The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hernández-Munain, C.
Right arrow Articles by Krangel, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hernández-Munain, C.
Right arrow Articles by Krangel, M. S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
The Journal of Immunology, 2002, 169: 4362-4369.
Copyright © 2002 by The American Association of Immunologists

Distinct Roles for c-Myb and Core Binding Factor/Polyoma Enhancer-Binding Protein 2 in the Assembly and Function of a Multiprotein Complex on the TCR {delta} Enhancer In Vivo1

Cristina Hernández-Munain2,* and Michael S. Krangel{dagger}

* Basel Institute for Immunology, Basel, Switzerland; and {dagger} Department of Immunology, Duke University Medical Center, Durham, NC 27710


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Enhancers and promoters within TCR loci functionally collaborate to modify chromatin structure and to confer accessibility to the transcription and V(D)J recombination machineries during T cell development in the thymus. Two enhancers at the TCR{alpha}{delta} locus, the TCR {alpha} enhancer and the TCR {delta} enhancer (E{delta}), are responsible for orchestrating the distinct developmental programs for V(D)J recombination and transcription of the TCR {alpha} and {delta} genes, respectively. E{delta} function depends critically on transcription factors core binding factor (CBF)/polyoma enhancer-binding protein 2 (PEBP2) and c-Myb as measured by transcriptional activation of transiently transfected substrates in Jurkat cells, and by activation of V(D)J recombination within chromatin-integrated substrates in transgenic mice. To understand the molecular mechanisms for synergy between these transcription factors in the context of chromatin, we used in vivo footprinting to study the requirements for protein binding to E{delta} within wild-type and mutant versions of a human TCR {delta} minilocus in stably transfected Jurkat cells. Our data indicate that CBF/PEBP2 plays primarily a structural role as it induces a conformational change in the enhanceosome that is associated with augmented binding of c-Myb. In contrast, c-Myb has no apparent affect on CBF/PEBP2 binding, but is critical for transcriptional activation. Thus, our data reveal distinct functions for c-Myb and CBF/PEBP2 in the assembly and function of an E{delta} enhanceosome in the context of chromatin in vivo.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The activation of transcription and V(D)J recombination is strictly regulated during T cell ontogeny in the thymus, and occurs at the CD4-CD8- (DN)3 stage for the TCR {beta}, {gamma}, and {delta} genes, and at the CD4+CD8+ (DP) stage for the TCR {alpha} gene (1). Enhancers and promoters within the TCR loci functionally collaborate to modify chromatin structure in a lineage-specific, locus-specific, and developmental stage-specific manner, thereby imparting developmental control to the processes of transcription and V(D)J recombination (1, 2, 3, 4). They do so by binding unique combinations of ubiquitous and cell- and stage-specific transcription factors.

The disparate temporal programs of TCR {delta} and TCR {alpha} gene rearrangement during thymocyte development are particularly notable because the TCR {delta} gene is embedded within the TCR {alpha} gene (5). The unique genomic structure of the TCR{alpha}{delta} locus dictates that the TCR {delta} gene is deleted from the chromosome upon V{alpha} to J{alpha} recombination at the DP stage. This process irreversibly commits DP thymocytes to the {alpha}{beta}-T cell lineage. Because of these properties, the locus represents an interesting model to study developmental stage-specific regulation of transcription and V(D)J recombination. Two enhancers at the TCR{alpha}{delta} locus, TCR {alpha} enhancer (E{alpha}) and TCR {delta} enhancer (E{delta}), are responsible for orchestrating the distinct developmental programs for V(D)J recombination and transcription of the TCR {alpha} and {delta} genes (6, 7, 8). During thymocyte development, E{alpha} is "off" and E{delta} is "on" at the DN stage, whereas E{alpha} is on and E{delta} is off at the DP stage (7). These observations provide the foundation for a model in which these two enhancers work as a "developmental switch" for the activation of transcription and V(D)J recombination at the TCR{alpha}{delta} locus.

E{delta} function has been analyzed at the level of transcription within transiently transfected reporter constructs in Jurkat cells and at the level of V(D)J recombination within chromatin-integrated substrates in transgenic mice. These studies have demonstrated a critical synergism between core binding factor (CBF)/polyoma enhancer-binding protein 2 (PEBP2), a member of the Runx family of transcription factors, and c-Myb, bound to two precisely spaced binding sites within the {delta}E3 element of the human E{delta} (9, 10, 11). To understand the molecular mechanism for functional synergy between CBF/PEBP2 and c-Myb, we previously performed a detailed analysis of binding of these factors in vitro, and found that they appear to bind independently, rather than cooperatively, to DNA (12). These data led to a model in which synergy between these transcription factors may result from their ability to form a composite surface that makes simultaneous and stereospecific contacts with additional components of the transcriptional machinery.

To activate transcription in vivo, transcription factors must be able to overcome the repressive effects of chromatin to bind to their specific DNA-binding sites. To establish the molecular basis for synergy between CBF/PEBP2 and c-Myb at E{delta} in vivo, we have analyzed the requirements for factor binding to this enhancer by genomic footprinting and DNase I hypersensitivity. In contrast to previous in vitro studies (12), we found that these transcription factors do not independently occupy their sites in E{delta} in a native chromatin context. Rather, protein binding to the CBF/PEBP2 site appears to induce a conformational change in the {delta}E3,4 enhanceosome that is associated with elevated c-Myb binding. CBF/PEBP2 appears to play primarily a structural role, as it appears not to be required for transcriptional activation per se. In contrast, c-Myb has no apparent effect on CBF/PEBP2 binding, but is critical for the activation of enhancer-dependent transcription. Thus, c-Myb and CBF/PEBP2 appear to play distinct roles in the assembly and function of an E{delta} enhanceosome within chromatin in vivo.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells

The human {alpha}{beta} T leukemia cell line Jurkat, the human {gamma}{delta} T leukemia cell line Molt-13 and the human B cell leukemia cell line Raji were grown in RPMI 1640 medium (Life Technologies, Gaithersburg, MD) supplemented with 10% FCS (Atlanta Biologicals, Norcross, GA) and penicillin-streptomycin (Cellgro-Mediatech, Herndon, VA).

