|
|
||||||||
Cutting Edge |




* Université Denis Diderot, Paris France; and
Institute of Immunology, University Hospital, Hamburg, Germany
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
On the basis of its pharmacological properties, the cytolytic actions of ecto-ATP have been ascribed to the P2X7 receptor (P2X7R) (13, 14). A number of peculiar features distinguish P2X7 from other purinergic receptors (10, 15). Whereas other P2X receptors activate at ATP concentrations <50 µM (16), P2X7R requires levels of ATP in the millimolar range to achieve full activation (13, 14, 17). Moreover, P2X7R can exist in at least two conductance states (13). Upon brief exposure to ATP, P2X7R functions as a nonselective cation channel, but upon prolonged exposure, channels rapidly transform into pores allowing passage of solutes up to 800 Da, such as the DNA-staining dye quinolinium, 4-(3-methyl-2[3H]-benzoxazolylidene)methyl)-11(3-(triethylammonio)propyl) diodide (YO-PRO-1). Continuous ligation of P2X7R can lead to cell death (18, 19).
The molecular mechanisms leading to pore formation upon activation of P2X7R remain to be defined. Domain-swapping experiments demonstrated that the C-terminal domain, which is significantly larger in P2X7R than in other P2X receptors, is essential (13, 14). Coimmunoprecipitation experiments suggested that P2X7R may form larger complexes with several intracellular proteins (20). Interestingly, the C-terminal tail of P2X7R contains motifs homologous to protein-protein interaction and LPS-binding domains (21). An allelic polymorphism (E496A) in a putative TNFR-related death domain leads to loss of function of human P2X7R (22, 23).
It is not yet clear whether P2X7R itself forms pores or induces pore formation by binding to other proteins. Transfection of 293 human embryonic kidney (HEK) cells with human or rat P2X7R is sufficient to confer ATP-sensitive pore formation (24, 25, 26, 27). Intriguingly, transfectants with mouse P2X7R appeared much less sensitive to ATP, although some in vivo experiments had indicated that mouse T cells, macrophages, and dendritic cells are highly sensitive to ATP (6, 10, 28).
In the context of ongoing investigations on the effects of extracellular nucleotides on T cell functions, we noticed a striking difference in T cell responses to ATP between BALB/c and C57BL/6 mice. In this study, we demonstrate that an allelic polymorphism in the putative death domain of mouse P2X7R (P451L) markedly impairs its function and accounts for differential strain responses to ATP.
| Materials and Methods |
|---|
|
|
|---|
Chemicals were from Sigma-Aldrich (Deisenhofen, Germany), unless indicated otherwise. YO-PRO-1, Fluo-3, and Pluronic F-127 were from Molecular Probes (Leiden, The Netherlands).
Animals, cells, and DNA
Mice were from Charles River Breeding Laboratories (Sulzfeld, Germany); genomic DNAs were from The Jackson Laboratory (Bar Harbor, ME). T cells were prepared for flow cytometry as described (3). B cells were depleted by MACS using anti-B220 magnetic beads (Miltenyi Biotec, Bergisch-Gladbach, Germany). 293HEK cells were from American Type Culture Collection (Manassas, VA).
Assays for calcium uptake, PS exposure, and pore formation
Calcium uptake was assayed by preincubation of cells with 2 µM Fluo-3/0.04% Pluronic F-127 for 20 min at room temperature before FACS analysis. Staining with Annexin VFITC (BD PharMingen, Heidelberg, Germany) and PI was as described previously (3). For assay of YO-PRO-1 uptake, cells were incubated at 37°C with ATP in PBS or sucrose buffer (24), and YO-PRO-1 (1 µg/ml) was added for the last 2 (PBS) or 10 (sucrose) min before FACS analysis.
Cloning, PCR, and cell transfections
P2X7R cDNAs were PCR amplified with high-fidelity Platinium Taq polymerase (Invitrogen, Groningen, The Netherlands) from purified BALB/c or C57BL/6 T cells using P2X7 specific primers described elsewhere (25), and cloned into the pCR4Blunt-Topo vector. Two clones were sequenced completely on both strands (Genome Express, Montreuil, France). The single point mutation was confirmed by direct sequencing of PCR products from two separate PCR using internal primers. For functional expression, cDNAs were subcloned into the pCDNA6/V5-HisB vector (Invitrogen). 293HEK cells (1 x 106) were transfected with 1 µg of expression construct using FuGENE6 transfection reagent (Roche, Mannheim, Germany). Stable transfectants were selected with 6 µg/ml blasticidin. Allele-specific PCR amplification was performed with AmpliTaq Gold polymerase (Applied Biosystems, Weiterstadt, Germany) using allele-specific forward primers 451P-F (CTATCTCTCCACGACTCACCCCC) or 451L-F (CTATCTCT CCACGACTCACCCCT) in combination with P2X7-R (TATAATCCCGGGAGGGATACTTGAAGCCACTGTAC) for 30 cycles (96°C for 30 s, 60°C for 1 min, 72°C for 1 min). Western blot analysis was performed as described previously (29).
| Results and Discussion |
|---|
|
|
|---|
Extracellular ATP induces calcium uptake and death by
apoptosis in T cells (28). The latter can be
assessed by exposure of PS on the outer leaflet of the plasma membrane,
and ultimately by failure to exclude PI. T cells from BALB/c and
C57BL/6 mice differ markedly in their sensitivity to these effects of
ATP (Fig. 1
).
|
To determine which purinergic P2 receptor(s) were involved in
ATP-mediated PS exposure, the effects of known receptor agonists and
antagonists (15, 27) were evaluated. The rank order of
sensitivity suggested involvement of P2X7R,
because 2',3'-O-(benzoyl-4-benzoyl)-ATP (bzATP), a known
P2X7R agonist, was more efficient than
ATP itself, and the effect was blocked by 1-[N,
O-bis(5-isoquinolinesulfonyl)-N-methyl-L-tyrosyl]-4-phenylpiperazine
and oxidized ATP, known inhibitors of
P2X7R-mediated responses (Fig. 2
, AC). As seen in Fig. 1
, reactivity was markedly reduced in C57BL/6 T cells.
P2X7R differs from other members of the P2 family
by its capacity to induce pores in the cell membrane that are permeable
to the DNA-binding dye YO-PRO-1. As observed for ATP-induced PS
exposure, bzATP-induced YO-PRO-1 uptake was also reduced in C57BL/6 vs
BALB/c T cells (Fig. 2
D). Collectively, these observations
indicate that ATP-induced PS exposure is mediated by
P2X7R, and that P2X7R
function is impaired in C57BL/6 mice.
|
To examine whether this difference in function reflects a
variation in primary structure, full-length P2X7R
cDNAs were PCR amplified and sequenced from both BALB/c and C57BL/6
mice. A single coding mutation (T1352C) was found in the C57BL/6
allele, resulting in a change from proline to leucine at
position 451 (P451L) of the deduced amino acid sequence (Fig. 3
A, arrow). Sequence alignment
showed that the BALB/c allele is in accord with the rat and human
orthologs at this position, while the only mouse
P2X7R sequence in the databases (NM_011027)
shares the P451L mutation with the C57BL/6 allele (not shown).
Interestingly, this mutation lies within a region of the C-terminal
cytoplasmic domain showing homology to the TNFR 1-death domain
(TNFR1-DD) and to a fragment of the Src homology (SH)3-binding
protein (SH3BP) 1 (Ref. 21 ; Fig. 3
).
|
Analysis of T cells from DBA/1 mice, a second strain carrying the P451L
mutation, showed reduced ATP-induced PS exposure in this strain also,
confirming the association of P2X7R function with
the genotype at this locus (Fig. 3
D).
To determine whether the P451L mutation is the cause for the observed
differences in P2X7R function, HEK cells were
transfected with cDNAs encoding the two variants. Though lack of
reagents precluded surface staining, Western blot analysis showed
comparable expression of both variants (Fig. 4
A). ATP-induced YO-PRO-1
uptake, PS exposure, and calcium influx were stronger in cells
transfected with the 451P allele than in their 451L counterparts (Figs. 4
, BF). Because the two cDNAs differ in a single coding
mutation, these experiments conclusively show that the P451L
substitution severely affects the function of
P2X7R as cation channel and macropore.
|
-helical (Fig. 3Our findings have implications also for the evaluation of previous studies concerning mouse P2X7R. Transfection studies showed that mouse P2X7R is much less sensitive to ATP than its rat or human orthologs (17, 26). This may be explained by the presence of the P451L mutation in the NM_011027 cDNA used for transfection. Our findings also bear relevance for studies using P2X7R-deficient mice (30, 31, 32). In some of these, the P2X7R-/- phenotype may have been underestimated because it was analyzed against genetic backgrounds (C57BL/6 or DBA/2) already carrying a naturally defective variant.
In conclusion, our findings provide a second example of a naturally occurring point mutation within the P2X7R cytoplasmic domain that severely impairs important functions of this receptor, namely pore formation and reorganization of the plasma membrane. Both of these are likely crucial steps involved in biological responses mediated by this receptor such as the induction of apoptosis and cytokine secretion (33). The occurrence of the P451L mutation within a region of similarity to both the TNFR-death domain and an SH3-binding domain supports the notion that these observed homologies may be of functional significance. The further analysis of this mutation thus may provide important insights into the molecular mechanisms of P2X7R action.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Friedrich Haag, Institute of Immunology, Martinistrasse 52, D-20246 Hamburg, Germany. E-mail address: haag{at}uke.uni-hamburg.de ![]()
3 Abbreviations used in this paper: PS, phosphatidylserine; PI, propidium iodide; P2X7R, P2X7 receptor; YO-PRO-1, quinolinium, 4-(3-methyl-2[3H]-benzoxazolylidene)methyl)-11(3-(triethylammonio)propyl) diodide; HEK, human embryonic kidney; bzATP, 2',3'-O-(benzoyl-4-benzoyl)-ATP; SH, Src homology; SH3BP, SH3-binding protein; TNFR1-DD, TNFR1-death domain. ![]()
Received for publication June 14, 2002. Accepted for publication August 28, 2002.
| References |
|---|
|
|
|---|
release by activating the purinergic P2Z receptor of human macrophages. J. Immunol. 159:1451.[Abstract]
This article has been cited by other articles:
![]() |
M. P. Lees, S. J. Fuller, R. McLeod, N. R. Boulter, C. M. Miller, A. M. Zakrzewski, E. J. Mui, W. H. Witola, J. J. Coyne, A. C. Hargrave, et al. P2X7 Receptor-Mediated Killing of an Intracellular Parasite, Toxoplasma gondii, by Human and Murine Macrophages J. Immunol., June 15, 2010; 184(12): 7040 - 7046. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hong, N. Schwarz, A. Brass, M. Seman, F. Haag, F. Koch-Nolte, W. P. Schilling, and G. R. Dubyak Differential Regulation of P2X7 Receptor Activation by Extracellular Nicotinamide Adenine Dinucleotide and Ecto-ADP-Ribosyltransferases in Murine Macrophages and T Cells J. Immunol., July 1, 2009; 183(1): 578 - 592. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. J. Taylor, M. Gonzalez-Begne, D. K. Sojka, J. C. Richardson, S. A. Sheardown, S. M. Harrison, C. D. Pusey, F. W. K. Tam, and J. I. Elliott Lymphocytes from P2X7-deficient mice exhibit enhanced P2X7 responses J. Leukoc. Biol., June 1, 2009; 85(6): 978 - 986. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yip, T. Woehrle, R. Corriden, M. Hirsh, Y. Chen, Y. Inoue, V. Ferrari, P. A. Insel, and W. G. Junger Autocrine regulation of T-cell activation by ATP release and P2X7 receptors FASEB J, June 1, 2009; 23(6): 1685 - 1693. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Skals, N. R. Jorgensen, J. Leipziger, and H. A. Praetorius {alpha}-Hemolysin from Escherichia coli uses endogenous amplification through P2X receptor activation to induce hemolysis PNAS, March 10, 2009; 106(10): 4030 - 4035. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Scheuplein, N. Schwarz, S. Adriouch, C. Krebs, P. Bannas, B. Rissiek, M. Seman, F. Haag, and F. Koch-Nolte NAD+ and ATP Released from Injured Cells Induce P2X7-Dependent Shedding of CD62L and Externalization of Phosphatidylserine by Murine T Cells J. Immunol., March 1, 2009; 182(5): 2898 - 2908. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Mayo, R. Ren, C. Rich, M. A. Stepp, and V. Trinkaus-Randall Regulation by P2X7: Epithelial Migration and Stromal Organization in the Cornea Invest. Ophthalmol. Vis. Sci., October 1, 2008; 49(10): 4384 - 4391. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Heiss, N. Janner, B. Mahnss, V. Schumacher, F. Koch-Nolte, F. Haag, and H.-W. Mittrucker High Sensitivity of Intestinal CD8+ T Cells to Nucleotides Indicates P2X7 as a Regulator for Intestinal T Cell Responses J. Immunol., September 15, 2008; 181(6): 3861 - 3869. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Iglesias, S. Locovei, A. Roque, A. P. Alberto, G. Dahl, D. C. Spray, and E. Scemes P2X7 receptor-Pannexin1 complex: pharmacology and signaling Am J Physiol Cell Physiol, September 1, 2008; 295(3): C752 - C760. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Pelegrin, C. Barroso-Gutierrez, and A. Surprenant P2X7 Receptor Differentially Couples to Distinct Release Pathways for IL-1{beta} in Mouse Macrophage J. Immunol., June 1, 2008; 180(11): 7147 - 7157. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Adriouch, P. Bannas, N. Schwarz, R. Fliegert, A. H. Guse, M. Seman, F. Haag, and F. Koch-Nolte ADP-ribosylation at R125 gates the P2X7 ion channel by presenting a covalent ligand to its nucleotide binding site FASEB J, March 1, 2008; 22(3): 861 - 869. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. J. Taylor, M. Gonzalez-Begne, S. Dewhurst, G. Chimini, C. F. Higgins, J. E. Melvin, and J. I. Elliott Sequential Shrinkage and Swelling Underlie P2X7-Stimulated Lymphocyte Phosphatidylserine Exposure and Death J. Immunol., January 1, 2008; 180(1): 300 - 308. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-J. Jun, J. Kim, S.-Y. Jung, R. Song, J.-H. Noh, Y.-S. Park, S.-H. Ryu, J.-H. Kim, Y.-Y. Kong, J.-M. Chung, et al. Extracellular ATP Mediates Necrotic Cell Swelling in SN4741 Dopaminergic Neurons through P2X7 Receptors J. Biol. Chem., December 28, 2007; 282(52): 37350 - 37358. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sluyter, A. N. Shemon, W. E. Hughes, R. O. Stevenson, J. G. Georgiou, G. D. Eslick, R. M. Taylor, and J. S. Wiley Canine erythrocytes express the P2X7 receptor: greatly increased function compared with human erythrocytes Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2007; 293(5): R2090 - R2098. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Darville, L. Welter-Stahl, C. Cruz, A. A. Sater, C. W. Andrews Jr., and D. M. Ojcius Effect of the Purinergic Receptor P2X7 on Chlamydia Infection in Cervical Epithelial Cells and Vaginally Infected Mice J. Immunol., September 15, 2007; 179(6): 3707 - 3714. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Adriouch, S. Hubert, S. Pechberty, F. Koch-Nolte, F. Haag, and M. Seman NAD+ Released during Inflammation Participates in T Cell Homeostasis by Inducing ART2-Mediated Death of Naive T Cells In Vivo J. Immunol., July 1, 2007; 179(1): 186 - 194. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Young, P. Pelegrin, and A. Surprenant Amino Acid Residues in the P2X7 Receptor that Mediate Differential Sensitivity to ATP and BzATP Mol. Pharmacol., January 1, 2007; 71(1): 92 - 100. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tsukimoto, M. Maehata, H. Harada, A. Ikari, K. Takagi, and M. Degawa P2X7 Receptor-Dependent Cell Death Is Modulated during Murine T Cell Maturation and Mediated by Dual Signaling Pathways. J. Immunol., September 1, 2006; 177(5): 2842 - 2850. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-H. Feng, X. Li, L. Wang, L. Zhou, and G. I. Gorodeski A Truncated P2X7 Receptor Variant (P2X7-j) Endogenously Expressed in Cervical Cancer Cells Antagonizes the Full-length P2X7 Receptor through Hetero-oligomerization J. Biol. Chem., June 23, 2006; 281(25): 17228 - 17237. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Yeung, K. Zablocki, C.-F. Lien, T. Jiang, S. Arkle, W. Brutkowski, J. Brown, H. Lochmuller, J. Simon, E. A. Barnard, et al. Increased susceptibility to ATP via alteration of P2X receptor function in dystrophic mdx mouse muscle cells FASEB J, April 1, 2006; 20(6): 610 - 620. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chen and C. F. Brosnan Exacerbation of Experimental Autoimmune Encephalomyelitis in P2X7R-/- Mice: Evidence for Loss of Apoptotic Activity in Lymphocytes. J. Immunol., March 1, 2006; 176(5): 3115 - 3126. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Shemon, R. Sluyter, S. L. Fernando, A. L. Clarke, L.-P. Dao-Ung, K. K. Skarratt, B. M. Saunders, K. S. Tan, B. J. Gu, S. J. Fuller, et al. A Thr357 to Ser Polymorphism in Homozygous and Compound Heterozygous Subjects Causes Absent or Reduced P2X7 Function and Impairs ATP-induced Mycobacterial Killing by Macrophages J. Biol. Chem., January 27, 2006; 281(4): 2079 - 2086. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Verhoef, S. B. Kertesy, K. Lundberg, J. M. Kahlenberg, and G. R. Dubyak Inhibitory Effects of Chloride on the Activation of Caspase-1, IL-1{beta} Secretion, and Cytolysis by the P2X7 Receptor J. Immunol., December 1, 2005; 175(11): 7623 - 7634. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Aswad, H. Kawamura, and G. Dennert High Sensitivity of CD4+CD25+ Regulatory T Cells to Extracellular Metabolites Nicotinamide Adenine Dinucleotide and ATP: A Role for P2X7 Receptors J. Immunol., September 1, 2005; 175(5): 3075 - 3083. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Auger, I. Motta, K. Benihoud, D. M. Ojcius, and J. M. Kanellopoulos A Role for Mitogen-activated Protein KinaseErk1/2 Activation and Non-selective Pore Formation in P2X7 Receptor-mediated Thymocyte Death J. Biol. Chem., July 29, 2005; 280(30): 28142 - 28151. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Denlinger, G. Angelini, K. Schell, D. N. Green, A. G. Guadarrama, U. Prabhu, D. B. Coursin, P. J. Bertics, and K. Hogan Detection of Human P2X7 Nucleotide Receptor Polymorphisms by a Novel Monocyte Pore Assay Predictive of Alterations in Lipopolysaccharide-Induced Cytokine Production J. Immunol., April 1, 2005; 174(7): 4424 - 4431. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Krebs, S. Adriouch, F. Braasch, W. Koestner, E. H. Leiter, M. Seman, F. E. Lund, N. Oppenheimer, F. Haag, and F. Koch-Nolte CD38 Controls ADP-Ribosyltransferase-2-Catalyzed ADP-Ribosylation of T Cell Surface Proteins J. Immunol., March 15, 2005; 174(6): 3298 - 3305. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kawamura, F. Aswad, M. Minagawa, K. Malone, H. Kaslow, F. Koch-Nolte, W. H. Schott, E. H. Leiter, and G. Dennert P2X7 Receptor-Dependent and -Independent T Cell Death Is Induced by Nicotinamide Adenine Dinucleotide J. Immunol., February 15, 2005; 174(4): 1971 - 1979. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sluyter, A. N. Shemon, J. A. Barden, and J. S. Wiley Extracellular ATP Increases Cation Fluxes in Human Erythrocytes by Activation of the P2X7 Receptor J. Biol. Chem., October 22, 2004; 279(43): 44749 - 44755. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. I. Elliott and C. F. Higgins Major Histocompatibility Complex Class I Shedding and Programmed Cell Death Stimulated Through the Proinflammatory P2X7 Receptor: A Candidate Susceptibility Gene for NOD Diabetes Diabetes, August 1, 2004; 53(8): 2012 - 2017. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Hiken and T. H. Steinberg ATP downregulates P2X7 and inhibits osteoclast formation in RAW cells Am J Physiol Cell Physiol, August 1, 2004; 287(2): C403 - C412. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Grose, S. Tyler, G. Peters, J. Hiebert, G. M. Stephens, W. T. Ruyechan, W. Jackson, J. Storlie, and G. A. Tipples Complete DNA Sequence Analyses of the First Two Varicella-Zoster Virus Glycoprotein E (D150N) Mutant Viruses Found in North America: Evolution of Genotypes with an Accelerated Cell Spread Phenotype J. Virol., July 1, 2004; 78(13): 6799 - 6807. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-P. Courageot, S. Lepine, M. Hours, F. Giraud, and J.-C. Sulpice Involvement of Sodium in Early Phosphatidylserine Exposure and Phospholipid Scrambling Induced by P2X7 Purinoceptor Activation in Thymocytes J. Biol. Chem., May 21, 2004; 279(21): 21815 - 21823. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Le Stunff, R. Auger, J. Kanellopoulos, and M.-N. Raymond The Pro-451 to Leu Polymorphism within the C-terminal Tail of P2X7 Receptor Impairs Cell Death but Not Phospholipase D Activation in Murine Thymocytes J. Biol. Chem., April 23, 2004; 279(17): 16918 - 16926. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Denlinger, K. Schell, G. Angelini, D. Green, A. Guadarrama, U. Prabhu, D. B. Coursin, K. Hogan, and P. J. Bertics A novel assay to detect nucleotide receptor P2X7 genetic polymorphisms influencing numerous innate immune functions Innate Immunity, April 1, 2004; 10(2): 137 - 142. [Abstract] [PDF] |
||||
![]() |
J. S. Wiley, L.-P. Dao-Ung, C. Li, A. N. Shemon, B. J. Gu, M. L. Smart, S. J. Fuller, J. A. Barden, S. Petrou, and R. Sluyter An Ile-568 to Asn Polymorphism Prevents Normal Trafficking and Function of the Human P2X7 Receptor J. Biol. Chem., May 2, 2003; 278(19): 17108 - 17113. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |