain mAb (solid lines) and control mAb (dotted lines). 677F–866F indicate the position of the tyrosine(s) mutated to phenylalanine(s) (F), and AY indicates native mouse IL-12R2 chain (all tyrosines intact). D10 indicates parental D10 cells without transfection.

View larger version (68K): [in this window] [in a new window]   FIGURE 3. A and B, STAT4 (A) and STAT3 (B) tyrosine phosphorylation of D10 cells stably transfected with IL-12R2 chain mutants with one cytoplasmic tyrosine site mutated. After stripping, the blots were reprobed with anti-STAT Abs. At least two independent clones for each mutant were analyzed. C and D, STAT4 (C) and STAT3 (D) tyrosine phosphorylation of D10 cells stably transfected with IL-12R2 chain mutants with all cytoplasmic tyrosines mutated except a tyrosine at one site (677Y–866Y). AF indicates mouse IL-12R2 chain mutants with all tyrosine sites mutated, AY indicates native IL-12R2 chain, and D10 indicates nontransfected parental cells. At least two independent clones for each mutant were analyzed.

In parallel studies depicted in Fig. 3D, in which STAT3 (rather than STAT4) tyrosine phosphorylation was examined, we found that transfection of plasmids expressing IL-12R2 chains with single tyrosines at 737, 804, and 811 were capable of mediating STAT3 tyrosine phosphorylation upon IL-12 stimulation, whereas cells transfected with plasmids expressing a single tyrosine at position 757 were capable of mediating only very weak or no STAT3 phosphorylation. Thus, cytoplasmic IL-12R2 chain tyrosine sites involved in STAT3 phosphorylation differed from those involved in STAT4 phosphorylation at only one major site, tyrosine position 737.

Taken together, these studies show that the mouse IL-12R2 chain requires cytoplasmic tyrosines to transduce STAT4 and STAT3 tyrosine phosphorylation and that multiple cytoplasmic tyrosines are each capable of both STAT4 and STAT3 tyrosine phosphorylation.

The role of cytoplasmic IL-12R2 chain tyrosine phosphorylation in Th1 differentiation. Carrying our analyses further, we determined the relation of IL-12R2 chain tyrosine phosphorylation to Th1 differentiation. However, we could not use D10 cells because these are Th2 cells that produce very low amounts of IFN- even when reconstituted with a native IL-12R2 chain (18). To circumvent this problem, we used CD4⁺ T cells obtained from IL-12R2 chain knockout mice that also bear an OVA-specific TCR transgene and infected such cells with retroviruses expressing a native mouse IL-12R2 chain or, alternatively, a mutated IL-12R2 chain containing various phenylalaninetyrosine mutations. In each case, the cells were stimulated under Th1 conditions (Ag (OVA peptide, 3 µM) plus APCs plus IL-12 (2 ng/ml) plus IL-2 (50–100 U/ml)) and infected with retrovirus 1 day later; then, at day 6, they were restimulated with plate-bound anti-CD3, OVA peptide plus APCs, or IL-12 plus IL-18 to induce production of IFN-. As shown in the flow cytometry studies with anti-IL-12R2 chain mAb depicted in Fig. 4A, 23–41% of cells infected with retrovirus expressing native or mutated IL-12R2 chain expressed these chains on their cell surface, whereas cells infected with control retrovirus (i.e., retroviruses that did not express the IL-12R2 chain designated "vector") did not express the IL-12R2 chain on their cell surface. In addition, as shown in Table II, cells infected with retrovirus expressing native IL-12R2 chain (designated AY) produced considerable amounts of IFN-, whereas cells infected with control retrovirus (designated vector) produced low amounts of IFN-, i.e., amounts similar to that produced by uninfected cells; this result confirmed that our reconstitution could indeed lead to IL-12 signaling and induction of Th1 differentiation. As also shown in Table II, cells infected with a retrovirus expressing an IL-12R2 chain with no cytoplasmic tyrosines (and thus, as shown above, one that leads to no STAT4 phosphorylation), designated AF, produced low amounts of IFN- under any stimulation conditions. In addition, cells infected with retroviruses expressing IL-12R2 chains with tyrosines at positions 804 and 811 produced as much IFN- as those infected with a retrovirus expressing all tyrosines, whereas those infected with a retrovirus expressing a tyrosine at position 757 produced consistently less IFN- than those infected with a retrovirus expressing all tyrosines. Thus, the three tyrosine positions associated with IFN- secretion were the same as those responsible for STAT4 activation, and the magnitude of IFN- production associated with these tyrosine positions correlated with the magnitude of STAT4 tyrosine phosphorylation. Finally, it should be noted that cells infected with retroviruses with tyrosine at positions 727 or 737 and which were associated with weak STAT4 activation produced essentially the same amount of IFN- as cells infected with retroviruses with no tyrosines (AF). Thus, these tyrosines are not important for IFN- secretion. We also infected cells with retroviruses expressing IL-12R2 chains with a tyrosinephenylalanine mutation at only one of the cytoplasmic tyrosine positions of the 2 chain. As shown in Table III, infection with these retroviruses resulted in cells producing considerably more IFN- than cells infected with control retroviruses. In addition, a retrovirus expressing a IL-12R2 chain mutated only at tyrosine 811 was the sole mutant with a single tyrosinephenylalanine mutation that gave rise to a cell producing less IFN- than cells infected with a retrovirus expressing a native 2 chain. These results indicate that, whereas Th1 differentiation, like STAT4 phosphorylation, is not dependent on a single tyrosine site, IL-12R2 cytoplasmic tyrosine at position 811 is a dominant site for STAT4-mediated IFN- production, especially when the induction is mediated only by cytokine.

