|
|
||||||||



,
Programs in
* Biochemistry, Cellular and Molecular Biology, and
Cellular and Molecular Medicine, and
Graduate Program in Immunology and Department of Medicine, The Johns Hopkins University School of Medicine, Baltimore, MD 21205
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Recently, Sigal et al. (17, 18) showed that virally
infected non-hemopoietic cells are unable to stimulate primary CTL
responses directly. The Ag produced by these non-hemopoietic
cells has to be cross-presented by bone marrow-derived APCs
to induce anti-viral CTL responses. Another group (19)
also found that Ag under the control of tissue-specific promoters can
elicit CTL responses without the expression of Ag in APCs.
Cross-priming has been shown to be important in the induction of CTL
responses to certain tumors and in the development of peripheral
tolerance to adoptively transferred T cells specific for a transgenic
Ag expressed in pancreatic
cells (20, 21, 22). Therefore,
presentation of endocytosed material may be far more prevalent than
originally recognized (23).
A major challenge in separating the contributions of the two class I-restricted Ag processing pathways under physiological conditions is that it is difficult to inhibit one pathway without affecting the other. In our study we took advantage of a human CMV (HCMV)3 gene product, US11, to achieve this purpose and dissect the relative contributions of direct priming and cross-priming to the induction of vaccinia-specific CTL in a mouse model under conditions in which the cell types infected (bone marrow-derived APCs or non-hemopoietic cells) are influenced by the route of exposure to the virus.
HCMV is a ubiquitous herpes virus that can establish life-long
infection. After periodic reactivation from latency, it uses a variety
of immune evasion proteins to survive and replicate in the face of a
robust, fully primed host immune response (24, 25, 26). The
HCMV gene product US11, an endoplasmic reticulum (ER) resident, type I
transmembrane glycoprotein, has been shown in transfection experiments
to cause the selective degradation of endogenous class I molecules
(27). In the presence of US11, class I heavy chains are
dislocated from the lumen of the ER into the cytoplasm, where they are
deglycosylated by host N-glycanase and then degraded by the
proteasome (28). A second HCMV gene product, US2, has also
been observed to carry out a similar function (27, 29). In
human astrocytoma cells transfected with the HCMV US11 gene, the
Kb, Db,
Dd, and Ld molecules
expressed via recombinant vaccinia virus vectors are rapidly degraded,
while in US2-transfected cells, only Db and
Dd are significantly destabilized
(30). Recently it was shown that unlike US11, US2 causes
the degradation of two essential proteins in the MHC class II Ag
processing pathway: HLA-DR-
and DM-
. The expression of US2 in
cells reduces or abolishes their ability to present Ag to
CD4+ T lymphocytes (31).
In this study we evaluated direct and cross-priming pathways using a
recombinant vaccinia vector, vUS11, that encodes HCMV US11 under
control of a vaccinia early/late promoter. The vector also encodes
-galactosidase (
-gal), which we used as a model Ag, under control
of the vaccinia late promoter. By coexpressing HCMV US11 with test Ags
using recombinant vaccinia virus, we were able to block the
presentation of Ags synthesized endogenously within infected cells
(direct priming). Since US11 is an ER resident membrane protein, it
cannot be efficiently transferred in functional form from one cell to
another. Thus, MHC class I-restricted presentation by non-infected
cells that take up Ags released by infected cells (cross-priming) is
not significantly affected. Therefore, this strategy allows selective
inhibition of the classic MHC class I Ag presentation pathway. Using
this system, we compared the induction of primary vaccinia-specific and
-gal-specific CD8+ CTLs in mice challenged
with vUS11 or control vaccinia vSC8, a recombinant vaccinia expressing
only
-gal under control of the vaccinia late promoter. Our results
suggest that classic MHC class I Ag presentation and cross-priming
contribute differentially to the induction of
CD8+ CTL following exposure to vaccinia virus via
different immunization routes.
| Materials and Methods |
|---|
|
|
|---|
Six- to 8-wk-old female BALB/c mice were purchased from National Cancer Institute (Bethesda, MD). B10.A(5R) mice were purchased from The Jackson Laboratory (Bar Harbor, ME).
Antibodies
FITC-conjugated mouse anti-H-2Kb,
FITC-conjugated mouse anti-H-2Dd,
FITC-conjugated mouse IgG2a,
, rat anti-mouse IFN-
, and
biotin-conjugated rat anti-mouse IFN-
were purchased from BD
PharMingen (San Diego, CA). Mouse anti-
-gal was purchased from
Life Technologies (Gaithersburg, MD). HRP-conjugated goat
anti-mouse IgG (H+L) was purchased from Bio-Rad (Hercules, CA).