Stable transfections

A total of 5–20 x 106 Jurkat cells were resuspended in 400 µl of complete medium, and kept on ice for 15 min. Cells were then electroporated at 400 µF and 230 V using 10–20 µg of KpnI-linearized and ethanol-precipitated TCR {delta} minilocus DNA, and 1–2 µg of XbaI-linearized and ethanol-precipitated pFNeo plasmid. Cells were kept for 15 min on ice after electroporation, diluted in 6 ml of complete medium in 30-mm2 plates, and incubated for 24–48 h before selection. Transfected cells were selected by adding 1–1.5 mg/ml of gentamicin. After a week of selection, surviving cells were isolated by Ficoll filtration and cloned at 1 cell/well in 96-well plates. Positive clones were detected on slot blots using 5 µg of purified DNA, and transgene copy number was determined by genomic DNA analysis, comparing with tail DNAs from previously identified single-copy transgenic mice. Slot blots were probed with a radiolabeled C{delta} fragment and the resultant hybridization signals were quantified using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA). Independent clones were identified by Southern blot of BamHI digested genomic DNA and a {alpha}-32P-labeled V{delta}1 probe (13). Structure of the transgenes were examinated by sequential hybridizations of these same Southern blots with {alpha}-32P-labeled V{delta}2 and J{delta}3 probes, and by PCR amplifications of J{delta}3, J{delta}1, and C{delta}-containing minilocus regions.

Genomic footprinting

Genomic footprinting was performed as described (14). Oligonucleotides for E{delta} top-strand analysis were GCTGAGAAGCTCAACTAAAAGACTG, CTGATTCTGTTTCAGTCACTCAGGGC, and CTGTTTCAGTCACTCAGGGCAGGAAAC. Those for E{delta} bottom-strand analysis were TATCCAACTAAATCAGACCAGGATTAAG, TAACTTGTAACTCCCTTGAAAGTCAGCC, and CCCTTGAAAGTCAGCCAGAGTATGTCTC.

DNase I hypersensitivity assays

DNase I hypersensitivity assays were performed as previously described with minor modifications (7, 15). Briefly, cells were washed twice in PBS and permeabilized by incubation with 0.067 mg/ml of lysolecithin in buffer C (0.15 M sucrose, 80 mM KCl, 5 mM MgCl2, 0.5 mM CaCl2, and 30 mM HEPES pH 7.4) for 4 min at room temperature. Cell suspensions were incubated in a water-ice bath for 5 min before transferring them to an ice bath for DNase I (Worthington Biochemical, Freehold, NJ) treatments. DNase I was then added and digestions were incubated for 10 min on ice. Reactions were stopped by adding EDTA (pH 8) to a final concentration of 10 mM. Cells were lysed by incubating them at 37°C for 16 h in the presence of 0.4 mg/ml of proteinase K and 0.4% of SDS. Purified DNA was digested with SacI, electrophoresed through a 0.9% agarose gel, transferred to a nylon membrane (Micron Separations, Westboro, MA), and hybridized with a {alpha}-32P-labeled 1.1-kb J{delta}3 genomic fragment as previously described (15).

Northern blot

Total RNA samples were isolated from transfected cells as described (16). Purified RNA (10 µg/sample) was electrophoresed through a 1.5% agarose gel containing 2.2 M formaldehyde and transferred to a nylon membrane (Micron Separations), and sequentially hybridized with {alpha}-32P-labeled C{delta} and GAPDH DNA probes.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Analysis of wild-type human E{delta} occupancy in vivo by genomic footprinting

To elucidate the molecular basis for functional synergism between the proteins that bind to E{delta}, we decided to study the requirements for factor binding to this enhancer in vivo by genomic footprinting. This technique allows one to detect protein-DNA contacts in vivo at single nucleotide resolution. For this purpose, genomic DNA was treated with dimethylsulfate (DMS) either as naked DNA in vitro or as chromatin in live cells. DMS methylates accessible guanines at the N7 position and, less efficiently, adenines at the N3 position. Sites of methylation were mapped by ligation-mediated PCR and, by comparing the methylation patterns in the two samples, footprints indicating occupied DNA binding sites in vivo were identified.

We first analyzed in vivo transcription factor binding to the endogenous human E{delta} in the human {gamma}{delta} T cell line Molt-13 (Fig. 1GoA). This analysis revealed clear and strong occupancy of all previously identified and functionally relevant binding sites for transcription factors within the enhancer. Protein binding to the CBF/PEBP2 and c-Myb binding sites within {delta}E3 was comparable to that previously observed in the analysis of the endogenous murine E{delta} in DN thymocytes (7). Occupancy of the CBF/PEBP2 binding site was visualized as two protected guanines on the top strand. Occupancy of the c-Myb binding site was detected as one protected guanine and one lightly hypersensitive adenine on the top strand, and one protected guanine and one hypersensitive guanine on the bottom strand. In addition to the {delta}E3 binding sites, occupancy of the two GATA-3 binding sites present in the human {delta}E4 element was also clearly detected (17, 18, 19). The upstream GATA-3 binding site was visualized as one protected guanine and one hypersensitive guanine on the bottom strand, whereas the downstream GATA-3 site was detected as one protected guanine on the bottom strand. A summary of the footprints obtained from the analysis of E{delta} occupancy in Molt-13 cells is presented in Fig. 1GoB. As expected from the T cell-specific expression of E{delta} binding proteins (9, 17, 18, 19, 20, 21), in vivo E{delta} occupancy was T cell-specific and no footprints were detected in the human B cell line Raji (data not shown).



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 1. Analysis of in vivo occupancy of the endogenous human E{delta} by genomic footprinting and diagram of the transfected TCR {delta} minilocus. A, Top- and bottom-strand analyses of the endogenous human E{delta}. Molt-13 cell DNA was methylated with DMS either as naked (N) DNA in vitro or as chromosomal (c) DNA in intact cells in vivo. Methylated DNA samples were treated with piperidine and subjected to ligation-mediated PCR. Protected guanines are indicated by plain arrows; hypersensitive guanines, as well as a barely detectable hypersensitive adenine, are indicated by tagged (with a dot) arrows. Protein binding sites are indicated by brackets. B, Summary of protected and hypersensitive nucleotides within the human E{delta}. The {delta}E3 and {delta}E4 regions defined by in vitro footprinting (20 ) are indicated by double lines. Human E{delta} accession no. at National Center for Biotechnology Information is M33967. C, Structure of stably transfected minilocus contructs. Human TCR {delta} gene minilocus containing wild-type or mutant versions of the human E{delta} have been described (10 11 22 ). {blacksquare}, Exons; {square}, protein binding sites.