View larger version (29K): [in this window] [in a new window]   FIGURE 4. A, IL-12R2 chain expression on CD4+ cell lines from IL-12R2 chain-/- TCR-transgenic DO11.10 mice infected with retroviruses expressing mouse IL-12R2 chain mutants with all but one cytoplasmic tyrosine sites mutated. Nomenclature of mutants is the same as indicated in Fig. 5. "Vector" indicates cells infected with control retrovirus (retrovirus without IL-12R2 chain cDNA) and "Non-infected" indicates cells not infected with a retrovirus. CD4+ cells from IL-12R2 chain-/- DO11.10 mice were primed with Ag plus APCs plus IL-12 (2 ng/ml) plus IL-2 (50 U/ml). Staining was amplified with anti-streptavidin and streptavidin PE (see Materials and Methods). Approximately 23–41% of CD4+ cells were positive for IL-12R2 chain expression. Data shown are representative of three independent experiments. B, IL-12-induced proliferation of CD4+ cell lines from IL-12R2 chain-/- TCR-transgenic DO11.10 mice infected with retroviruses expressing mouse IL-12R2 chain mutants. Six days after priming (see Materials and Methods) cell lines were harvested, washed extensively, and sorted by flow cytometry with anti-IL-12R2 chain mAb (vector-infected cells were not sorted). IL-12R2 chain-positive cells were recultured with varying concentration of IL-12 (0–10 ng/ml) for 24 h; cultures were pulsed with 1 µCi of [3H]thymidine during the last 6 h. Error bars indicate SD of triplicate cultures. C, Cells infected with retroviruses expressing IL-12R2 chain mutants with all but one cytoplasmic tyrosines mutated. Nomenclature of mutants is the same as indicated in Figs. 2 and 3. Data shown are representative of two independent experiments.

View this table: [in this window] [in a new window]   Table II. IFN- production by IL-12R2 chain-deficient CD4+ cells infected with retroviruses expressing IL-12R2 chain mutants with only one cytoplasmic tyrosine, with no cytoplasmic tyrosines, or expressing a native IL-12R2 chaina

View this table: [in this window] [in a new window]   Table III. IFN- production by IL-12R2 chain-deficient CD4+ cells infected with retroviruses expressing IL-12R2 chain mutants with a single cytoplasmic tyrosine mutation or expressing a native IL-12R2 chaina

The role of the IL-12R2 chain tyrosines in CD4⁺ T cell proliferation. In parallel studies also using retroviral infected cells, we determined the relation of IL-12R2 cytoplasmic tyrosines on CD4⁺ T cell proliferation. One difference between these studies and the previous studies of IFN- secretion is that in this case the cells were initially primed under Th2 conditions with IL-4 (200 U/ml) to obviate the negative effect of IFN- on cell proliferation. As shown in Fig. 4B, the results were similar to those relating to IFN- production in that infection with a retrovirus expressing a native IL-12R2 chain (AY) exhibited a very substantial increase in proliferation in response to IL-12, whereas cells infected with a control retrovirus exhibited no increase in proliferation in response to IL-12 (vector). Furthermore, cells infected with a retrovirus expressing an IL-12R2 chain with no cytoplasmic tyrosines exhibited minimal IL-12-induced proliferation, although slight increases in proliferation were noted with increasing IL-12 concentrations (AF). Finally, cells infected with retroviruses expressing an IL-12R2 chain having a single tyrosine at position 811 exhibited even greater IL-12-induced proliferation than cells infected with a retrovirus expressing a native IL-12R2 chain, and cells infected with retroviruses at a number of other positions also exhibited substantial IL-12-induced proliferation. These studies showed that tyrosines critical to IL-12-induced IFN- production are also critical to IL-12-induced proliferation. However, in the case of IL-12-induced proliferation, the presence of tyrosines at other tyrosine sites led to a 2 chain able to support some level of proliferation. As discussed below, this suggests that nonphosphorylated STAT4 may contribute to cell viability or that IL-12R2-mediated phosphorylation of another STAT can mediate cell proliferation.

In separate studies we also studied IL-12-induced proliferation in cells infected with retroviruses expressing IL-12R2 chain with only a single tyrosine deletion. As shown in Fig. 4C, all cells of this type exhibited as much IL-12-induced proliferation as cells infected with a retrovirus expressing IL-12R2 chain with no tyrosine deletions (AY), with the exception of cells infected with retrovirus having a mutation at position 811, which consistently exhibited less proliferation. This suggests that, while no single tyrosine site is critical for IL-12-induced proliferation, the tyrosine site at position 811 is a dominant site for proliferation, as it is for IFN- secretion.

IL-12-inducible genes independent of STAT4

While the above data show that IL-12-induced Th1 differentiation and proliferation are dependent on STAT4, other IL-12-inducible genes may not require STAT4. To explore this question we returned to the cell system in which STAT4^+/+ and STAT4^-/- IL-12R2 chain transgenic T cells are stimulated with IL-12. However, in this case we determined the ability of these cells to up-regulate several genes known to be responsive to IL-12 signaling, including Pim-1, IRF-1, IL-18R1, c-Myc (27, 28, 29), and CD25 (30). In these studies, CD25 was measured by flow cytometry, and PIM-1, IRF-1, IL-18R1, and c-Myc expression was determined by quantitative mRNA analysis (see Materials and Methods). As shown in Table IV, we found that Pim-1, IRF-1, IL-18R1, and c-Myc were not induced by IL-12 in the absence of STAT4 in cells primed under Th1 conditions. However, Pim-1 and IRF-1 were induced in the absence of STAT4 in cells primed under Th2 conditions, although in the case of Pim-1 such induction was less in the absence of STAT4 than in its presence. As shown in Fig. 5, a similar study conducted with respect to CD25 (in this case measured by flow cytometry) demonstrated that IL-12 did not up-regulate CD25 under either Th1 or Th2 conditions. These studies indicate that the up-regulation of some genes (PIM-1 and IRF-1) by IL-12 is independent of STAT4 under certain conditions, although such up-regulation is suboptimal.