FITC-conjugated goat anti-mouse IgG (H+L) was purchased from Caltag
Laboratories (Palo Alto, CA). The 25-D1.16 mAb specific for SIINFEKL
(OVA257264)/H-2 Kb
complexes (32) was obtained from Dr. R. Germain (National
Institutes of Health, Bethesda, MD).
Generation of recombinant vaccinia virus
The full-length US11 gene was amplified by PCR using
DNA from purified HCMV strain AD169 and the following primer pair: 5'
primer, GCCCTCGAGATGAACCTTGTAATGCTTATTC; and 3' primer,
CCCTCTAGATCACCACTGGTCCGAAAACAT. The 5' primer contains an
XhoI site, and the 3' primer contains an XbaI
site. Vector pSC11.MCS1-US11 was generated by ligating the US11 PCR
product cut with XhoI and XbaI into the
SalI and NheI sites of pSC11.MCS1
(33). This placed US11 under control of
vaccinia early/late promoter p7.5. The vector also encodes
-gal under control of vaccinia late promoter p11. The
US11 insert of pSC11.MCS1-US11 was verified by DNA sequencing.
Recombinant vaccinia vUS11 was generated according to standard methods
(34, 35). In brief, CV-1 cells were infected with
wild-type vaccinia virus (vWR-Lvar), followed by transfection
(Lipofectamine 2000; Life Technologies) of the infected cells with
pSC11.MCS1-US11. Recombinant virus was selected on the basis of
bromodeoxyuridine resistance and screened by the expression of
-gal.
The recombinant virus was carried through three rounds of plaque
purification under selective conditions. The control vaccinia vector
vSC8 (34, 35) was obtained from the National Institutes of
Health AIDS Research and Reference Reagent Program. It encodes
-gal
under control of vaccinia late promoter p11. Vaccinia
viruses were amplified and then purified by zonal sucrose gradient
centrifugation. Viral stocks used in a single experiment were titrated
simultaneously using CV-1 cells. The two viruses had similar plaque
sizes and had the same efficiency of replication in both HeLa S3 and
CV-1 cells. Construction of vaccinia vector pXSO is described in detail
elsewhere (X. Shen, C. B. Buck, S. B. J. Wong, and
R. F. Siliciano, manuscript in preparation). Briefly, this vector
encodes a rapidly degraded, epitope-shuffled form of the HIV-1 Gag
protein consisting of an N-terminal methionine residue, followed in
sequence by the following segments of the gag protein (HXB2R
coordinates): 286500, 1647, 68103, and 136283. The peptide
sequence LEQLESIINFEKL derived from OVA is appended at the C terminus.
It includes the Kb-restricted SIINFEKL epitope.
Complexes of SIINFEKL and H-2Kb can be detected
by 25-D1.16 mAb on MC57G cells infected with this virus.
Western blotting
The A20 cell line, a BALB/c B cell lymphoma, was infected with
recombinant vaccinia vectors at a multiplicity of infection of 3 for
2 h and then incubated overnight to allow protein expression. The
cells were washed, pelleted, resuspended in SDS sample buffer, and
boiled for 10 min. The cell debris was pelleted at maximum speed in a
microcentrifuge for 10 min, and lysate equivalent to
104 cells/lane was separated by SDS-PAGE on a
412% gradient Nupage minigel (Novex, San Diego, CA). The proteins
were transferred onto nitrocellulose, and the nitrocellulose was
blotted according to ECL kit protocol (NEN, Boston, MA; primary Ab,
mouse anti-
-gal at 1 µg/ml; secondary Ab, HRP-conjugated goat
anti-mouse at 1/10,000 dilution).
Infection of SCID mice with vaccinia viruses
Two groups of two SCID mice each were injected i.p. with 3 x 106 PFU of either vSC8 or vUS11 diluted in HBSS. These mice were sacrificed 3 days later, and their ovaries were recovered. Ovarian homogenates were sonicated, serially diluted, and used to infect CV-1 cells preplated overnight in six-well plates at a concentration of 5 x 105 cells/well. Two days later these wells were overlaid with crystal violet solution, and the plaques were counted.
Stimulation of a primary CTL response
Group of three to five mice were immunized with 3 x 106 PFU of vSC8 or vUS11 in 0.1 ml sterile PBS via different routes. Seven or 8 days after immunization, mice were sacrificed, and their spleens were harvested. The spleens were homogenized, and the suspension was passed through a 70-µm pore size cell strainer. Pelleted splenocytes were resuspended in ACK lysis buffer (BioSource International, Camarillo, CA; 150 mM NH4Cl, 1 M KHCO3, and 10 mM EDTA, pH 7.2) and incubated at room temperature for 5 min to remove RBC. The splenocytes were washed three times and then resuspended in RPMI containing 10% FCS supplemented with antibiotics, counted, and used as effectors directly in a 51Cr release assay or an ELISPOT assay.