 
To assess the hierarchy of protein binding to E{delta} in a homogenous cell population, we studied the occupancy of wild-type and mutant forms of E{delta} in chromosomally integrated templates in stably transfected Jurkat cells. This human {alpha}{beta} T cell line has been used extensively for the study of E{delta} structure and function (9, 20, 21). Of note, because the endogenous TCR {delta} gene has been deleted by TCR {alpha} gene rearrangement, there is no endogenous enhancer to interfere with the analysis of a transfected E{delta} in these cells. We generated stably transfected Jurkat cell clones using our previously characterized unrearranged human TCR {delta} minilocus containing either wild-type or mutant E{delta}s (10, 11, 22) (Fig. 1GoC). This 22-kb construct consists of unrearranged V{delta}1, V{delta}2, D{delta}3, J{delta}1, and J{delta}3 gene segments, C{delta}, and E{delta} in its natural intronic location. The generation of fully rearranged VDJ products within this construct in transgenic thymocytes is E{delta}-driven and depends on the presence of an intact E{delta}, because introduction of point mutations in either the c-Myb or the CBF/PEBP2 binding site abrogates the ability of E{delta} to activate V(D)J recombination (10, 11). We obtained four different transfected clones carrying a TCR {delta} minilocus with a wild-type E{delta}. These clones were denoted W2, W6, W7, and W70. W2 carries a single copy of the transgene that is truncated at the 5' end, W7 and W70 carry two copies of the transgene, and W6 carries four copies of the transgene. Analysis E{delta} occupancy in these clones revealed footprints indistinguishable from those obtained in occupancy analysis of the endogenous E{delta} in Molt-13 cells (see Figs. 1GoA, 2, 3, and 4). Thus, transgene integration into ectopic sites does not significantly perturb E{delta} occupancy.

Occupancy of the CBF/PEBP2 binding site is required for a distinct {delta}E3,4 enhanceosome conformation and enhanced c-Myb binding

To investigate the molecular basis for functional synergy between CBF/PEBP2 and c-Myb, we compared the in vivo occupancy of wild-type and mutant versions of E{delta} by genomic footprinting. Previous studies of enhancer mutants mMyb and mCore (Fig. 1GoC) revealed the mutations to abrogate the binding of c-Myb and CBF/PEBP2, respectively, as determined by EMSA, and to eliminate both enhancer-dependent activation of transcription in transiently transfected Jurkat cells and V(D)J recombination in transgenic mice (9, 10, 11, 21). We obtained five different stably transfected cell clones containing the human TCR {delta} minilocus with an E{delta}mMyb and four different clones with an E{delta}mCore. Transfectants containing E{delta}mMyb were denoted M3, M20, M36, M53, and M62, and those containing E{delta}mCore were denoted C63, C64, C74, and C81. C81 carries a single copy of the transgene that is truncated at the 5' end. C63, C64, M3, M20, M36, and M53 carry two copies of the transgene, C74 carries four copies of the transgene, and M62 carries eight copies of the transgene.

We first analyzed in vivo enhancer occupancy in the transfectants carrying E{delta}mMyb (see Fig. 3Go). Taking into account loading differences among the various lanes, we found no evidence of occupancy of the mutated c-Myb binding site. However, the CBF/PEBP2 binding site was clearly occupied in the presence of the c-Myb site mutation (see Fig. 3Go). These results are consistent with our previous in vitro binding studies, which indicated independent binding of c-Myb and CBF/PEBP2 to E{delta} (12). Similarly, protected guanines over the two GATA-3 sites were indistinguishable from those detected within wild-type E{delta}-containing clones (Figs. 2Go and 3Go). Although the hypersensitive guanine on the bottom strand of the upstream GATA-3 binding site was less obvious in M53 and M62 in the experiment shown in Fig. 3Go, hypersensitivity at this site was confirmed in other analyses of the same clones (data not shown). Thus, our data indicates that binding of c-Myb to E{delta} is not required for CBF/PEBP2 and GATA-3 to gain access to and stably occupy their DNA binding sites within the enhancer. In agreement with in vitro experiments (Ref. 12 and data not shown), both CBF/PEBP2 and GATA-3 can bind independently of c-Myb to the enhancer in vivo.



View larger version (66K):
[in this window]
[in a new window]
 
FIGURE 3. Occupancy of the c-Myb binding site is not required for CBF/PEBP2 and GATA-3 binding to E{delta}. Stably transfected Jurkat cell DNA samples were analyzed by genomic footprinting as naked (N) DNA in vitro or chromosomal (c) DNA in vivo. Protected guanines are indicated by plain arrows, and hypersensitive nucleotides are indicated by tagged (with a dot) arrows. Protein binding sites are indicated by brackets.

 


View larger version (72K):
[in this window]
[in a new window]
 
FIGURE 2. Analysis of in vivo occupancy of the transfected wild-type human E{delta} by genomic footprinting. Stably transfected Jurkat cell DNA samples were analyzed by genomic footprinting as naked (N) DNA in vitro or chromosomal (c) DNA in vivo. Protected guanines are indicated by plain arrows, and hypersensitive nucleotides are indicated by tagged (with a dot) arrows. Protein binding sites are indicated by brackets.

 
In contrast to the above analysis, genomic footprinting of E{delta}mCore transfectants revealed unexpected results. In the absence of CBF/PEBP2 binding, footprints over the c-Myb binding site were partially inhibited, as judged by the diminished protection of top- and bottom-strand guanines (Fig. 4Go). Moreover, although the hypersensitive adenine on the top strand of the c-Myb site was present in all E{delta}mCore clones, the bottom-strand hypersensitive guanine was absent. In addition, although protection of the bottom-strand guanine over the upstream GATA-3 sites was present in all the E{delta}mCore clones, the hypersensitive bottom-strand guanine over this site was absent (Fig. 4Go). No change in footprinting was detected at the downstream GATA-3 site.



View larger version (48K):
[in this window]
[in a new window]
 
FIGURE 4. Occupancy of the CBF/PEBP2 binding site is required for normal occupancy of the c-Myb and GATA-3 binding sites within E{delta}. Stably transfected Jurkat cell DNA samples were analyzed by genomic footprinting as naked (N) DNA in vitro or chromosomal (c) DNA in vivo. Protected guanines are indicated by plain arrows, and hypersensitive nucleotides are indicated by tagged (with a dot) arrows. Protein binding sites are indicated by brackets.

 
We interpret reduced protection of guanines at the c-Myb site to reflect a lower average level of binding site occupancy within the cell population analyzed, presumably a consequence of lower affinity c-Myb binding. Thus, CBF/PEBP2 appears to be required for high level occupancy of the c-Myb site, although it seems likely that significant c-Myb binding occurs even in the absence of CBF/PEBP2. These results are in contrast with those obtained from the analysis of protein binding to the enhancer in vitro, which revealed occupancy of the c-Myb and CBF/PEBP2 sites to be completely independent (12).

The hypersensitive guanines at the edges of the c-Myb and upstream GATA-3 sites should reflect a unique DNA conformation that renders these nucleotides particularly accessible to DMS. Therefore, we interpret the loss of these hypersensitive nucleotides in the absence of CBF/PEBP2 to mean that this conformation has been disrupted. Because the GATA-3 site hypersensitivity is retained in E{delta}mMyb but not in E{delta}mCore, it is not a consequence of GATA-3 binding per se, but rather of binding of GATA-3 together with CBF/PEBP2. Similarly, because E{delta}mCore displays residual c-Myb binding but lacks the c-Myb site hypersensitivity, the c-Myb site hypersensitivity must require simultaneous binding of c-Myb and CBF/PEBP2, rather than binding of c-Myb alone. Thus, CBF/PEBP2 appears to play a unique and central role in the assembly of a multiprotein complex on the enhancer by coordinating a distinct conformation for the {delta}E3,4 enhanceosome, and by promoting elevated occupancy of the c-Myb site.

DNase I hypersensitive sites (HSs) result from local distortions of the canonical nucleosomal structure due to binding of transcription factors (23). To confirm the results of genomic footprinting analysis, we analyzed chromatin structure over the enhancer and surrounding areas by DNase I digestion. For this purpose, transfected clones containing wild-type or mutant versions of E{delta} were permeabilized with lysolecithin and treated with increasing amounts of DNase I. DNA was then purified and digested with SacI for Southern blot analysis, as previously described (15). A 1.1-kb J{delta}3 probe detected the predicted 10-kb SacI DNA fragment in all clones (Fig. 5Go). Clones W6, M53, M62, and C63 also displayed one or two strong clone-specific bands that are presumably a consequence of truncations at the 3' end of one transgene copy (Fig. 5Go). These truncations do not affect detection of HSs because the probe detects the 5' end of the SacI fragment and the truncations occur 3' of all HSs. Several clear DNase I HSs were found in the analysis of the transfected clones containing a wild-type enhancer (Fig. 5Go). The strongest mapped to E{delta}, presumably reflecting chromatin distortion due to protein binding at the {delta}E3 and {delta}E4 elements (denoted {delta}E3/4 HS). This HS is lineage-specific because it was detected at the endogenous locus in Molt-13 but not in Raji cells (data not shown). Two additional very clear HSs (Fig. 5Go, arrows) seem to map to two described matrix-attachment regions (MARs) that flank E{delta} (24). In addition, we detected an HS located upstream of the J{delta}3 gene segment, which may identify a promoter associated with transcription and recombination of this segment (denoted 5' J{delta}3). Identical results were obtained for all transfectants containing the wild-type E{delta} (Fig. 5Go and data not shown).



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 5. Analysis of chromatin structure over E{delta} and surrounding areas by DNase I digestion. Transfected Jurkat cell DNAs containing wild-type or mutant E{delta}s were digested with DNase I in permeabilized cells. DNA samples (10 µg) were digested with SacI, electrophoresed through 0.9% agarose gels, and analyzed on Southern blots probed with a {alpha}-32P-labeled 1.1-kb J{delta}3 genomic fragment (15 ). The DNase I-HS over E{delta} is labeled as {delta}E3/4, DNase I-HSs over E{delta} flanking regions are indicated by arrows, and the DNase I-HS upstream of J{delta}3 is labeled as 5' J{delta}3. Size markers (in kilobases) are indicated at the left.

 
The arrays of HSs in E{delta}mMyb transfectants were identical with those in wild-type transfectants (Fig. 5Go). The {delta}E3/4 HS is presumably a consequence of normal binding of CBF/PEBP2 and GATA-3. These results are consistent with those obtained by genomic footprinting analysis of the mutant enhancer, and suggest that similar local distortions of chromatin are present in both E{delta} and E{delta}mMyb. However, different results were obtained from analysis of transfectants containing E{delta}mCore (Fig. 5Go). A diminished {delta}E3/4 HS signal was detected in E{delta}mCore clones C63 and C74 (Fig. 5Go), and no signal was detected in clones C64 and C81 (data not shown). Diminution of the {delta}E3/4 HS in E{delta}mCore as compared with E{delta}mMyb or E{delta} clones is highly reproducible and can be readily judged with reference to the HSs associated with flanking MARs (Fig. 5Go and data not shown). These data are consistent with the diminished protections and altered conformational properties of the mutant enhancer detected by in vivo footprinting, and indicate that a mutation in the CBF/PEBP2 binding site results in a chromatin structure that is distinct from that conferred by either a wild-type E{delta} or E{delta}mMyb.

The CBF/PEBP2 binding site is dispensable for enhancer-dependent transcriptional activation in Jurkat transfectants

To analyze the functional effects of mutations in the c-Myb and CBF/PEBP2 binding sites in this system, we measured transcription in the transfected clones by Northern blotting (Fig. 6Go). Previous functional analysis of TCR {delta} minilocus transgenic mice demonstrated the presence of two independently regulated domains within the construct (22). The 5' domain contains the V{delta} and D{delta} gene segments and rearranges independently of E{delta}, whereas the 3' domain contains the J{delta} gene segments and C{delta} region and rearranges only in the presence of an intact E{delta}. Hence, as a measurement of E{delta}-dependent transcription, we analyzed C{delta} transcripts which are dependent on the presence of an active enhancer within the minilocus (15). As controls, we analyzed C{delta} transcripts derived from the endogenous TCR {delta} gene in Molt-13 and Jurkat cells, and from the TCR {delta} minilocus in cells from the mouse transgenic lines A and recombination-activating gene 2-/- x A (R x A) (3, 22) (Fig. 6Go). As expected, high levels of C{delta} transcripts were found in Molt-13 cells, whereas no C{delta} transcripts were detected in Jurkat cells. Previous data demonstrated that E{delta} function is down-regulated at the transition from DN to DP thymocytes (7). Consistent with this, high levels of transcription were detected in thymocytes of line R x A, which contains only DN cells (3), low levels of transcription were detected in total thymocytes from line A, which contains mostly DP cells, and no transcription was detected {alpha}{beta} T cells from line A.