View this table: [in this window] [in a new window]   Table IV. IL-12-inducible genes in STAT4-/-CD4+ cells bearing an IL-12R2 chain transgenea

View larger version (22K): [in this window] [in a new window]   FIGURE 5. CD25 up-regulation induced by IL-12 in the presence or absence of STAT4 proteins. IL-12R2 chain transgenic CD4+ cells and STAT4-/-CD4+ cells with IL-12 R2 transgene were primed under the Th1 and Th2 conditions described in Fig. 1, harvested, washed extensively at 5 days after priming, and recultured with (solid lines) or without (dotted lines) mouse IL-12 (5 ng/ml). Twenty-four hours later CD25 staining was performed by flow cytometry.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

In one approach to this question, we generated STAT4^-/- mice that express a transgenic IL-12R2 chain at levels comparable to that in WT cells and showed that such cells are nevertheless incapable of undergoing IL-12-induced Th1 differentiation. In a second and complementary approach that did not rely on cells from a STAT4^-/- mouse (that could conceivably be generally impaired), we showed that repletion of cells from IL-12R2 chain^-/- mice with an IL-12R2 chain lacking cytoplasmic tyrosines involved in STAT4 activation (i.e., lacking all cytoplasmic tyrosines or lacking tyrosines at sites shown to be necessary for STAT4 activation) are unable to undergo Th1 differentiation, whereas repletion of these cells with an IL-12R2 containing cytoplasmic tyrosines involved in STAT4 activation (i.e., unmutated 2 chains or 2 chains mutated at sites shown to be unnecessary for STAT4 activation) led to normal Th1 differentiation. Thus, the presence of an IL-12R2 chain unable to transduce STAT4 activation but still able to transduce other signals (such as STAT3 activation) is insufficient for Th1 differentiation. Overall, then, these interlocking data sets prove that, in addition to its necessary role in optimal IL-12R2 chain expression and signaling, activated STAT4 plays an essential downstream role in Th1 differentiation that is ultimately manifested as IFN- production and Th1 cell proliferation. It should be noted that this conclusion is entirely compatible with the fact that in humans Th1 differentiation can occur as a result of IFN- signaling which uses a receptor that is independent of STAT4 activation because it has been shown that it in this situation STAT4 is activated indirectly via STAT2 (32, 33).

In recent studies Mullen et al. (8) have marshaled evidence that the transcription factor T-bet is induced upon cell activation in the absence of STAT4 and that such induction leads to substantial STAT4-independent IFN- production. In addition, provision of cells with exogenous T-bet via a T-bet-expressing retrovirus leads to up-regulation of the IL-12R2 chain (8). On this basis, Mullen et al. (8) suggested that T-bet, rather than IL-12/STAT4, determines the initial Th1 cellular program and that the IL-12/STAT4 pathway serves a more downstream role involving the maintenance of Th1 cell growth and survival. The data presented here are somewhat at odds with those conclusions for at least two reasons. First, we showed in contradistinction to the findings of Mullen et al. (8) that the amount of IFN- production is quite minimal in the absence of IL-12/STAT4 signaling, consistent with the fact that the STAT4^-/- mice exhibit greatly reduced Th1 responses in vivo (13). This discrepancy may be due to differences in the type and level of in vitro cell stimulation in the two studies because we have found that the stimulation of cells with Con A and APCs as used in this study is far more dependent on STAT4 than is stimulation of cells with anti-CD3/CD28, as used in the study of Mullen et al. (8). In addition, the data on IFN- production in cells from STAT4^+/+ and STAT4^-/- mice in the study by Mullen et al. (8) do reveal very considerable differences if strength of signal as well as number of positive cells are considered. Second, we showed that, while the IL-12R1 and 2 chains are expressed in STAT4^-/- cells, such expression is reduced, and this leads to reduced IL-12 signaling as measured by STAT3 phosphorylation. Furthermore, we showed that cells bearing a transgenic 2 chain and thus independent of T-bet-induced 2 chain expression still fail to produce IFN- in the absence of STAT4. Overall, our data are more consistent with the view that under physiologic stimulation conditions (in which cells are stimulated with Ag and APCs or Con A and APCs) the IL-12/STAT4 pathway has a central role in Th1 differentiation, which manifests itself both at the level of IL-12R expression and at the level of IFN- production. In addition, while T-bet may be associated with such differentiation, it cannot act in the absence of STAT4 even early in the differentiation process. This view is strongly supported by recent studies showing that T-bet induction requires STAT1 signaling which, in turn, is dependent on IFN- production, presumably arising from the IL-12/STAT4 pathway (34, 35). However, it remains possible that the importance of the IL-12/STAT4 pathway in IFN- production is diminished under maximal stimulation conditions not often encountered in vivo.

The data in this study concerning STAT4 tyrosine phosphorylation derived from the study of murine cells differs somewhat from those derived from human cells. Thus, in a previous study of human cells, Naeger et al. (24) reported that 293 cells transfected with human IL-12R1 and IL-12R2 chains as well as STAT3 and STAT4 that STAT4 binding to an activation site on the 2 chain occurs at only one of three tyrosine sites (position 800); moreover, in a reporter assay using an IRF-1 promoter linked to lucerifase, mutant 2 chains in which the tyrosine at position 800 is mutated were unable to transduce a reporter signal, whereas mutated 2 chains in which the other two tyrosines were mutated induced normal reporter signals (23). Naeger et al. (24) concluded that the ability of STAT4 to specifically bind to pLYPSNID, i.e., the peptide in the neighborhood of position 800 on the 2 chain, accounts for the specificity of the 2 chain/STAT4 interaction. The results reported here are different in that they show that, in mice, STAT4 is activated and becomes functional at 3 of 10 cytoplasmic tyrosine sites. Two of these, those with the strongest activation potential (804 and 811), have sequence homology to the human site mentioned above; indeed, the mouse 811 tyrosine site, which most clearly corresponds to the human 800 position, is the site that provides the most robust STAT4 activation and function. However, in our studies of mouse cells, STAT4 also becomes functionally activated by tyrosine 757, albeit it to a lesser extent than at tyrosines 804 and 811. This site is not structurally similar to the human site. One possible reason for this difference in the studies of human and mouse IL-12R2 chain is that the human study was conducted with mouse STAT4 constructs and human IL-12R2 chain constructs; however, this is unlikely because the human and mouse STAT4 molecules are 91% identical in their amino acid residues. Another possibility, and one that we favor, is that the difference is real, and in mice STAT4 activation is more "promiscuous" than in human cells. Moreover, such promiscuity provides a selective advantage to mice because a genetic abnormality at a single site in the IL-12R2 chain does not result in cessation of IL-12 signaling. In humans, this advantage is less necessary because STAT4 can be alternatively activated via STAT2, as already mentioned.

Another difference between the study of Naeger et al. (24) and our own study of the IL-12R2 chain relating to the activation of STATs is that in the study of the human IL-12R2 chain STAT3 activation was not detected, whereas in our studies stimulation of cells via IL-12R2 chain is associated with robust STAT3 activation. Our observation in mice raises the possibility that STAT3 tyrosine phosphorylation is dependent on STAT4 tyrosine phosphorylation (or vice versa), but this does not seem likely because STAT4 and STAT3 activation are discrepant with respect to several activation sites. Finally, it should be noted that the close interrelation between STAT4 and STAT3 activation in these studies of murine cells is not a technical artifact due to Ab cross-reactions in the STAT3 and STAT4 immunoprecipitation studies, because these Abs did not cross-react in a Western blotting experiment in which STAT3 is immunoprecipitated and probed with STAT4 (and vice versa) and gel mobility of STAT3 and STAT4 in SDS-PAGE can be differentiated (data not shown).

It is clear from these studies that, while there are multiple sites of STAT4 activation in the intracytoplasmic murine IL-12R2 chain, mutation of all sites leads to complete loss of STAT4 activation and function. However, even if tyrosine sites may be necessary for STAT4 activation and function, they may not be sufficient. This is suggested by our own prior data, which show that IL-12 induces STAT4 phosphorylation on serine 721 and that mutation of serine 721 leads to reduced STAT4 transcriptional activity (12, 36). Furthermore, we have shown that such serine phosphorylation is mediated by p38 and its upstream activator mitogen-activated protein kinase kinase 6 (12).

The relation of the various tyrosine sites to IL-12/IL-12R2 chain-mediated proliferation was parallel to IFN- production in that, again, single tyrosines at positions 757, 804, and 811 were able to support IL-12-stimulated proliferation. However, in this case there was a considerable discrepancy between the ability of a given mutated IL-12R2 chain with a single tyrosine to phosphorylate STAT4 and to support proliferation. In addition, cells transfected with a mutated IL-12R2 chain that contains no tyrosines able to support phosphorylation of STAT4 exhibited a greater capacity to undergo IL-12-induced proliferation than STAT4^-/- cells. One possible explanation of these findings suggested by the fact that the presence of nonphosphorylated STAT1 rescues cells from apoptosis (37) is that nonphosphorylated STAT4 mediates some degree of cell proliferation. A second possibility is that tyrosines unable to support phosphorylation of STAT4 are able to support phosphorylation of another STAT, such as STAT5, which mediates some degree of cell proliferation. This is suggested by the observation of Ahn et al. (38), who showed that IL-12- and IL-2-responsive T cell clones exist which exhibit a large or small capacity to produce IFN-, respectively, yet manifest comparable levels of proliferation; in addition, they showed that while an IL-12-dependent clone manifested both STAT4 and STAT5 phosphorylation, an IL-2-dependent clone exhibited STAT5 but not STAT4 phosphorylation. Thus, the authors attributed the proliferation-inducing function of IL-12R2 chain signaling to STAT5 and not to STAT4. A similar conclusion was drawn from a study of BaF3 cells transfected with constructs expressing the IL-12R1 and 2 chains and expressing very little STAT4, which nevertheless display IL-12-induced proliferation (39). It should be noted that the results of these various studies differ from those of the present studies in which the importance of STAT4 activation for proliferation was clearly evident. This discrepancy can be resolved if we assume that, while STAT5 can mediate robust IL-12R2 chain-induced proliferation in particular cell lines, in normal cells STAT4 is necessary for the full expression of this function. This view is compatible with the observation that STAT4 cells bearing an IL-12R2 chain transgene exhibit very little IL-12-induced proliferation (Fig. 3).

If indeed a key function of STAT4 lies downstream of its facilitation of IL-12 signaling (as the data gathered here imply), what is this latter function? Studies by Barbulescu et al. (15) mentioned earlier show that the IFN- gene does have a STAT4 binding site and that mutation of this site abrogates IFN- transcription induced by IL-12 but only slightly inhibits IFN- transcription induced by IL-18, which depends on an AP-1 site. These data thus show that STAT4 is necessary, if not sufficient, for IFN- transcription. Studies by Mullen et al. (8) mentioned above and showing that STAT4 acts in concert with CREB to induce IFN- transcription also support this conclusion (8). Another and perhaps equally important downstream function of STAT4 is its likely role in IL-12-related cell viability and protection from apoptosis. Thus, as shown in previous studies, administration of anti-IL-12 to mice with Th1-induced inflammation results in massive Fas-mediated apoptosis (40). The mechanism of this downstream effect of IL-12/IL-12R2 signaling here has yet to be discovered.

	Acknowledgments

 
We thank Dr. Judy Hewitt and the staff of the National Institute of Allergy and Infectious Diseases transgenic facility for their help in constructing IL-12R2 chain transgenic mice and maintaining the transgenic mouse colony. We also thank S. Kaul and L. Utterback for their secretarial assistance.

	Footnotes

 
¹ Current address: Department of Pediatrics, Kyoto University Hospital, 54 Shogoin Kawaharo-cho, Sakyo, Kyoto 606-8507, Japan.

² Address correspondence and reprint requests to Dr. Warren Strober, Mucosal Immunity Section, Laboratory of Clinical Investigation, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892-1890. E-mail address: wstrober{at}niaid.nih.gov

³ Abbreviations used in this paper: IRF, IFN-regulating factor; WT, wild type.

Received for publication November 1, 2001. Accepted for publication August 12, 2002.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Mosmann, T. R., H. Cherwinski, M. Bond, M. A. Giedlin, R. Coffman. 1986. Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J. Immunol. 136:2348.[Abstract]
2. Murphy, K. M., W. Ouyang, S. J. Szabo, N. G. Jacobson, M. L. Guler, J. D. Gorham, U. Gubler, T. L. Murphy. 1999. T helper differentiation proceeds through STAT1-dependent, STAT4-dependent and STAT4-independent phases. Curr. Top. Microbiol. Immunol. 238:13.[Medline]
3. Magram, J., S. E. Connaughton, R. R. Warrier, D. M. Darvajal, C. Y. Wu, J. Ferrante, C. Stewart, U. Sarmiento, D. A. Faherty, M. K. Gately. 1996. IL-12-deficient mice are defective in IFN production and type 1 cytokine response. Immunity 4:471.[Medline]
4. Wu, C., J. Ferrante, M. K. Gately, J. Magram. 1997. Characterization of IL-12 receptor 1 chain (IL-12R1)-deficient mice: IL-12R1 is an essential component of the functional mouse IL-12 receptor. J. Immunol. 159:1658.[Abstract]
5. Wu, C., X. Wang, M. Gadina, J. J. O’Shea, D. H. Presky, J. Magram. 2000. IL-12 receptor 2 (IL-12R2)-deficient mice are defective in IL-12-mediated signaling despite the presence of high-affinity IL-12 binding sites. J. Immunol. 165:6221.[Abstract/Free Full Text]
6. Rogge, L., L. Barberis-Maino, M. Biffi, N. Passini, D. H. Presky, U. Gubler, F. Sinigaglia. 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185:825.[Abstract/Free Full Text]
7. Szabo, S. J., A. S. Dighe, U. Gubler, K. M. Murphy. 1997. Regulation of the interleukin (IL)-12R2 subunit expression in developing T helper 1 (Th1) and Th2 cells. J. Exp. Med. 185:817.[Abstract/Free Full Text]
8. Mullen, A. C., F. A. High, A. S. Hutchins, H. W. Lee, A. B. Villarino, D. M. Livingston, A. L. Kung, N. Cereb, T. P. Yao, S. Y. Yang, S. L. Reiner. 2001. Role of T-bet in commitment of Th1 cells before IL-12-dependent selection. Science 292:1907.[Abstract/Free Full Text]
9. Szabo, S. J., S. T. Kim, G. L. Costa, X. Zhang, C. G. Fathman, L. H. Glimcher. 2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 100:655.[Medline]
10. Gollob, J. A., E. A. Murphy, S. Mahajan, C. P. Schnipper, J. Ritz, D. A. Frank. 1998. Altered interleukin-12 responsiveness in Th1 and Th2 cells is associated with the differential activation of STAT5 and STAT1. Blood 91:1341.[Abstract/Free Full Text]
11. Jacobson, N. G., S. J. Szabo, R. M. Weber-Nordt, Z. Zhong, R. D. Schreiber, J. E. Darnell, Jr, K. M. Murphy. 1995. Interleukin 12 signaling in T helper type 1 (Th1) cells involves tyrosine phosphorylation of signal transducer and activator of transcription (STAT3) and STAT4. J. Exp. Med. 181:1755.[Abstract/Free Full Text]
12. Visconti, R., M. Gadina, M. Chiarello, E. H. Chen, L. F. Stancato, J. S. Gutkind, J. J. O’Shea. 2000. Importance of the MKK6/p38 pathway for interleukin-12-induced STAT4 serine phosphorylation and transcriptional activity. Blood 96:1844.[Abstract/Free Full Text]
13. Kaplan, M. H., Y. L. Sun, T. Hoey, M. J. Grusby. 1996. Impaired IL-12 responses and enhanced development of Th2 cells in STAT4-deficient mice. Nature 382:174.[Medline]
14. Thierfelder, W. E., J. M. van Deursen, K. Yamamoto, R. A. Tripp, S. R. Sarawar, R. T. Carson, M. Y. Sangster, D. A. Vignali, P. C. Doherty, G. C. Grosveld, J. N. Ihle. 1996. Requirement for STAT4 in interleukin-12-mediated responses of natural killer and T cells. Nature 382:171.[Medline]
15. Barbulescu, K., C. Becker, J. F. Schlaak, E. Schmitt, K. H. Meyer zum Buschenfelde, M. F. Neurath. 1998. IL-12 and IL-18 differentially regulate the transcriptional activity of the human IFN- promoter in primary CD4⁺ T lymphocytes. J. Immunol. 160:3652.
16. Xu, X., Y. L. Sun, T. Hoey. 1996. Cooperative DNA binding and sequence-selective recognition conferred by the STAT amino-terminal domain. Science 273:794.[Abstract]
17. Lawless, V. A., S. Zhang, O. N. Ozes, H. A. Bruns, I. Oldham, T. Hoey, M. J. Grusby, M. H. Kaplan. 2000. STAT4 regulates multiple components of IFN--inducing signaling pathways. J. Immunol. 165:6803.[Abstract/Free Full Text]
18. Nishikomori, R., R. O. Ehrhardt, W. Strober. 2000. T helper type 2 cell differentiation occurs in the presence of interleukin 12 receptor 2 chain expression and signaling. J. Exp. Med. 191:847.[Abstract/Free Full Text]
19. Presky, D. H., H. Yang, L. J. Minetti, A. O. Chua, N. Nabavi, C. Y. Wu, M. K. Gately, U. Gubler. 1996. A functional interleukin 12 receptor complex is composed of two -type cytokine receptor units. Proc. Natl. Acad. Sci. USA 93:14002.[Abstract/Free Full Text]
20. Zhumabekov, T., P. Corbella, M. Tolaini, D. Kioussis. 1995. Improved version of a human CD2 minigene based vector for T cell-specific expression in transgenic mice. J. Immunol. Methods 185:133.[Medline]
21. Hawley, R. G., F. H. Lieu, A. Z. Fong, T. S. Hawley. 1994. Versatile retroviral vectors for potential use in gene therapy. Gene Ther. 1:136.[Medline]
22. Kinoshita, S., I. Su, M. Amano, L. A. Timmerman, H. Kaneshima, G. P. Nolan. 1997. The T cell activation factor NF-Atc positively regulates HIV-1 replication and gene expression in T cells. Immunity 6:235.[Medline]
23. Cohen, J. H., J. P. Aubry, M. H. Jouvin, J. Wijdenes, J. Bancherau, M. Kazatchkine, J. P. Revillard. 1987. Enumeration of CR1 complement receptors on erythrocytes using a new method for detecting low density cell surface antigens by flow cytometry. J. Immunol. Methods 99:53.[Medline]
24. Naeger, L. K., J. McKinney, A. Salvekar, T. Hoey. 1999. Identification of a STAT4 binding site in the interleukin-12 receptor required for signaling. J. Biol. Chem. 274:1875.[Abstract/Free Full Text]
25. Yao, B. B., P. Niu, C. S. Surowy, C. R. Faltynek. 1999. Direct interaction of STAT4 with the IL-12 receptor. Arch. Biochem. Biophys. 368:147.[Medline]
26. Fujitani, Y., M. Hibi, T. Fukada, M. Takahashi-Tezuka, H. Yoshida, T. Yamaguchi, K. Sugiyama, Y. Yamanaka, K. Nakajima, T. Hirano. 1997. An alternative pathway for STAT activation that is mediated by the direct interaction between JAK and STAT. Oncogene 14:751.[Medline]
27. Galon, J., C. Sudarshan, S. Ito, D. Finbloom, J. J. O’Shea. 1999. IL-12 induces IFN regulating factor-1 (IRF-1) gene expression in human NK and T cells. J. Immunol. 162:7256.[Abstract/Free Full Text]
28. Matikainen, S., T. Saraneva, T. Ronni, A. Lehtonen, P. J. Koskinen, I. Jukkunen. 1999. Interferon- activates multiple STAT proteins and upregulates proliferation-associated IL-2R, c-myc, and pim-1 genes in human T cells. Blood 93:1980