Induction of
-gal-specific CTL
Two groups of three BALB/c mice (National Cancer Institute) each
were immunized i.v. with either HBSS alone or 1 x
108 PFU of replication-incompetent adenovirus
vector encoding
-gal (a gift from Dr. J. K. Donahue, The Johns
Hopkins University School of Medicine, Baltimore, MD) diluted in HBSS.
These mice were sacrificed 2 wk later, and their spleens were
recovered. Single-cell splenocyte suspensions were prepared as
described above. After thorough washing, these effector cells were
positively enriched for CD8+ cells by magnetic
separation using Ab-labeled microbeads according to the manufacturers
suggested protocol (Miltenyi Biotec, Auburn, CA). This resulted in a
cell population that was >95% CD8+ by flow
cytometric analysis. These effectors were resuspended at a
concentration of 0.5 x 106 cells/ml in
complete culture medium (RPMI 1640 medium supplemented with 10% FCS,
50 µM 2-ME, penicillin, streptomycin, IL-2, and Glutamax (Invitrogen,
Carlsbad, CA)). Stimulator cells were isolated from the spleens
of syngeneic BALB/c mice, gamma-irradiated (3000 rad), and resuspended
in complete culture medium at a concentration of 0.5 x
106 cells/ml. Effector cells (1 x
107) from each group of mice were incubated for 6
days with 5 x 107 stimulator cells in a
total volume of 4 ml complete culture medium in the presence of 10
µg/ml of the Ld-restricted
-gal peptide,
TPHPARIGL.
Cytolytic T cell assays
Cells of the mastocytoma cell line P815 (H-2d) were infected with the control vaccinia vector vSC8 or with vUS11 at a multiplicity of infection of 10 for 6 h. Infected cells were labeled with 51Cr for 2 h at 37°C, then washed three times to remove the excess 51Cr. Splenocyte effectors from immunized mice were mixed with target cells at varying E:T cell ratios in V-bottom, 96-well plates. The plates were spun briefly and incubated for 810 h at 37°C. Cells were then spun again, and 40 µl medium from each well was transferred into corresponding wells in a LumaPlate (Packard Instrument, Meriden, CT). The radioactivity was counted with a TopCount instrument. The percent specific lysis (%SL) is defined as: [(counts experimental lysis - counts medium lysis)/(counts Nonidet P-40 lysis - counts medium lysis)] x 100%. Vaccinia-specific lysis is defined as: (%SL of vaccinia-infected targets) - (%SL of uninfected targets).
For experiments with
-gal-specific CTL, P815 cells were infected
with vaccinia virus that expressed (vSC8) or did not express
-gal
(vvWR) at multiplicity of infection of 5 in a 100-µl volume. After
2 h the target cells were resuspended in 2 ml RPMI 1640 medium
supplemented with 10% FCS for a total of 18 h. The target cells
were labeled with 51Cr for 1.5 h, washed,
counted, and resuspended at a concentration of 1.75 x
104 cells/ml in RPMI 1640 medium supplemented
with 10% FCS, penicillin, streptomycin, and glutamine. Live effector
cells, as determined by trypan blue exclusion, were mixed with labeled
target cells at E:T cell ratios of 100, 33, 11, and 3.7 in V-bottom,
96-well plates. Five hours later 50 µl supernatant from each well was
sampled and counted as described above.
Peptides
The Kb-restricted peptide
(p
-gal-Kb),
-gal497504 (ICPMYARV), and the
Ld-restricted peptide
(p
-gal-Ld),
-gal876884 (TPHPARIGL), were synthesized by
The Johns Hopkins University School of Medicine Peptide Synthesis
Facility and were purified to >95% before use.
ELISPOT assays
MultiScreen-HA plates (Millipore, Bedford, MA) were coated with
rat anti-mouse IFN-
mAb at a concentration of 10 µg/ml in PBS
at 4°C overnight. The Ab was discarded, and the coated plates were
then washed six times with PBS with 0.25% Tween 20 (PBST). Each well
was then blocked with 200 µl assay medium for at least 1 h at
37°C. The medium was discarded. Various dilutions of effector cells
with peptide and stimulator cells were added to coated/blocked wells
and incubated at 37°C for 1012 h in 200 µl RPMI containing 10%
FCS supplemented with IL-2 (20 U/ml; Biogen, Cambridge, MA) and
antibiotics. The cells were then discarded, and the plates were washed
six times with PBST. Biotin rat anti-mouse IFN-
at a
concentration of 5 µg/ml in PBST was added to each well, and the
plate was incubated at 4°C overnight. The Ab solution was discarded,
and the plates were then washed six times with PBST. Avidin-alkaline
phosphatase (Sigma-Aldrich, St. Louis, MO) was added at a concentration
of 1.25 µg/ml in PBS and incubated for 2 h at room temperature.