View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 6. Analysis of minilocus transcription by Northern blot. Stable transfectant RNA samples were analyzed on Northern blots hybridized with {alpha}-32P-labeled C{delta} and glyceraldehyde-3-phosphate dehydrogenase probes. As controls, C{delta} transcripts derived from the endogenous TCR {delta} gene in Molt-13 and Jurkat cells, and from the TCR {delta} minilocus in cells from the transgenic mouse lines A and R x A were analyzed (3 22 ). Filled and open arrowheads indicate differentially polyadenylated transcripts originating from VDJ rearranged and germline templates, respectively. The open arrowhead labeled with an asterisk indicates the major transcript detected in the transfectant clones.

 
Recent data indicate that most C{delta} transcripts detected in minilocus transfectants of Jurkat initiate upstream of J{delta}3 (J. Carabaña and M. S. Krangel, unpublished observations), probably driven by a promoter located 5' of the J{delta}3 gene segment (Fig. 5Go). Three of three transfectants carrying a wild-type E{delta} minilocus with an intact J{delta}3 5' region displayed clear evidence for C{delta} transcripts (Fig. 6Go). Similar results were obtained for four additional wild-type transfectants (J. Carabaña and M. S. Krangel, unpublished observations). However, C{delta} transcripts were not detected in four of five E{delta}mMyb clones (Fig. 6Go). The outlier, M62, may have a minilocus integration site that is near an active enhancer. These results confirm that c-Myb binding is critical for E{delta} function, and that CBF/PEBP2 and GATA-3 binding is not sufficient for activity.

In contrast to the results obtained from the analysis of E{delta}mMyb clones, C{delta} transcripts were clearly detected in all E{delta}mCore clones containing an intact J{delta}3 5' region (Fig. 6Go). Furthermore, the levels of C{delta} transcription detected in these clones were roughly similar to those detected in wild-type clones. Thus, binding of c-Myb to E{delta} is required for transcriptional activation, whereas binding of CBF/PEBP2 is not. Although average occupancy of the c-Myb site is somewhat reduced in the absence of CBF/PEBP2, these results indicate that transcriptional activation occurs normally in those cells in which c-Myb is bound and occurs independent of the CBF/PEBP2-dependent conformational change in the {delta}E3,4 enhanceosome. Thus, the data reveal distinct functions for CBF/PEBP2 and c-Myb, with CBF/PEBP2 playing primarily a structural role, and c-Myb required for transcriptional activation.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To regulate gene expression, CBF/PEBP2 must function in a context-dependent fashion by cooperating with other transcription factors (25). However, the molecular mechanisms responsible for functional collaboration between CBF/PEBP2 and c-Myb seem distinct from those responsible for collaboration between CBF/PEBP2 and other functional partners. For example, CBF/PEBP2 has been shown to physically interact with all of its functional partners except c-Myb (26, 27, 28, 29, 30). Moreover, CBF/PEBP2 binds cooperatively to naked DNA with Ets-1 or C/EBP in vitro (28, 31), but does not do so with c-Myb (12, 32). We previously suggested an alternative model to explain functional synergy between CBF/PEBP2 and c-Myb in which the two transcription factors were required to form a composite transactivation surface that contacts additional components of the transcriptional machinery (12). However, chromatin structure may impose distinct requirements on the binding of transcription factors to DNA. Accordingly, we found that CBF/PEBP2 and c-Myb binding to E{delta} within chromatin does not occur independently, and that CBF/PEBP2 both stimulates the binding of c-Myb and plays a central structural role in the assembly of an appropriately configured {delta}E3,4 enhanceosome. We suggest that a similar interplay between CBF/PEBP2 and c-Myb might occur at other elements regulated by this pair of factors, such as E{gamma} (33, 34), the long-terminal repeats of murine leukemia viruses (35), and the myeloperoxidase promoter (32), and might occur between CBF/PEBP2 and other transcription factors, as recently suggested for CBF/PEBP2 and a vitamin D-responsive transcription factor at the rat osteocalcin promoter (36).

Transcription factors use several molecular mechanisms to stably occupy their binding sites within chromatin. Previous in vitro analysis has demonstrated that binding of disparate transcription factors to nucleosomal DNA is inherently cooperative (37, 38). Polach and Widom (38) proposed a theoretical model that explains how regulatory proteins that bind independently to naked DNA might bind with reciprocal cooperativity to nucleosomal target sites. They suggest that nucleosomes are dynamic structures that transiently expose factor binding sites with the exposed configuration stabilized by the binding of multiple factors to the same nucleosome. Because our data suggest that CBF/PEBP2 promotes c-Myb occupancy but that c-Myb does not impact CBF/PEBP2 occupancy, cooperativity in this case does not appear to be reciprocal.

In some cases, a specific factor plays a critical role in initiating the assembly of a functional multiprotein complex (39, 40). This is the case for inducible transcription factors such as nuclear receptors. The hierarchy of factor binding depends on the position of binding sites with respect to the nucleosome surface (37, 41, 42, 43). Thus, binding of one transcription factor to a peripheral site on a nucleosome may induce a structural change that stimulates the binding of additional factors to internal sites on the same nucleosome. Therefore, CBF/PEBP2 might bind at the edge of a precisely positioned nucleosome and stimulate access to the c-Myb site in this manner.

A specific factor may also play a critical role in coordinating the assembly of a functional multiprotein complex. This is the case for structural proteins such as HMG-I at the {beta}-IFN enhancer and T cell-specific factor-1/lymphoid enhancer-binding factor-1 at E{alpha} (26, 44, 45). Recent crystal structure analysis of the CBF/PEBP2-DNA complex revealed an interaction of CBF/PEBP2{alpha} with the minor groove that induces a DNA bend of ~20° around the last base of the consensus binding-site TGTGGTT (46). This is consistent with an inherent structural role for CBF/PEBP2 and provides another possible mechanism for the ability of CBF/PEBP2 to potentiate c-Myb binding.

CBF/PEBP2 might also promote binding of other factors in vivo by recruiting specific chromatin modifying activities, such as histone acetyl transferases and ATP-dependent remodeling complexes, that themselves may facilitate factor binding to nucleosomal DNA (47, 48, 49, 50, 51, 52). In this regard, it has been demonstrated that CBF/PEBP2 recruits the histone acetyl transferases p300 and CBP (53). Moreover, an intact E{delta} CBF/PEBP2 site is required to promote histone H3 acetylation across the TCR {delta} minilocus in transgenic mice (3).

CBF/PEBP2 not only stimulates the binding of c-Myb, but also stimulates the appearance of hypersensitive guanines that flank the c-Myb and upstream GATA-3 sites. A perturbed DNA conformation at the edges of the c-Myb and GATA-3 binding sites could depend on CBF/PEBP2-induced DNA bending, on direct interactions between CBF/PEBP2 and GATA-3, or on coactivator-mediated interactions among CBF/PEBP2, GATA-3, and c-Myb. The unique enhanceosome structure defined by these hypersensitive guanines might in turn play a direct role in stabilizing the binding of c-Myb.

Our data suggest that transcription requires c-Myb but not CBF/PEBP2, and occurs normally on those alleles that bind c-Myb in the absence of CBF/PEBP2. The fact that the CBF/PEBP2 site mutation has no apparent effect on transcription even though it results in diminished c-Myb binding probably reflects an effect on c-Myb binding that is less dramatic than variations in transcriptional activity due to copy number and integration site heterogeneity.

The fact that the c-Myb site but not the CBF/PEBP2 site mutation inhibits transcription in stably transfected Jurkat contrasts with our results in transgenic mice in which both mutations have dramatic effects on V(D)J recombination within the same set of constructs. This might suggest different requirements for transcription and V(D)J recombination, but the results must be interpreted cautiously as they may reflect differences in the milieus of transcription factors, coactivators, and chromatin modifying activities in Jurkat cells and DN thymocytes. Finally, we note an apparent discrepancy between our transcription data in transiently (9, 21) vs stably transfected Jurkat cells. CBF/PEBP2 binding seems important for transcription in the former, but not the latter. The distinct chromatin states in transient and stable transfectants might contribute to this difference (54, 55). Alternatively, transcription may be influenced by other cis-acting elements with which E{delta} interacts and that differ between the two test constructs (i.e., promoters, MARs). Additional experiments in which the chromatin structural environments or associated cis-acting elements are systematically varied will be required to address this issue in greater detail.


    Acknowledgments
 
We thank Nadège Balmelle-Devaux for her excellent technical assistance, Susan Gilfillan, Fraser McBlane, and Carlos Suñé for critical reading of the manuscript, and Juan Carabaña for communicating unpublished data.


    Footnotes
 
1 This work was supported by Hoffman-LaRoche and National Institutes of Health Grant GM41052. The Basel Institute for Immunology was founded and supported by Hoffman-LaRoche. Back

2 Address correspondence and reprint requests to Dr. Cristina Hernández-Munain, Edificio de Biologicas, Lab C-210, Centro de Biología Molecular, Universidad Autónoma de Madrid, Cantoblanco, 28007 Madrid, Spain. E-mail address: chmunain{at}cbm.uam.es Back

3 Abbreviations used in this paper: DN, CD4-CD8- thymocytes; DP, CD4+CD8+ thymocytes; CBF, core binding factor; DMS, dimethylsulfate; E{alpha}, TCR {alpha} enhancer; E{delta}, TCR {delta} enhancer; HS, hypersensitive site; MAR, matrix-attachment region; PEBP2, polyoma enhancer-binding protein 2; R x A, recombination-activating gene 2-/- x A. Back

Received for publication April 11, 2002. Accepted for publication August 5, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Sleckman, B. P., J. R. Gorman, F. W. Alt. 1996. Accessibility control of antigen-receptor variable-region gene assembly: role of cis-acting elements. Annu. Rev. Immunol. 14:459.[Medline]
  2. Hernández-Munain, C., M. T. McMurry, M. S. Krangel. 1999. Regulation of chromatin accessibility for V(D)J recombination. Cold Spring Harb. Symp. Quant. Biol. 64:183.[Medline]
  3. McMurry, M. T., M. S. Krangel. 2000. A role for histone acetylation in the developmental regulation of VDJ recombination. Science 287:495.[Abstract/Free Full Text]
  4. Krangel, M. S.. 2001. V(D)J recombination becomes accessible. J. Exp. Med. 193:F27.
  5. Krangel, M. S., C. Hernández-Munain, P. Lauzurica, M. McMurry, J. L. Roberts, X. P. Zhong. 1998. Developmental regulation of V(D)J recombination at the TCR {alpha}/{delta} locus. Immunol. Rev. 165:131.[Medline]
  6. Sleckman, B. P., C. G. Bardon, R. Ferrini, L. Davidson, F. W. Alt. 1997. Function of the TCR {alpha} enhancer in {alpha}{beta} and {gamma}{delta} T cells. Immunity 7:505.[Medline]
  7. Hernández-Munain, C., B. P. Sleckman, M. S. Krangel. 1999. A developmental switch from TCR {delta} enhancer to TCR {alpha} enhancer function during thymocyte maturation. Immunity 10:723.[Medline]
  8. Monroe, R. J., B. P. Sleckman, B. C. Monroe, B. Khor, S. Claypool, R. Ferrini, L. Davidson, F. W. Alt. 1999. Developmental regulation of TCR {delta} locus accessibility and expression by the TCR {delta} enhancer. Immunity 10:503.[Medline]
  9. Hernández-Munain, C., M. S. Krangel. 1994. Regulation of the T-cell receptor {delta} enhancer by functional cooperation between c-Myb and core-binding factors. Mol. Cell Biol. 14:473.[Abstract/Free Full Text]
  10. Hernández-Munain, C., P. Lauzurica, M. S. Krangel. 1996. Regulation of T cell receptor {delta} gene rearrangement by c-Myb. J. Exp. Med. 183:289.[Abstract/Free Full Text]
  11. Lauzurica, P., X. P. Zhong, M. S. Krangel, J. L. Roberts. 1997. Regulation of T cell receptor {delta} gene rearrangement by CBF/PEBP2. J. Exp. Med. 185:1193.[Abstract/Free Full Text]
  12. Hernández-Munain, C., M. S. Krangel. 1995. c-Myb and core-binding factor/PEBP2 display functional synergy but bind independently to adjacent sites in the T-cell receptor {delta} enhancer. Mol. Cell Biol. 15:3090.[Abstract]
  13. Hata, S., M. B. Brenner, M. S. Krangel. 1987. Identification of putative human T cell receptor {delta} complementary DNA clones. Science 238:678.[Abstract/Free Full Text]
  14. Mueller, P. R., P. A. Garrity, B. Wold. 1992. Ligation-mediated PCR for genomic sequencing and footprinting. F. M. Ausubel, and R. Brent, and R. E. Kingston, and D. D. Moore, and J. G. Seidman, and J. A. Smith, and K. Struhl, eds. Current Protocols in Molecular Biology 1. Wiley, New York.
  15. Hernández-Munain, C., J. L. Roberts, M. S. Krangel. 1998. Cooperation among multiple transcription factors is required for access to minimal T-cell receptor {alpha}-enhancer chromatin in vivo. Mol. Cell Biol. 18:3223.[Abstract/Free Full Text]
  16. Chomezynski, P., N. Saachi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156.[Medline]
  17. Joulin, V., D. Bories, J. F. Eleouet, M. C. Labastie, S. Chretien, M. G. Mattei, P. H. Romeo. 1991. A T-cell specific TCR {delta} DNA binding protein is a member of the human GATA family. EMBO J. 10:1809.[Medline]
  18. Ko, L. J., M. Yamamoto, M. W. Leonard, K. M. George, P. Ting, J. D. Engel. 1991. Murine and human T-lymphocyte GATA-3 factors mediate transcription through a cis-regulatory element within the human T-cell receptor {delta} gene enhancer. Mol. Cell Biol. 11:2778.[Abstract/Free Full Text]
  19. Marine, J., A. Winoto. 1991. The human enhancer-binding protein Gata3 binds to several T-cell receptor regulatory elements. Proc. Natl. Acad. Sci. USA 88:7284.[Abstract/Free Full Text]
  20. Redondo, J. M., S. Hata, C. Brocklehurst, M. S. Krangel. 1990. A T cell-specific transcriptional enhancer within the human T cell receptor {delta} locus. Science 247:1225.[Abstract/Free Full Text]
  21. Redondo, J. M., J. L. Pfohl, M. S. Krangel. 1991. Identification of an essential site for transcriptional activation within the human T-cell receptor {delta} enhancer. Mol. Cell Biol. 11:5671.[Abstract/Free Full Text]
  22. Lauzurica, P., M. S. Krangel. 1994. Enhancer-dependent and -independent steps in the rearrangement of a human T cell receptor {delta} transgene. J. Exp. Med. 179:43.[Abstract/Free Full Text]
  23. Gross, D. S., W. T. Garrard. 1988. Nuclease hypersensitive sites in chromatin. Annu. Rev. Biochem. 57:159.[Medline]
  24. Zhong, X. P., J. Carabaña, M. S. Krangel. 1999. Flanking nuclear matrix attachment regions synergize with the T cell receptor {delta} enhancer to promote V(D)J recombination. Proc. Natl. Acad. Sci. USA 96:11970.[Abstract/Free Full Text]
  25. Ito, Y.. 1999. Molecular basis of tissue-specific gene expression mediated by the runt domain transcription factor PEBP2/CBF. Genes Cells 4:685.[Abstract]
  26. Giese, K., C. Kingsley, J. R. Kirshner, R. Grosschedl. 1995. Assembly and function of a TCR {alpha} enhancer complex is dependent on LEF-1-induced DNA bending and multiple protein-protein interactions. Genes Dev. 9:995.[Abstract/Free Full Text]
  27. Zhang, D. E., C. J. Hetherington, S. Meyers, K. L. Rhoades, C. J. Larson, H. M. Chen, S. W. Hiebert, D. G. Tenen. 1996. CCAAT enhancer-binding protein (C/EBP) and AML1 (CBF{alpha}2) synergistically activate the macrophage colony-stimulating factor receptor promoter. Mol. Cell Biol. 16:1231.[Abstract]
  28. Petrovick, M. S., S. W. Hiebert, A. D. Friedman, C. J. Hetherington, D. G. Tenen, D. E. Zhang. 1998. Multiple functional domains of AML1: PU.1 and C/EBP{alpha} synergize with different regions of AML1. Mol. Cell Biol. 18:3915.[Abstract/Free Full Text]
  29. Hanai, J., L. F. Chen, T. Kanno, N. Ohtani-Fujita, W. Y. Kim, W. H. Guo, T. Imamura, Y. Ishidou, M. Fukuchi, M. J. Shi, et al 1999. Interaction and functional cooperation of PEBP2/CBF with Smads: synergistic induction of the immunoglobulin germline C{alpha} promoter. J. Biol. Chem. 274:31577.[Abstract/Free Full Text]
  30. Ogihara, H., T. Kanno, E. Morii, D. K. Kim, Y. M. Lee, M. Sato, W. Y. Kim, S. Nomura, Y. Ito, Y. Kitamura. 1999. Synergy of PEBP2/CBF with mi transcription factor (MITF) for transactivation of mouse mast cell protease 6 gene. Oncogene 18:4632.[Medline]
  31. Wotton, D., J. Ghysdael, S. Wang, N. A. Speck, M. J. Owen. 1994. Cooperative binding of Ets-1 and core binding factor to DNA. Mol. Cell Biol. 14:840.[Abstract/Free Full Text]
  32. Britos-Bray, M., A. D. Friedman. 1997. Core binding factor cannot synergistically activate the myeloperoxidase proximal enhancer in immature cells without c-Myb. Mol. Cell. Biol. 17:5127.[Abstract]
  33. Hsiang, Y. H., D. Spencer, S. Wang, N. A. Speck, D. H. Raulet. 1993. The role of viral enhancer "core" motif-related sequences in regulating T cell receptor-{gamma} and -{delta} gene expression. J. Immunol. 150:3905.[Abstract]
  34. Hsiang, Y. H., J. P. Goldman, D. H. Raulet. 1995. The role of c-Myb or a related factor in regulating the T cell receptor {gamma} gene enhancer. J. Immunol. 154:5195.[Abstract]
  35. Zaiman, A. L., J. Lenz. 1996. Transcriptional activation of a retrovirus enhancer by CBF (AML1) requires a second factor: evidence for cooperativity with c-Myb. J. Virol. 70:5618.[Abstract/Free Full Text]
  36. Javed, A., S. Gutiérrez, M. Montecino, A. J. van Wijnen, J. L. Stein, G. S. Stein, J. B. Lian. 1999. Multiple Cbfa/AML sites in the rat osteocalcin promoter are required for basal and vitamin D-responsive transcription and contribute to chromatin organization. Mol. Cell Biol. 19:7491.[Abstract/Free Full Text]
  37. Adams, C. C., J. L. Workman. 1995. Binding of disparate transcriptional activators to nucleosomal DNA is inherently cooperative. Mol. Cell Biol. 15:1405.[Abstract]
  38. Polach, K. J., J. Widom. 1996. A model for the cooperative binding of eukaryotic regulatory proteins to nucleosomal target sites. J. Mol. Biol. 258:800.[Medline]
  39. Beato, M., K. Eisfeld. 1997. Transcription factor access to chromatin. Nucleic Acids Res. 25:3559.[Abstract/Free Full Text]
  40. Li, Q., O. Wrange, P. Eriksson. 1997. The role of chromatin in transcriptional regulation. Int. J. Biochem. Cell Biol. 29:731.[Medline]
  41. Archer, T. K., M. G. Cordingley, R. G. Wolford, G. L. Hager. 1991. Transcription factor access is mediated by accurately positioned nucleosomes on the mouse mammary tumor virus promoter. Mol. Cell Biol. 11:688.[Abstract/Free Full Text]
  42. Li, Q., O. Wrange. 1993. Translational positioning of a nucleosomal glucocorticoid response element modulates glucocorticoid receptor affinity. Genes Dev. 7:2471.[Abstract/Free Full Text]
  43. Piña, B., U. Bruggemeier, M. Beato. 1990. Nucleosome positioning modulates accessibility of regulatory proteins to the mouse mammary tumor virus promoter. Cell 60:719.[Medline]
  44. Kim, T. K., T. Maniatis. 1997. The mechanism of transcriptional synergy of an in vitro assembled interferon-{beta} enhanceosome. Mol. Cell 1:119.[Medline]
  45. Mayall, T. P., P. L. Sheridan, M. R. Montminy, K. A. Jones. 1997. Distinct roles for P-CREB and LEF-1 in TCR {alpha} enhancer assembly and activation on chromatin templates in vitro. Genes Dev. 11:887.[Abstract/Free Full Text]
  46. Tahirov, T. H., T. Inoue-Bungo, H. Morii, A. Fujikawa, M. Sasaki, K. Kimura, M. Shiina, K. Sato, T. Kumasaka, M. Yamamoto, et al 2001. Structural analyses of DNA recognition by the AML1/Runx-1 Runt domain and its allosteric control by CBF{beta}. Cell 104:755.[Medline]
  47. Lee, D. Y., J. J. Hayes, D. Pruss, A. P. Wolffe. 1993. A positive role for histone acetylation in transcription factor access to nucleosomal DNA. Cell 72:73.[Medline]
  48. Chen, H., B. Li, J. L. Workman. 1994. A histone-binding protein, nucleoplasmin, stimulates transcription factor binding to nucleosomes and factor-induced nucleosome disassembly. EMBO J. 13:380.[Medline]
  49. Cote, J., J. Quinn, J. L. Workman, C. L. Peterson. 1994. Stimulation of GAL4 derivative binding to nucleosomal DNA by the yeast SWI/SNF complex. Science 265:53.[Abstract/Free Full Text]
  50. Vettese-Dadey, M., P. Walter, H. Chen, L. J. Juan, J. L. Workman. 1994. Role of the histone amino termini in facilitated binding of a transcription factor, GAL4-AH, to nucleosome cores. Mol. Cell Biol. 14:970.[Abstract/Free Full Text]
  51. Kingston, R. E., G. J. Narlikar. 1999. ATP-dependent remodeling and acetylation as regulators of chromatin fluidity. Genes Dev. 13:2339.[Free Full Text]
  52. Wolffe, A. P., D. Guschin. 2000. Review: chromatin structural features and targets that regulate transcription. J. Struct. Biol. 129:102.[Medline]
  53. Kitabayashi, I., A. Yokoyama, K. Shimizu, M. Ohki. 1998. Interaction and functional cooperation of the leukemia-associated factors AML1 and p300 in myeloid cell differentiation. EMBO J. 17:2994.[Medline]
  54. Smith, C. L., G. L. Hager. 1997. Transcriptional regulation of mammalian genes in vivo: a tale of two templates. J. Biol. Chem. 272:27493.[Free Full Text]
  55. Smith, C. L., R. G. Wolford, T. B. O’Neill, G. L. Hager. 2000. Characterization of transiently and constitutively expressed progesterone receptors: evidence for two functional states. Mol. Endocrinol. 14:956.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Int ImmunolHome page
S. Tani-ichi, M. Satake, and K. Ikuta
Activation of the mouse TCR{gamma} enhancers by STAT5
Int. Immunol., September 1, 2009; 21(9): 1079 - 1088.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. del Blanco, J. L. Roberts, N. Zamarreno, N. Balmelle-Devaux, and C. Hernandez-Munain
Flexible Stereospecific Interactions and Composition within Nucleoprotein Complexes Assembled on the TCR{alpha} Gene Enhancer
J. Immunol., August 1, 2009; 183(3): 1871 - 1883.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
O. Chayka, J. Kintscher, D. Braas, and K.-H. Klempnauer
v-Myb Mediates Cooperation of a Cell-Specific Enhancer with the mim-1 Promoter
Mol. Cell. Biol., January 1, 2005; 25(1): 499 - 511.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
B. V. Johnson, A. G. Bert, G. R. Ryan, A. Condina, and P. N. Cockerill
Granulocyte-Macrophage Colony-Stimulating Factor Enhancer Activation Requires Cooperation between NFAT and AP-1 Elements and Is Associated with Extensive Nucleosome Reorganization
Mol. Cell. Biol., September 15, 2004; 24(18): 7914 - 7930.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Arman, J. Calvo, M. E. Trojanowska, P. N. Cockerill, M. Santana, M. Lopez-Cabrera, J. Vives, and F. Lozano
Transcriptional Regulation of Human CD5: Important Role of Ets Transcription Factors in CD5 Expression in T Cells
J. Immunol., June 15, 2004; 172(12): 7519 - 7529.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hernández-Munain, C.
Right arrow Articles by Krangel, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hernández-Munain, C.
Right arrow Articles by Krangel, M. S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS