The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Adriouch, S.
Right arrow Articles by Haag, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Adriouch, S.
Right arrow Articles by Haag, F.
The Journal of Immunology, 2002, 169: 4108-4112.
Copyright © 2002 by The American Association of Immunologists


Cutting Edge

Cutting Edge: A Natural P451L Mutation in the Cytoplasmic Domain Impairs the Function of the Mouse P2X7 Receptor1

Sahil Adriouch*, Claudia Dox{dagger}, Vivienne Welge{dagger}, Michel Seman*, Friedrich Koch-Nolte{dagger} and Friedrich Haag2,{dagger}

* Université Denis Diderot, Paris France; and {dagger} Institute of Immunology, University Hospital, Hamburg, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
The P2X7 receptor (P2X7R) is an ATP-gated channel that mediates apoptosis of cells of the immune system. The capacity of P2X7R to form large pores depends on its large cytoplasmic tail, which harbors a putative TNFR-related death domain. Previous transfection studies indicated that mouse P2X7R forms pores much less efficiently than its counterparts from humans and rats. In this study, we demonstrate that an allelic mutation (P451L) in the predicted death domain of P2X7R confers a drastically reduced sensitivity to ATP-induced pore formation in cells from some commonly used strains of mice, i.e., C57BL/6 and DBA/2. In contrast, most other strains of mice, including strains derived from wild mice, carry P451 at this position as do rats and humans. The effects of the P451L mutation resemble those of the E496A mutation in human P2X7R. These P2X7R mutants may provide useful tools to decipher the molecular mechanisms leading to pore formation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Following their release from the intracellular compartment into the extracellular space, nucleotides such as ATP and NAD profoundly affect the functions of lymphocytes, macrophages, and other cells (1, 2, 3, 4, 5). In the immune system, extracellular ATP can permeabilize and cause lysis of lymphocytes and APC, and may provide a CD95- and perforin-independent mechanism of inducing apoptosis (6, 7, 8, 9). Prolonged exposure of T cells to ATP induces exposure of phosphatidylserine (PS)3 on the outer leaflet of the plasma membrane, followed by DNA fragmentation and irreversible uptake of propidium iodide (PI; Refs. 7 and 10). ATP can be released into the extracellular compartment by nonlytic mechanisms or as consequence of cell damage in injured tissues or at sites of inflammation (11, 12).

On the basis of its pharmacological properties, the cytolytic actions of ecto-ATP have been ascribed to the P2X7 receptor (P2X7R) (13, 14). A number of peculiar features distinguish P2X7 from other purinergic receptors (10, 15). Whereas other P2X receptors activate at ATP concentrations <50 µM (16), P2X7R requires levels of ATP in the millimolar range to achieve full activation (13, 14, 17). Moreover, P2X7R can exist in at least two conductance states (13). Upon brief exposure to ATP, P2X7R functions as a nonselective cation channel, but upon prolonged exposure, channels rapidly transform into pores allowing passage of solutes up to 800 Da, such as the DNA-staining dye quinolinium, 4-(3-methyl-2[3H]-benzoxazolylidene)methyl)-1–1(3-(triethylammonio)propyl) diodide (YO-PRO-1). Continuous ligation of P2X7R can lead to cell death (18, 19).

The molecular mechanisms leading to pore formation upon activation of P2X7R remain to be defined. Domain-swapping experiments demonstrated that the C-terminal domain, which is significantly larger in P2X7R than in other P2X receptors, is essential (13, 14). Coimmunoprecipitation experiments suggested that P2X7R may form larger complexes with several intracellular proteins (20). Interestingly, the C-terminal tail of P2X7R contains motifs homologous to protein-protein interaction and LPS-binding domains (21). An allelic polymorphism (E496A) in a putative TNFR-related death domain leads to loss of function of human P2X7R (22, 23).

It is not yet clear whether P2X7R itself forms pores or induces pore formation by binding to other proteins. Transfection of 293 human embryonic kidney (HEK) cells with human or rat P2X7R is sufficient to confer ATP-sensitive pore formation (24, 25, 26, 27). Intriguingly, transfectants with mouse P2X7R appeared much less sensitive to ATP, although some in vivo experiments had indicated that mouse T cells, macrophages, and dendritic cells are highly sensitive to ATP (6, 10, 28).

In the context of ongoing investigations on the effects of extracellular nucleotides on T cell functions, we noticed a striking difference in T cell responses to ATP between BALB/c and C57BL/6 mice. In this study, we demonstrate that an allelic polymorphism in the putative death domain of mouse P2X7R (P451L) markedly impairs its function and accounts for differential strain responses to ATP.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Materials

Chemicals were from Sigma-Aldrich (Deisenhofen, Germany), unless indicated otherwise. YO-PRO-1, Fluo-3, and Pluronic F-127 were from Molecular Probes (Leiden, The Netherlands).

Animals, cells, and DNA

Mice were from Charles River Breeding Laboratories (Sulzfeld, Germany); genomic DNAs were from The Jackson Laboratory (Bar Harbor, ME). T cells were prepared for flow cytometry as described (3). B cells were depleted by MACS using anti-B220 magnetic beads (Miltenyi Biotec, Bergisch-Gladbach, Germany). 293HEK cells were from American Type Culture Collection (Manassas, VA).

Assays for calcium uptake, PS exposure, and pore formation

Calcium uptake was assayed by preincubation of cells with 2 µM Fluo-3/0.04% Pluronic F-127 for 20 min at room temperature before FACS analysis. Staining with Annexin VFITC (BD PharMingen, Heidelberg, Germany) and PI was as described previously (3). For assay of YO-PRO-1 uptake, cells were incubated at 37°C with ATP in PBS or sucrose buffer (24), and YO-PRO-1 (1 µg/ml) was added for the last 2 (PBS) or 10 (sucrose) min before FACS analysis.

Cloning, PCR, and cell transfections

P2X7R cDNAs were PCR amplified with high-fidelity Platinium Taq polymerase (Invitrogen, Groningen, The Netherlands) from purified BALB/c or C57BL/6 T cells using P2X7 specific primers described elsewhere (25), and cloned into the pCR4Blunt-Topo vector. Two clones were sequenced completely on both strands (Genome Express, Montreuil, France). The single point mutation was confirmed by direct sequencing of PCR products from two separate PCR using internal primers. For functional expression, cDNAs were subcloned into the pCDNA6/V5-HisB vector (Invitrogen). 293HEK cells (1 x 106) were transfected with 1 µg of expression construct using FuGENE6 transfection reagent (Roche, Mannheim, Germany). Stable transfectants were selected with 6 µg/ml blasticidin. Allele-specific PCR amplification was performed with AmpliTaq Gold polymerase (Applied Biosystems, Weiterstadt, Germany) using allele-specific forward primers 451P-F (CTATCTCTCCACGACTCACCCCC) or 451L-F (CTATCTCT CCACGACTCACCCCT) in combination with P2X7-R (TATAATCCCGGGAGGGATACTTGAAGCCACTGTAC) for 30 cycles (96°C for 30 s, 60°C for 1 min, 72°C for 1 min). Western blot analysis was performed as described previously (29).


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Differential sensitivities of T cells from BALB/c and C57BL/6 mice to ATP-induced calcium uptake and PS exposure

Extracellular ATP induces calcium uptake and death by apoptosis in T cells (28). The latter can be assessed by exposure of PS on the outer leaflet of the plasma membrane, and ultimately by failure to exclude PI. T cells from BALB/c and C57BL/6 mice differ markedly in their sensitivity to these effects of ATP (Fig. 1Go).



View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 1. BALB/c and C57BL/6 T cells differ in sensitivity to ATP-induced calcium uptake and PS exposure. A, Purified splenic T cells from BALB/c and C57BL/6 mice were loaded with the calcium-sensitive fluorescent dye Fluo-3 and analyzed by flow cytometry. At the indicated time point, cells were treated with ATP. B, Cells were incubated for 2 h at 37°C in the presence or absence of ATP and stained with Annexin vFITC and PI. C, Cells were incubated for 30 min at 37°C with the indicated concentrations of ATP and stained as in B.

 
ATP-induced PS exposure is mediated by P2X7R

To determine which purinergic P2 receptor(s) were involved in ATP-mediated PS exposure, the effects of known receptor agonists and antagonists (15, 27) were evaluated. The rank order of sensitivity suggested involvement of P2X7R, because 2',3'-O-(benzoyl-4-benzoyl)-ATP (bzATP), a known P2X7R agonist, was more efficient than ATP itself, and the effect was blocked by 1-[N, O-bis(5-isoquinolinesulfonyl)-N-methyl-L-tyrosyl]-4-phenylpiperazine and oxidized ATP, known inhibitors of P2X7R-mediated responses (Fig. 2Go, A–C). As seen in Fig. 1Go, reactivity was markedly reduced in C57BL/6 T cells. P2X7R differs from other members of the P2 family by its capacity to induce pores in the cell membrane that are permeable to the DNA-binding dye YO-PRO-1. As observed for ATP-induced PS exposure, bzATP-induced YO-PRO-1 uptake was also reduced in C57BL/6 vs BALB/c T cells (Fig. 2GoD). Collectively, these observations indicate that ATP-induced PS exposure is mediated by P2X7R, and that P2X7R function is impaired in C57BL/6 mice.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 2. ATP-mediated PS exposure is mediated by P2X7R. Purified splenic T cells from BALB/c (A) and C57BL/6 (B) mice were incubated for 30 min at 37°C with P2 receptor agonists and analyzed as in Fig. 1GoB. C, Purified BALB/c T cells were treated for 2 h at 37°C with the indicated P2 receptor antagonists before treatment with 500 µM ATP. D, BALB/c and C57BL/6 mice differ in sensitivity to ATP-induced dye uptake. Purified lymph node T cells from BALB/c (open histograms) and C57BL/6 (filled histograms) mice were incubated for 10 min in the absence (top panel) or presence (bottom panel) of 100 µM bzATP. The DNA-staining dye YO-PRO-1 was added for the last 2 min before FACS analysis. {beta},{gamma}-ATP, {beta},{gamma}-methylene-ATP; {alpha},{beta}-ATP, {alpha},{beta}-methylene-ATP; MeSATP, 2-methylthio-ATP; KN-62, 1-[N,O-bis(5-isoquinolinesulfonyl)-N-methyl-L-tyrosyl]-4-phenylpiperazine; o-ATP, oxidized ATP.

 
The P2X7 receptors of BALB/c and C57BL/6 mice differ in a single amino acid located in the cytoplasmic tail

To examine whether this difference in function reflects a variation in primary structure, full-length P2X7R cDNAs were PCR amplified and sequenced from both BALB/c and C57BL/6 mice. A single coding mutation (T1352C) was found in the C57BL/6 allele, resulting in a change from proline to leucine at position 451 (P451L) of the deduced amino acid sequence (Fig. 3GoA, arrow). Sequence alignment showed that the BALB/c allele is in accord with the rat and human orthologs at this position, while the only mouse P2X7R sequence in the databases (NM_011027) shares the P451L mutation with the C57BL/6 allele (not shown). Interestingly, this mutation lies within a region of the C-terminal cytoplasmic domain showing homology to the TNFR 1-death domain (TNFR1-DD) and to a fragment of the Src homology (SH)3-binding protein (SH3BP) 1 (Ref. 21 ; Fig. 3Go).



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 3. BALB/c and C57BL/6 mice differ in a single amino acid residue in the P2X7R C-terminal cytoplasmic domain. A, Alignment of a fragment of the P2X7R cytoplasmic tail with fragments of TNFR1 and SH3BP1 (21 ). The P451L mutation is indicated by an arrow, the E496A mutation found in chronic lymphocytic leukemia patients (22 ) by an asterisk. Conserved residues (*), conserved (:), and semiconserved (.) substitutions of P2X7R to TNFR1 and SH3BP are indicated below the respective sequences. The six {alpha} helices of the TNFR1-DD (34 ) are indicated by {square}. {alpha}-Helical domains of the P2X7R cytoplasmic tail were predicted using the profile network from Heidelbus (PHD) algorithm (35 ) based on an alignment of mouse, rat, and human P2X7R, and are shown as {blacksquare}. Predictions for residues with an expected accuracy >82% are indicated by H for "helical" and L for "loop". B, Schematic diagram of P2X7R, showing the P451L and E496A mutations and regions of similarity with TNFR1, SH3BP1, and a putative LPS-binding domain (21 ). C, Distribution of the P451L mutation among inbred mouse strains. DNA from the indicated strains was PCR amplified using primers specific for the 451P or L alleles. D, ATP-induced PS exposure is reduced in mice carrying the 451L allele. Purified splenic T cells from the indicated mouse strains were incubated with 500 µM ATP and analyzed for annexin V binding as in Fig. 1GoB. NOD, nonobese diabetic; NZW, New Zealand White.

 
To determine the distribution of the two alleles among laboratory mice, mouse genomic DNAs were analyzed by PCR amplification using primers designed to specifically recognize each of the variants. Of the 14 specimens analyzed, only DNA from C57BL/6, C57BL/10, DBA/1, and DBA/2 mice carried the 451L allele. All other mice analyzed, including four strains derived from wild mice (Mus caroli, Mus spretus, Mus musculus, Mus poschiavinus), carried the 451P allele (Fig. 3GoC and not shown). Thus, it is likely that 451P represents the wild type within the mouse population.

Analysis of T cells from DBA/1 mice, a second strain carrying the P451L mutation, showed reduced ATP-induced PS exposure in this strain also, confirming the association of P2X7R function with the genotype at this locus (Fig. 3GoD).

To determine whether the P451L mutation is the cause for the observed differences in P2X7R function, HEK cells were transfected with cDNAs encoding the two variants. Though lack of reagents precluded surface staining, Western blot analysis showed comparable expression of both variants (Fig. 4GoA). ATP-induced YO-PRO-1 uptake, PS exposure, and calcium influx were stronger in cells transfected with the 451P allele than in their 451L counterparts (Figs. 4Go, B–F). Because the two cDNAs differ in a single coding mutation, these experiments conclusively show that the P451L substitution severely affects the function of P2X7R as cation channel and macropore.



View larger version (46K):
[in this window]
[in a new window]
 
FIGURE 4. The P451L mutation impairs P2X7R function. A, Western blot analysis of P2X7R expression in HEK cells and subclones stably transfected with the 451P or 451L P2X7R alleles. B, ATP-induced pore formation is reduced in cells carrying the 451L allele. Transfected HEK cells were incubated with YO-PRO-1 and 1 mM ATP for 2 min and analyzed by flow cytometry. Shaded histograms represent parental 293HEK cells. C, ATP-induced PS exposure is reduced in cells carrying the 451L allele. Transfected HEK cells were incubated with Annexin VFITC and 1 mM ATP for 5 min, and were analyzed by flow cytometry. Shaded histograms represent parental 293HEK cells. D, Kinetics of dye uptake by HEK 451L and 451P transfectants. Cells were incubated with YO-PRO-1, and baseline fluorescence was determined in a flow cytometer. The increase in mean fluorescence intensity relative to baseline following addition of 1 mM ATP is shown. E, Dose response to ATP of HEK transfectants. Uptake of YO-PRO-1 by transfected HEK cells (eight independent clones bearing the 451P and four bearing the 451L allele) was determined in sucrose buffer (24 ). F, Calcium uptake by HEK 451L and 451P transfectants. Calcium uptake was measured in HEK transfectants as in Fig. 1Go.

 
The C-terminal cytoplasmic domain of the P2X7R protein is known to be important for receptor function. Deletion of this domain abolished pore-forming and lytic activities of the receptor (13). In humans, a severely impairing mutation (E496A) has been observed within this region (22). The frequency of E496A is elevated among individuals suffering from chronic lymphocytic leukemia, and the mutation is thought to contribute to disease pathogenesis by interfering with apoptosis in B lymphocytes (23). Like E496A, P451L also maps to a region of the cytoplasmic tail that shows homology to the TNFR1-DD (21). Secondary structure prediction algorithms predict this region, like TNFR1-DD, to be primarily {alpha}-helical (Fig. 3GoA). P451L, in addition, lies within an area of homology to the SH3BP1 (21), and thus may interfere with the interaction of P2X7R with an SH3-domain-containing protein. Intriguingly, alignment with the corresponding regions of TNFR1 and SH3BP1 shows that the proline at position 451 is conserved in all proteins with the exception of C57BL/6 P2X7R (Fig. 3GoA). Because P2X7R exists in the membrane in a complex with multiple other proteins (20), it is tempting to speculate that the P451L mutation affects the capacity of the receptor to interact with other proteins.

Our findings have implications also for the evaluation of previous studies concerning mouse P2X7R. Transfection studies showed that mouse P2X7R is much less sensitive to ATP than its rat or human orthologs (17, 26). This may be explained by the presence of the P451L mutation in the NM_011027 cDNA used for transfection. Our findings also bear relevance for studies using P2X7R-deficient mice (30, 31, 32). In some of these, the P2X7R-/- phenotype may have been underestimated because it was analyzed against genetic backgrounds (C57BL/6 or DBA/2) already carrying a naturally defective variant.

In conclusion, our findings provide a second example of a naturally occurring point mutation within the P2X7R cytoplasmic domain that severely impairs important functions of this receptor, namely pore formation and reorganization of the plasma membrane. Both of these are likely crucial steps involved in biological responses mediated by this receptor such as the induction of apoptosis and cytokine secretion (33). The occurrence of the P451L mutation within a region of similarity to both the TNFR-death domain and an SH3-binding domain supports the notion that these observed homologies may be of functional significance. The further analysis of this mutation thus may provide important insights into the molecular mechanisms of P2X7R action.


    Acknowledgments
 
We thank S. Pechberty, G. Dubberke, D. Freese, and W. Ohlrogge for excellent assistance.


    Footnotes
 
1 This work was supported by a grant from the Ministère de la Recherche et de la Technologie and by Deutsche Forschungsgemeinschaft Grant SFB 545/B9 (to F.K.-N. and F.H.). S.A. is a recipient of a fellowship from the Association pour la Recherche sur le Cancer. Back

2 Address correspondence and reprint requests to Dr. Friedrich Haag, Institute of Immunology, Martinistrasse 52, D-20246 Hamburg, Germany. E-mail address: haag{at}uke.uni-hamburg.de Back

3 Abbreviations used in this paper: PS, phosphatidylserine; PI, propidium iodide; P2X7R, P2X7 receptor; YO-PRO-1, quinolinium, 4-(3-methyl-2[3H]-benzoxazolylidene)methyl)-1–1(3-(triethylammonio)propyl) diodide; HEK, human embryonic kidney; bzATP, 2',3'-O-(benzoyl-4-benzoyl)-ATP; SH, Src homology; SH3BP, SH3-binding protein; TNFR1-DD, TNFR1-death domain. Back

Received for publication June 14, 2002. Accepted for publication August 28, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Gordon, J. L.. 1986. Extracellular ATP: effects, sources and fate. Biochem. J. 233:309.[Medline]
  2. Goding, J. W., M. C. Howard. 1998. Ecto-enzymes of lymphoid cells. Immunol. Rev. 161:5.[Medline]
  3. Adriouch, S., W. Ohlrogge, F. Haag, F. Koch-Nolte, M. Seman. 2001. Rapid induction of naive T cell apoptosis by ecto-nicotinamide adenine dinucleotide: requirement for mono(ADP-ribosyl)transferase 2 and a downstream effector. J. Immunol. 167:196.[Abstract/Free Full Text]
  4. Kichenin, K., S. Decollogne, J. Angignard, M. Seman. 2000. Cardiovascular and pulmonary response to oral administration of ATP in rabbits. J. Appl. Physiol. 88:1962.[Abstract/Free Full Text]
  5. Kichenin, K., M. Seman. 2000. Chronic oral administration of ATP modulates nucleoside transport and purine metabolism in rats. J. Pharmacol. Exp. Ther. 294:126.[Abstract/Free Full Text]
  6. Buisman, H. P., T. H. Steinberg, J. Fischbarg, S. C. Silverstein, S. A. Vogelzang, C. Ince, D. L. Ypey, P. C. Leijh. 1988. Extracellular ATP induces a large nonselective conductance in macrophage plasma membranes. Proc. Natl. Acad. Sci. USA 85:7988.[Abstract/Free Full Text]
  7. Di Virgilio, F., P. Pizzo, P. Zanovello, V. Bronte, D. Collavo. 1990. Extracellular ATP as a possible mediator of cell-mediated cytotoxicity. Immunol. Today 11:274.[Medline]
  8. Filippini, A., R. E. Taffs, M. V. Sitkovsky. 1990. Extracellular ATP in T-lymphocyte activation: possible role in effector functions. Proc. Natl. Acad. Sci. USA 87:8267.[Abstract/Free Full Text]
  9. Blanchard, D. K., S. Wei, C. Duan, F. Pericle, J. I. Diaz, J. Y. Djeu. 1995. Role of extracellular adenosine triphosphate in the cytotoxic T-lymphocyte-mediated lysis of antigen presenting cells. Blood 85:3173.[Abstract/Free Full Text]
  10. Di Virgilio, F., P. Chiozzi, D. Ferrari, S. Falzoni, J. M. Sanz, A. Morelli, M. Torboli, G. Bolognesi, O. R. Baricordi. 2001. Nucleotide receptors: an emerging family of regulatory molecules in blood cells. Blood 97:587.[Abstract/Free Full Text]
  11. Cotrina, M. L., J. H. Lin, A. Alves-Rodrigues, S. Liu, J. Li, H. Azmi-Ghadimi, J. Kang, C. C. Naus, M. Nedergaard. 1998. Connexins regulate calcium signaling by controlling ATP release. Proc. Natl. Acad. Sci. USA 95:15735.[Abstract/Free Full Text]
  12. Jiang, Q., D. Mak, S. Devidas, E. M. Schwiebert, A. Bragin, Y. Zhang, W. R. Skach, W. B. Guggino, J. K. Foskett, J. F. Engelhardt. 1998. Cystic fibrosis transmembrane conductance regulator-associated ATP release is controlled by a chloride sensor. J. Cell Biol. 143:645.[Abstract/Free Full Text]
  13. Surprenant, A., F. Rassendren, E. Kawashima, R. A. North, G. Buell. 1996. The cytolytic P2Z receptor for extracellular ATP identified as a P2X receptor (P2X7). Science 272:735.[Abstract]
  14. Rassendren, F., G. N. Buell, C. Virginio, G. Collo, R. A. North, A. Surprenant. 1997. The permeabilizing ATP receptor, P2X7: cloning and expression of a human cDNA. J. Biol. Chem. 272:5482.[Abstract/Free Full Text]
  15. Abbracchio, M. P., G. Burnstock. 1994. Purinoceptors: are there families of P2X and P2Y purinoceptors?. Pharmacol. Ther. 64:445.[Medline]
  16. Greenberg, S., F. Di Virgilio, T. H. Steinberg, S. C. Silverstein. 1988. Extracellular nucleotides mediate Ca2+ fluxes in J774 macrophages by two distinct mechanisms. J. Biol. Chem. 263:10337.[Abstract/Free Full Text]
  17. Hibell, A. D., E. J. Kidd, I. P. Chessell, P. P. Humphrey, A. D. Michel. 2000. Apparent species differences in the kinetic properties of P2X7 receptors. Br. J. Pharmacol. 130:167.[Medline]
  18. Di Virgilio, F.. 1995. The P2Z purinoceptor: an intriguing role in immunity, inflammation and cell death. Immunol. Today 16:524.[Medline]
  19. Ferrari, D., M. Los, M. K. Bauer, P. Vandenabeele, S. Wesselborg, K. Schulze-Osthoff. 1999. P2Z purinoreceptor ligation induces activation of caspases with distinct roles in apoptotic and necrotic alterations of cell death. FEBS Lett. 447:71.[Medline]
  20. Kim, M., L. H. Jiang, H. L. Wilson, R. A. North, A. Surprenant. 2001. Proteomic and functional evidence for a P2X7 receptor signalling complex. EMBO J. 20:6347.[Medline]
  21. Denlinger, L. C., P. L. Fisette, J. A. Sommer, J. J. Watters, U. Prabhu, G. R. Dubyak, R. A. Proctor, P. J. Bertics. 2001. Cutting edge: the nucleotide receptor P2X7 contains multiple protein- and lipid-interaction motifs including a potential binding site for bacterial lipopolysaccharide. J. Immunol. 167:1871.[Abstract/Free Full Text]
  22. Gu, B. J., W. Zhang, R. A. Worthington, R. Sluyter, P. Dao-Ung, S. Petrou, J. A. Barden, J. S. Wiley. 2001. A Glu496 to Ala polymorphism leads to loss of function of the human P2X7 receptor. J. Biol. Chem. 276:11135.[Abstract/Free Full Text]
  23. Wiley, J. S., L. P. Dao-Ung, B. J. Gu, R. Sluyter, A. N. Shemon, C. Li, J. Taper, J. Gallo, A. Manoharan. 2002. A loss-of-function polymorphic mutation in the cytolytic P2X7 receptor gene and chronic lymphocytic leukaemia: a molecular study. Lancet 359:1114.[Medline]
  24. Hibell, A. D., K. M. Thompson, M. Xing, P. P. Humphrey, A. D. Michel. 2001. Complexities of measuring antagonist potency at P2X7 receptor orthologs. J. Pharmacol. Exp. Ther. 296:947.[Abstract/Free Full Text]
  25. Chessell, I. P., J. Simon, A. D. Hibell, A. D. Michel, E. A. Barnard, P. P. Humphrey. 1998. Cloning and functional characterisation of the mouse P2X7 receptor. FEBS Lett. 439:26.[Medline]
  26. Hibell, A. D., K. M. Thompson, J. Simon, M. Xing, P. P. Humphrey, A. D. Michel. 2001. Species- and agonist-dependent differences in the deactivation-kinetics of P2X7 receptors. Naunyn Schmiedeberg’s Arch. Pharmacol. 363:639.[Medline]
  27. North, R. A., A. Surprenant. 2000. Pharmacology of cloned P2X receptors. Annu. Rev. Pharmacol. Toxicol. 40:563.[Medline]
  28. Di Virgilio, F., V. Bronte, D. Collavo, P. Zanovello. 1989. Responses of mouse lymphocytes to extracellular adenosine 5'-triphosphate (ATP): lymphocytes with cytotoxic activity are resistant to the permeabilizing effects of ATP. J. Immunol. 143:1955.[Abstract]
  29. Kahl, S., M. Nissen, R. Girisch, T. Duffy, E. H. Leiter, F. Haag, F. Koch-Nolte. 2000. Metalloprotease-mediated shedding of enzymatically active mouse ecto-ADP-ribosyltransferase ART2.2 upon T cell activation. J. Immunol. 165:4463.[Abstract/Free Full Text]
  30. Sikora, A., J. Liu, C. Brosnan, G. Buell, I. Chessel, B. R. Bloom. 1999. Cutting edge: purinergic signaling regulates radical-mediated bacterial killing mechanisms in macrophages through a P2X7-independent mechanism. J. Immunol. 163:558.[Abstract/Free Full Text]
  31. Solle, M., J. Labasi, D. G. Perregaux, E. Stam, N. Petrushova, B. H. Koller, R. J. Griffiths, C. A. Gabel. 2001. Altered cytokine production in mice lacking P2X7 receptors. J. Biol. Chem. 276:125.[Abstract/Free Full Text]
  32. Labasi, J. M., N. Petrushova, C. Donovan, S. McCurdy, P. Lira, M. M. Payette, W. Brissette, J. R. Wicks, L. Audoly, C. A. Gabel. 2002. Absence of the P2X7 receptor alters leukocyte function and attenuates an inflammatory response. J. Immunol. 168:6436.[Abstract/Free Full Text]
  33. Ferrari, D., P. Chiozzi, S. Falzoni, M. Dal Susino, L. Melchiorri, O. R. Baricordi, F. Di Virgilio. 1997. Extracellular ATP triggers IL-1{beta} release by activating the purinergic P2Z receptor of human macrophages. J. Immunol. 159:1451.[Abstract]
  34. Sukits, S. F., L. L. Lin, S. Hsu, K. Malakian, R. Powers, G. Y. Xu. 2001. Solution structure of the tumor necrosis factor receptor-1 death domain. J. Mol. Biol. 310:895.[Medline]
  35. Rost, B., C. Sander. 1993. Prediction of protein secondary structure at better than 70% accuracy. J. Mol. Biol. 232:584.[Medline]



This article has been cited by other articles:


Home page
IOVSHome page
C. Mayo, R. Ren, C. Rich, M. A. Stepp, and V. Trinkaus-Randall
Regulation by P2X7: Epithelial Migration and Stromal Organization in the Cornea
Invest. Ophthalmol. Vis. Sci., October 1, 2008; 49(10): 4384 - 4391.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Heiss, N. Janner, B. Mahnss, V. Schumacher, F. Koch-Nolte, F. Haag, and H.-W. Mittrucker
High Sensitivity of Intestinal CD8+ T Cells to Nucleotides Indicates P2X7 as a Regulator for Intestinal T Cell Responses
J. Immunol., September 15, 2008; 181(6): 3861 - 3869.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
R. Iglesias, S. Locovei, A. Roque, A. P. Alberto, G. Dahl, D. C. Spray, and E. Scemes
P2X7 receptor-Pannexin1 complex: pharmacology and signaling
Am J Physiol Cell Physiol, September 1, 2008; 295(3): C752 - C760.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Pelegrin, C. Barroso-Gutierrez, and A. Surprenant
P2X7 Receptor Differentially Couples to Distinct Release Pathways for IL-1{beta} in Mouse Macrophage
J. Immunol., June 1, 2008; 180(11): 7147 - 7157.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
S. Adriouch, P. Bannas, N. Schwarz, R. Fliegert, A. H. Guse, M. Seman, F. Haag, and F. Koch-Nolte
ADP-ribosylation at R125 gates the P2X7 ion channel by presenting a covalent ligand to its nucleotide binding site
FASEB J, March 1, 2008; 22(3): 861 - 869.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. R. J. Taylor, M. Gonzalez-Begne, S. Dewhurst, G. Chimini, C. F. Higgins, J. E. Melvin, and J. I. Elliott
Sequential Shrinkage and Swelling Underlie P2X7-Stimulated Lymphocyte Phosphatidylserine Exposure and Death
J. Immunol., January 1, 2008; 180(1): 300 - 308.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D.-J. Jun, J. Kim, S.-Y. Jung, R. Song, J.-H. Noh, Y.-S. Park, S.-H. Ryu, J.-H. Kim, Y.-Y. Kong, J.-M. Chung, et al.
Extracellular ATP Mediates Necrotic Cell Swelling in SN4741 Dopaminergic Neurons through P2X7 Receptors
J. Biol. Chem., December 28, 2007; 282(52): 37350 - 37358.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
R. Sluyter, A. N. Shemon, W. E. Hughes, R. O. Stevenson, J. G. Georgiou, G. D. Eslick, R. M. Taylor, and J. S. Wiley
Canine erythrocytes express the P2X7 receptor: greatly increased function compared with human erythrocytes
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2007; 293(5): R2090 - R2098.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Darville, L. Welter-Stahl, C. Cruz, A. A. Sater, C. W. Andrews Jr., and D. M. Ojcius
Effect of the Purinergic Receptor P2X7 on Chlamydia Infection in Cervical Epithelial Cells and Vaginally Infected Mice
J. Immunol., September 15, 2007; 179(6): 3707 - 3714.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Adriouch, S. Hubert, S. Pechberty, F. Koch-Nolte, F. Haag, and M. Seman
NAD+ Released during Inflammation Participates in T Cell Homeostasis by Inducing ART2-Mediated Death of Naive T Cells In Vivo
J. Immunol., July 1, 2007; 179(1): 186 - 194.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. T. Young, P. Pelegrin, and A. Surprenant
Amino Acid Residues in the P2X7 Receptor that Mediate Differential Sensitivity to ATP and BzATP
Mol. Pharmacol., January 1, 2007; 71(1): 92 - 100.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Tsukimoto, M. Maehata, H. Harada, A. Ikari, K. Takagi, and M. Degawa
P2X7 Receptor-Dependent Cell Death Is Modulated during Murine T Cell Maturation and Mediated by Dual Signaling Pathways.
J. Immunol., September 1, 2006; 177(5): 2842 - 2850.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-H. Feng, X. Li, L. Wang, L. Zhou, and G. I. Gorodeski
A Truncated P2X7 Receptor Variant (P2X7-j) Endogenously Expressed in Cervical Cancer Cells Antagonizes the Full-length P2X7 Receptor through Hetero-oligomerization
J. Biol. Chem., June 23, 2006; 281(25): 17228 - 17237.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
D. Yeung, K. Zablocki, C.-F. Lien, T. Jiang, S. Arkle, W. Brutkowski, J. Brown, H. Lochmuller, J. Simon, E. A. Barnard, et al.
Increased susceptibility to ATP via alteration of P2X receptor function in dystrophic mdx mouse muscle cells
FASEB J, April 1, 2006; 20(6): 610 - 620.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Chen and C. F. Brosnan
Exacerbation of Experimental Autoimmune Encephalomyelitis in P2X7R-/- Mice: Evidence for Loss of Apoptotic Activity in Lymphocytes.
J. Immunol., March 1, 2006; 176(5): 3115 - 3126.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. N. Shemon, R. Sluyter, S. L. Fernando, A. L. Clarke, L.-P. Dao-Ung, K. K. Skarratt, B. M. Saunders, K. S. Tan, B. J. Gu, S. J. Fuller, et al.
A Thr357 to Ser Polymorphism in Homozygous and Compound Heterozygous Subjects Causes Absent or Reduced P2X7 Function and Impairs ATP-induced Mycobacterial Killing by Macrophages
J. Biol. Chem., January 27, 2006; 281(4): 2079 - 2086.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. A. Verhoef, S. B. Kertesy, K. Lundberg, J. M. Kahlenberg, and G. R. Dubyak
Inhibitory Effects of Chloride on the Activation of Caspase-1, IL-1{beta} Secretion, and Cytolysis by the P2X7 Receptor
J. Immunol., December 1, 2005; 175(11): 7623 - 7634.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Aswad, H. Kawamura, and G. Dennert
High Sensitivity of CD4+CD25+ Regulatory T Cells to Extracellular Metabolites Nicotinamide Adenine Dinucleotide and ATP: A Role for P2X7 Receptors
J. Immunol., September 1, 2005; 175(5): 3075 - 3083.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Auger, I. Motta, K. Benihoud, D. M. Ojcius, and J. M. Kanellopoulos
A Role for Mitogen-activated Protein KinaseErk1/2 Activation and Non-selective Pore Formation in P2X7 Receptor-mediated Thymocyte Death
J. Biol. Chem., July 29, 2005; 280(30): 28142 - 28151.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. C. Denlinger, G. Angelini, K. Schell, D. N. Green, A. G. Guadarrama, U. Prabhu, D. B. Coursin, P. J. Bertics, and K. Hogan
Detection of Human P2X7 Nucleotide Receptor Polymorphisms by a Novel Monocyte Pore Assay Predictive of Alterations in Lipopolysaccharide-Induced Cytokine Production
J. Immunol., April 1, 2005; 174(7): 4424 - 4431.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Krebs, S. Adriouch, F. Braasch, W. Koestner, E. H. Leiter, M. Seman, F. E. Lund, N. Oppenheimer, F. Haag, and F. Koch-Nolte
CD38 Controls ADP-Ribosyltransferase-2-Catalyzed ADP-Ribosylation of T Cell Surface Proteins
J. Immunol., March 15, 2005; 174(6): 3298 - 3305.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Kawamura, F. Aswad, M. Minagawa, K. Malone, H. Kaslow, F. Koch-Nolte, W. H. Schott, E. H. Leiter, and G. Dennert
P2X7 Receptor-Dependent and -Independent T Cell Death Is Induced by Nicotinamide Adenine Dinucleotide
J. Immunol., February 15, 2005; 174(4): 1971 - 1979.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Sluyter, A. N. Shemon, J. A. Barden, and J. S. Wiley
Extracellular ATP Increases Cation Fluxes in Human Erythrocytes by Activation of the P2X7 Receptor
J. Biol. Chem., October 22, 2004; 279(43): 44749 - 44755.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
J. I. Elliott and C. F. Higgins
Major Histocompatibility Complex Class I Shedding and Programmed Cell Death Stimulated Through the Proinflammatory P2X7 Receptor: A Candidate Susceptibility Gene for NOD Diabetes
Diabetes, August 1, 2004; 53(8): 2012 - 2017.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. F. Hiken and T. H. Steinberg
ATP downregulates P2X7 and inhibits osteoclast formation in RAW cells
Am J Physiol Cell Physiol, August 1, 2004; 287(2): C403 - C412.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. Grose, S. Tyler, G. Peters, J. Hiebert, G. M. Stephens, W. T. Ruyechan, W. Jackson, J. Storlie, and G. A. Tipples
Complete DNA Sequence Analyses of the First Two Varicella-Zoster Virus Glycoprotein E (D150N) Mutant Viruses Found in North America: Evolution of Genotypes with an Accelerated Cell Spread Phenotype
J. Virol., July 1, 2004; 78(13): 6799 - 6807.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M.-P. Courageot, S. Lepine, M. Hours, F. Giraud, and J.-C. Sulpice
Involvement of Sodium in Early Phosphatidylserine Exposure and Phospholipid Scrambling Induced by P2X7 Purinoceptor Activation in Thymocytes
J. Biol. Chem., May 21, 2004; 279(21): 21815 - 21823.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Le Stunff, R. Auger, J. Kanellopoulos, and M.-N. Raymond
The Pro-451 to Leu Polymorphism within the C-terminal Tail of P2X7 Receptor Impairs Cell Death but Not Phospholipase D Activation in Murine Thymocytes
J. Biol. Chem., April 23, 2004; 279(17): 16918 - 16926.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
L. C. Denlinger, K. Schell, G. Angelini, D. Green, A. Guadarrama, U. Prabhu, D. B. Coursin, K. Hogan, and P. J. Bertics
A novel assay to detect nucleotide receptor P2X7 genetic polymorphisms influencing numerous innate immune functions
Innate Immunity, April 1, 2004; 10(2): 137 - 142.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
J. S. Wiley, L.-P. Dao-Ung, C. Li, A. N. Shemon, B. J. Gu, M. L. Smart, S. J. Fuller, J. A. Barden, S. Petrou, and R. Sluyter
An Ile-568 to Asn Polymorphism Prevents Normal Trafficking and Function of the Human P2X7 Receptor
J. Biol. Chem., May 2, 2003; 278(19): 17108 - 17113.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services