The plate was then washed six times with PBST, and 50 µl
5-bromo-4-chloro-3-indolyl-phosphate/nitro blue tetrazolium solution
(Sigma-Aldrich) was added to each well. After incubation at room
temperature for 15 min, the reaction was stopped by adding water. The
plate was air-dried, and the spots were counted using a dissecting
microscope.
| Results |
|---|
|
|
|---|
In this study we used two recombinant vaccinia viruses to study
the role of direct presentation and cross-priming in CTL induction. The
previously described vector vSC8, which expresses
-gal under control
of the vaccinia late promoter p11, was used as a control
vector (34, 35). We generated vUS11, which in addition to
-gal encodes HCMV US11 under control of the vaccinia early/late
promoter p7.5. The generation of vUS11 is described in
Materials and Methods.
Because Abs against US11 are not widely available, we confirmed the insertion of the US11 gene into the vaccinia genome by PCR analysis of DNA from vUS11-infected HeLa S3 cells using US11 primers (data not shown). The presence of a functional form of the US11 gene in this vector is demonstrated by the dramatically reduced presentation of viral Ags in cells infected with this vector (see below).
vUS11 reduces the presentation of viral Ags by MHC class I molecules on the cell surface
Previous studies have shown that constitutive expression of US11 in stably transfected cell lines results in decreased expression of MHC class I molecules (27). Human fibroblasts and T cells transduced with a retroviral vector encoding US11 also exhibited a decrease in cell surface class I MHC expression (36). To determine whether the level of class I MHC molecules on the cell surface could be affected by introducing the US11 gene with a recombinant vaccinia vector, A20 or P815 cells were infected with vSC8 or vUS11. Sixteen hours after infection, FACS analysis showed no significant difference in the levels of H-2Dd molecules on the cell surface between cells infected with the two vectors (data not shown). This result probably reflects the long half-life of cell surface MHC class I molecules (37).
Although infection with vUS11 did not significantly reduce surface
class I levels over the course of 16 h, it did have a dramatic
effect on the presentation of viral Ags expressed in infected cells
(Fig. 1
). In these experiments cells of
the murine fibrosarcoma line MC57G (H-2b) were
coinfected with a recombinant vaccinia vector, vXSO, and with either
vUS11 or the control vaccinia vector, vSC8. The vXSO vector expresses
the well-characterized, H-2Kb-restricted chicken
OVA epitope SIINFEKL (pOVA) fused to the C terminus of a rapidly
degraded form of HIV-1 Gag. After the fusion protein is processed by
the class I pathway, surface expression of
SIINFEKL/H-2Kb complexes can be detected using
the mAb 25-D1.16 (32). Nine hours after the coinfection,
FACS analysis showed that the expression of US11 did not significantly
affect the total H-2Kb level on the cell surface
(Fig. 1
B), consistent with results obtained in A20 and P815
cells. On the other hand, we observed a significantly lower level of
SIINFEKL/Kb on cells coinfected with vUS11
compared with cells coinfected with vSC8 (Fig. 1
D). These
results provide direct demonstration that US11 reduces cell surface
presentation of a defined class I epitope. In this regard the
expression of HCMV US11 produces the same result as treatment of cells
with brefeldin A, a specific inhibitor of the transport of newly
synthesized proteins from ER to Golgi apparatus. Brefeldin A inhibits
the lysis of virally infected cells by CTL without producing a
measurable drop in the cell surface concentration of class I MHC
molecules (38, 39).
|
Expression of US11 reduces presentation of vaccinia Ags to vaccinia-specific CTLs in vitro and decreases priming of vaccinia-specific CTL responses in B10.A(5R) mice
Because the expression of US11 inhibits the presentation of the
H-2Kb-restricted SIINFEKL model peptide on the
surface of infected cells, we reasoned that CTL recognition of viral
Ags might be impaired in the case of vUS11-infected cells. To
investigate this question, we generated vaccinia-specific effector
cells by i.p. injection of B10.A(5R) mice with 3 x
106 PFU of vSC8 or vUS11. B10.A(5R) mice were
used because the class I alleles expressed by this strain
(H-2Kb, H-2Dd,
H-2Ld) are all susceptible to US11-mediated rapid
degradation (30). Seven days after infection, spleens were
harvested from the immunized mice, and the splenocytes were used
directly as effectors in a 51Cr release assay
with vSC8- or vUS11-infected P815 cells as targets
(H-2Dd-, H-2Ld-restricted
lysis). By using relatively high E:T cell ratios and long (8-h)
incubation periods, the induction of CTL can be directly measured
without an in vitro stimulation (40). The
vaccinia-specific effectors generated by i.p. priming with the control
vaccinia virus vSC8 lysed vSC8-infected P815 targets, but were unable
to lyse vUS11-infected P815 targets (Fig. 2
A). These results demonstrate
that the expression of US11 dramatically reduces the presentation of
vaccinia Ags to vaccinia-specific CTLs in vitro. Compared with the
US11-mediated inhibition of Ag presentation as measured by
Kb/SIINFEKL staining (Fig. 1
), the inhibition of
lysis of vaccinia-infected targets by US11 was more complete. This may
reflect the fact that in the setting of coinfection with vUS11 and
vXSO, some of the SIINFEKL peptide was processed for MHC class I
presentation before US11 was fully active. Because the SIINFEKL peptide
expressed by vXSO is linked to a rapidly degraded Ag (see
Materials and Methods), the peptide may have been processed
for MHC class I presentation more rapidly than peptides derived from
vaccinia early Ags. If this were so, then some
H-2Kb/SIINFEKL complexes may have formed and
exited the ER before US11 became fully active. In any event, the
results presented in Fig. 2
A show that under appropriate
conditions US11 can very effectively block the presentation of viral
Ags to CTL.
|
-gal peptide 497504
(p
-gal-Kb) and the
Ld-restricted response to
-gal peptide
876884 (p
-gal-Ld) were measured by ELISPOT
assay (Fig. 2
-gal by vSC8 and vUS11 (Fig. 2
-gal expression is driven off a late vaccinia promoter. To
demonstrate that the Ag can be directly presented by infected cells, we
generated
-gal-specific CTL by priming BALB/c mice with an
adenovirus vector expressing
-gal and then restimulated splenocytes
from immunized mice with the Ld-restricted
-gal peptide, TPHPARIGL. The resulting effectors lysed target cells
infected with vSC8, but not target cells infected with a control
vaccinia vector that does not express
-gal (vWR; Table I
-gal expressed from
the late vaccinia promoter can be directly presented in our system.
Taken together, these results demonstrate that the expression of US11
interfered with the in vivo priming of Ag-specific CTL responses in
mice. The inhibitory effect was particularly dramatic in the case of
the Ld-restricted response to
-gal peptide.
Strong, but less complete, inhibition was seen in the case of the
Kb-restricted
-gal peptide. This may reflect
different rates of US11-mediated degradation of
Kb and Ld
(30). Therefore, in subsequent experiments we focused on
the Ld-restricted CTL responses to
-gal (using
p
-gal-Ld for the ELISPOT assay). Taken
altogether, the in vitro and in vivo results suggest that direct
presentation of
-gal and vaccinia Ags can be blocked by the
expression of US11 and that direct presentation plays an important role
in CTL priming after i.p. injection of vaccinia virus as it can be
significantly reduced by the expression of US11.
|
The data collected in mice infected i.p. were consistent with
direct priming as a principal mode of presentation of viral Ags for the
induction of CTL responses. Because direct priming is thought to be
dependent on the infection of professional APCs, which may be abundant
in the peritoneal compartment, we reasoned that other vaccination
sites, where professional APCs might be less prevalent, might be more
reliant on cross-priming for CTL induction. To test this hypothesis,
groups of three to five mice were inoculated with vSC8 and vUS11 by
various routes, and CTL responses were determined as described above.
As observed previously, i.p. inoculation of vUS11 resulted in greatly
diminished CTL responses as measured by either ELSPOT or
51Cr release (Fig. 3
, A and B). In the
case of i.v. inoculation of vaccinia virus, the expression of US11 also
inhibited CTL induction, while for i.m. inoculation the inhibitory
effects of US11 were much less pronounced (Fig. 3
, A and
B). Interestingly, in the case of infection by s.c.
or intradermal (i.d.) routes, we did not observe significantly lower
levels of
-gal- or vaccinia-specific CTLs induced by vUS11 compared
with vSC8. The pattern was observed in response to a defined peptide Ag
(
-gal; Fig. 3
A) and was also observed in the overall
response to vaccinia virus (Fig. 3
B). These experiments were
repeated three or more time with all routes of inoculation using
different preparations of virus stocks with similar results. In
summary, our results indicate that the effect of inhibition of direct
priming on CTL induction is dramatic in the case of i.p. and i.v.
infection, less significant for i.m. infection, and minimal in the case
of s.c. or i.d. infection. Based on these results, we suggest that
classic MHC class I Ag presentation and cross-priming contribute
differentially during the induction of CD8+ CTLs
following infection by vaccinia virus via different routes.
|
Finally, we wanted to determine whether the phenomenon observed in
B10A(5R) mice could be generalized. We inoculated BALB/c mice with
3 x 106 PFU of vSC8 or vUS11 via i.p.,
i.v., i.m., s.c., or i.d. routes. The induction of
-gal-specific CTLs was studied by measuring IFN-
secretion using
the ELISPOT assay (Fig. 4
A),
and the induction of vaccinia-specific CTLs was measured by the
51Cr release assay (Fig. 4
B).
Significantly lower Ld-restricted
-gal876884 peptide-specific and
vaccinia-specific responses were induced by vUS11 than by vSC8 via the
i.p. route, consistent with previous findings in B10.A(5R) mice. The
effect of US11 on the induction of
-gal876884 peptide-specific and
vaccinia-specific responses was not significant if the infections were
conducted via other routes. This may reflect the fact that not all the
MHC class I alleles present in BALB/c mice are down-regulated by US11
(30). This would result in a smaller effect of US11 on
overall class I Ag presentation in vivo. Nevertheless, the fact that
US11 significantly affects CTL induction following i.p. infection even
in this system strongly suggests that local factors dictate the
relative importance of the direct vs cross-priming pathways.
|
| Discussion |
|---|
|
|
|---|
Using this system we have demonstrated that direct priming can contribute to the induction of primary CD8+ CTLs, but that the magnitude of the contribution depends on the route of infection. In the case of i.p. or i.v. inoculation, US11-mediated inhibition of the classic MHC class I pathway in infected cells strongly inhibits the induction of primary CD8+ CTLs. This finding indicates that direct priming plays an important role in the induction of virus-specific CTL responses in this situation. It is not clear which cell types are infected through these routes. A likely explanation for our results is that i.p. or i.v. inoculation results in the direct infection of large numbers of professional APCs. Such infected APCs could express Ags endogenously, process them through the classic MHC class I processing pathway, and present them to naive CD8+ T cells. In this scenario, the expression of US11 would inhibit the induction of CD8+ CTLs. An alternative explanation is that vUS11 simply replicates poorly in the i.p. site and thus induces a poor CTL response. We consider this less likely, because the viruses replicate equally well in vitro and in vivo in immunodeficient mice.
We also showed that inhibition of the classic MHC class I pathway by
US11 has less of an effect on the induction of primary
CD8+ CTLs following i.m. infection and has a
minimal effect following s.c. or i.d. infection. This observation may
reflect the fact that cell types other than professional APCs are
initially infected at these sites. For example, following i.m.
injection, a large fraction of the viral inoculum may go into myocytes,
which are not efficient at priming a CTL response
(42, 43, 44). In fact, Sigal and colleagues (17, 18) have shown that chimeras constructed by lethally irradiating
C57BL/6 mice and reconstituting them with bone marrow from
TAP0/0 mice (also H-2b) do
not generate CTL responses following infection with a large i.p. dose
of vaccinia. This result suggests that virally infected non-hemopoietic
cells are unable to stimulate primary CTL-mediated immunity, and that
bone marrow-derived cells are required as APC (17, 18),
consistent with our interpretation of the relative importance of
cross-priming in this setting. Another possibility is that
virus-induced cytokines such as IFN-
can reverse the US11 effect.
This would allow direct presentation by infected APC, which would have
been undetected by us. However, in this case it would be necessary to
propose that this IFN-
-mediated reversal operates only at some sites
of infection.
Evidence that cross-priming can be an obligatory Ag presentation pathway for priming CTL responses to viruses that only infect non-hemopoietic cells comes from elegant studies of poliovirus receptor transgenic mice. Normal mice cannot be infected by poliovirus because they do not express the receptor for this virus. In mouse chimeras constructed by lethally irradiating poliovirus receptor transgenic mice and reconstituting them with bone marrow from normal mice, the priming of polio-specific CTL is similar to the priming in polio receptor transgenic mice (17). Strong evidence also came from the study by Prasad et al. (19) showing that Ag under the control of tissue-specific promoters can elicit CTL responses without the expression of Ag in APCs. Yewdell and colleagues (62) have recently used vaccinia vectors expressing US2 or US11 to demonstrate that both direct priming and cross-priming contribute to the induction of CTL responses in vivo, consistent with the findings presented here.
Many viruses can infect both non-hemopoietic cells and bone
marrow-derived cells. Our system has the advantage that both bone
marrow-derived cells and non-hemopoietic cells are susceptible to
infection by vaccinia, and the cell types that are infected are
determined naturally by the route of exposure. From our studies of i.p.
or i.v. priming with vaccinia virus, we conclude that direct priming
plays an important role in the induction of CTL responses when virus is
introduced via these routes. Evidence supporting this conclusion also
comes from the work of Bronte et al. (45). They studied
the ability of a panel of recombinant vaccinia viruses expressing
-gal under the control of a number of early and late promoters to
prolong the survival of mice bearing a lethal
-gal-expressing tumor.
They found that via the i.v. route only those recombinant vaccinia
viruses employing early promoters were effective in prolonging
survival. Late promoters were ineffective regardless of their
determined promoter strength. When a variety of cell types were
infected with the panel of viruses in vitro, dendritic cells were found
to express
-gal only under the control of the early promoters even
though late promoters were intrinsically more active in other cell
types (45). These results are consistent with the idea
that direct infection of professional APCs by vaccinia viruses is
important for the induction of a CTL response.
Our results have also shown that among all the immunization routes
tested, i.p. and i.v. infection resulted in the highest levels of
CD8+ CTL. This is consistent with the observation
that i.v. immunization using recombinant modified vaccinia virus Ankara
expressing multiple CTL epitopes induced stronger CTL than did i.m.
immunization (46). The direct infection of APCs and
efficient presentation of Ag by direct priming could contribute to this
phenomenon. Unlike peptide-class II complexes, which have extremely
long half-lives (exceeding 100 h), peptide-class I complexes have
shorter half-lives (
10 h) (47). MHC class I
presentation must therefore be sustained by continuous synthesis of
class I molecules and loading from internal sources of Ag, which could
be accomplished more efficiently by direct priming.
In our vaccinia virus system the expression of US11 significantly reduced the MHC class I-restricted presentation of newly synthesized viral Ags in cells expressing US11 without affecting the overall cell surface expression of previously synthesized MHC class I molecules. In cell lines stably expressing US11, where US11 can function for longer period of time, surface MHC class I levels were found to decrease (36). However, our results clearly demonstrate that HCMV US11 can prevent the presentation of viral Ags before it has any significant effect on the cell surface MHC class I level. These phenomena resemble the inhibition of Ag presentation by brefeldin A (38, 39), although US11 and brefeldin A operate through different biochemical mechanisms. Brefeldin A rapidly and reversibly blocks the transport of newly synthesized proteins out of the ER and has no apparent effect on endocytosis, endosome acidification, lysosomal function, or the trans-Golgi system (48).
For viruses that evade CD8+ CTLs by interfering
with MHC class I expression, it is necessary to explain how at the same
time they can evade NK cells. By
72 h after infection, HCMV
expresses an NK decoy, UL18, which mimics MHC class I
(49). Recently, it has been proposed that another HCMV
product, UL16, serves to mask NK recognition of UL16-binding proteins
or MHC class I chain-related protein B, which are ligands for
the activating receptor, NKG2D/DAP10 (50). In the case of
HIV-1, the Nef protein down-regulates cell surface MHC class I by
accelerating the endocytosis of class I complexes
(51, 52, 53, 54). The specific targeting of HLA-A and -B locus
products, but not HLA-C or -E locus products, may be relevant for NK
cell evasion (55). We proposed here that inhibition of MHC
class I Ag presentation without significant reduction of cell surface
class I levels, as observed here, could be another important mechanism.
Especially for viruses with short replication cycles, this mechanism
may be enough to allow viral replication in the presence of efficient
CD8+ T cell and NK responses. Recently, the
expression of HCMV US11 has been shown to be sufficient to trigger the
cytotoxicity of NK cell clones expressing an inhibitory killer cell
Ig-like receptor for HLA-C (56). Based on the long
half-life of cell surface MHC class I, as shown here and by others,
together with the fact that vaccinia is rapidly cytotoxic, we believe
that triggering the cytotoxicity of NK cells is not a significant
factor contributing to the phenomena we observed here, because total
class I levels are not reduced during the time course of our
experiments.
In terms of vaccine development, our results suggest that immunization routes should be taken into consideration when vaccines are designed or evaluated. Certain vaccine strategies rely on the classic MHC class I Ag presentation pathway; for instance, strategies involving the targeting of Ags for rapid degradation in cytosol (57, 58) are likely to be most effective in the setting of direct presentation. Strategies that involve targeting Ag-expressing cells for apoptosis (59, 60, 61) rely on cross-priming. The results presented here provide a rational basis for the choice of routes of immunization that are likely to work the best with particular vaccine strategies.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Robert F. Siliciano, Department of Medicine, The Johns Hopkins University School of Medicine, 1049 Ross Building, 720 Rutland Avenue, Baltimore, MD 21205. E-mail address: rsilicia{at}welch.jhu.edu ![]()
3 Abbreviations used in this paper: HCMV, human CMV; ER, endoplasmic reticulum;
-gal,
-galactosidase; i.d., intradermal. ![]()
Received for publication November 21, 2001. Accepted for publication August 12, 2002.
| References |
|---|
|
|
|---|
-galactosidase provides visual screening of recombinant virus plaques. Mol. Cell Biol. 5:3403.
v
5 and CD36, and cross-present antigens to cytotoxic T lymphocytes. J. Exp. Med. 188:1359.This article has been cited by other articles:
![]() |
I. A. Cockburn, S. Chakravarty, M. G. Overstreet, A. Garcia-Sastre, and F. Zavala Memory CD8+ T Cell Responses Expand When Antigen Presentation Overcomes T Cell Self-Regulation J. Immunol., January 1, 2008; 180(1): 64 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gasteiger, W. Kastenmuller, R. Ljapoci, G. Sutter, and I. Drexler Cross-Priming of Cytotoxic T Cells Dictates Antigen Requisites for Modified Vaccinia Virus Ankara Vector Vaccines J. Virol., November 1, 2007; 81(21): 11925 - 11936. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Bins, M. C. Wolkers, M. D. van den Boom, J. B. A. G. Haanen, and T. N. M. Schumacher In Vivo Antigen Stability Affects DNA Vaccine Immunogenicity J. Immunol., August 15, 2007; 179(4): 2126 - 2133. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Saito, T. Yajima, S. Kumabe, T. Doi, H. Yamada, S. Sad, H. Shen, and Y. Yoshikai Impaired Protection against Mycobacterium bovis Bacillus Calmette-Guerin Infection in IL-15-Deficient Mice J. Immunol., February 15, 2006; 176(4): 2496 - 2504. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. N. Steele, Z. R. Balsara, and M. N. Starnbach Hematopoietic Cells Are Required to Initiate a Chlamydia trachomatis-Specific CD8+ T Cell Response J. Immunol., November 15, 2004; 173(10): 6327 - 6337. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. J. Wong, C. B. Buck, X. Shen, and R. F. Siliciano An Evaluation of Enforced Rapid Proteasomal Degradation as a Means of Enhancing Vaccine-Induced CTL Responses J. Immunol., September 1, 2004; 173(5): 3073 - 3083. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Thomas, L. M. Santarsiero, E. R. Lutz, T. D. Armstrong, Y.-C. Chen, L.-Q. Huang, D. A. Laheru, M. Goggins, R. H. Hruban, and E. M. Jaffee Mesothelin-specific CD8+ T Cell Responses Provide Evidence of In Vivo Cross-Priming by Antigen-Presenting Cells in Vaccinated Pancreatic Cancer Patients J. Exp. Med., August 2, 2004; 200(3): 297 - 306. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mercier, S. Verhaagh, J. Goudsmit, A. Lemckert, M. Monteil, M. Havenga, and M. Eloit Adenovirus fibre exchange alters cell tropism in vitro but not transgene-specific T CD8+ immune responses in vivo J. Gen. Virol., May 1, 2004; 85(5): 1227 - 1236. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Maranon, J.-F. Desoutter, G. Hoeffel, W. Cohen, D. Hanau, and A. Hosmalin Dendritic cells cross-present HIV antigens from live as well as apoptotic infected CD4+ T lymphocytes PNAS, April 20, 2004; 101(16): 6092 - 6097. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Daftarian, S. Ali, R. Sharan, S. F. Lacey, C. La Rosa, J. Longmate, C. Buck, R. F. Siliciano, and D. J. Diamond Immunization with Th-CTL Fusion Peptide and Cytosine-Phosphate-Guanine DNA in Transgenic HLA-A2 Mice Induces Recognition of HIV-Infected T Cells and Clears Vaccinia Virus Challenge J. Immunol., October 15, 2003; 171(8): 4028 - 4039. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Webby, S. Andreansky, J. Stambas, J. E. Rehg, R. G. Webster, P. C. Doherty, and S. J. Turner Protection and compensation in the influenza virus-specific CD8+ T cell response PNAS, June 10, 2003; 100(12): 7235 - 7240. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |