HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Adriouch, S. Articles by Haag, F. Search for Related Content PubMed PubMed Citation Articles by Adriouch, S. Articles by Haag, F.

Cutting Edge: A Natural P451L Mutation in the Cytoplasmic Domain Impairs the Function of the Mouse P2X7 Receptor¹

Sahil Adriouch^*, Claudia Dox, Vivienne Welge, Michel Seman^*, Friedrich Koch-Nolte and Friedrich Haag^2,

^* Université Denis Diderot, Paris France; and Institute of Immunology, University Hospital, Hamburg, Germany

	Abstract

Top Abstract Introduction Materials and Methods Results and Discussion References

 
The P2X7 receptor (P2X₇R) is an ATP-gated channel that mediates apoptosis of cells of the immune system. The capacity of P2X₇R to form large pores depends on its large cytoplasmic tail, which harbors a putative TNFR-related death domain. Previous transfection studies indicated that mouse P2X₇R forms pores much less efficiently than its counterparts from humans and rats. In this study, we demonstrate that an allelic mutation (P451L) in the predicted death domain of P2X₇R confers a drastically reduced sensitivity to ATP-induced pore formation in cells from some commonly used strains of mice, i.e., C57BL/6 and DBA/2. In contrast, most other strains of mice, including strains derived from wild mice, carry P451 at this position as do rats and humans. The effects of the P451L mutation resemble those of the E496A mutation in human P2X₇R. These P2X₇R mutants may provide useful tools to decipher the molecular mechanisms leading to pore formation.

	Introduction

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Following their release from the intracellular compartment into the extracellular space, nucleotides such as ATP and NAD profoundly affect the functions of lymphocytes, macrophages, and other cells (1, 2, 3, 4, 5). In the immune system, extracellular ATP can permeabilize and cause lysis of lymphocytes and APC, and may provide a CD95- and perforin-independent mechanism of inducing apoptosis (6, 7, 8, 9). Prolonged exposure of T cells to ATP induces exposure of phosphatidylserine (PS)³ on the outer leaflet of the plasma membrane, followed by DNA fragmentation and irreversible uptake of propidium iodide (PI; Refs. 7 and 10). ATP can be released into the extracellular compartment by nonlytic mechanisms or as consequence of cell damage in injured tissues or at sites of inflammation (11, 12).

On the basis of its pharmacological properties, the cytolytic actions of ecto-ATP have been ascribed to the P2X7 receptor (P2X₇R) (13, 14). A number of peculiar features distinguish P2X7 from other purinergic receptors (10, 15). Whereas other P2X receptors activate at ATP concentrations <50 µM (16), P2X₇R requires levels of ATP in the millimolar range to achieve full activation (13, 14, 17). Moreover, P2X₇R can exist in at least two conductance states (13). Upon brief exposure to ATP, P2X₇R functions as a nonselective cation channel, but upon prolonged exposure, channels rapidly transform into pores allowing passage of solutes up to 800 Da, such as the DNA-staining dye quinolinium, 4-(3-methyl-2[³H]-benzoxazolylidene)methyl)-1–1(3-(triethylammonio)propyl) diodide (YO-PRO-1). Continuous ligation of P2X₇R can lead to cell death (18, 19).

The molecular mechanisms leading to pore formation upon activation of P2X₇R remain to be defined. Domain-swapping experiments demonstrated that the C-terminal domain, which is significantly larger in P2X₇R than in other P2X receptors, is essential (13, 14). Coimmunoprecipitation experiments suggested that P2X₇R may form larger complexes with several intracellular proteins (20). Interestingly, the C-terminal tail of P2X₇R contains motifs homologous to protein-protein interaction and LPS-binding domains (21). An allelic polymorphism (E496A) in a putative TNFR-related death domain leads to loss of function of human P2X₇R (22, 23).

It is not yet clear whether P2X₇R itself forms pores or induces pore formation by binding to other proteins. Transfection of 293 human embryonic kidney (HEK) cells with human or rat P2X₇R is sufficient to confer ATP-sensitive pore formation (24, 25, 26, 27). Intriguingly, transfectants with mouse P2X₇R appeared much less sensitive to ATP, although some in vivo experiments had indicated that mouse T cells, macrophages, and dendritic cells are highly sensitive to ATP (6, 10, 28).

In the context of ongoing investigations on the effects of extracellular nucleotides on T cell functions, we noticed a striking difference in T cell responses to ATP between BALB/c and C57BL/6 mice. In this study, we demonstrate that an allelic polymorphism in the putative death domain of mouse P2X₇R (P451L) markedly impairs its function and accounts for differential strain responses to ATP.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Materials

Chemicals were from Sigma-Aldrich (Deisenhofen, Germany), unless indicated otherwise. YO-PRO-1, Fluo-3, and Pluronic F-127 were from Molecular Probes (Leiden, The Netherlands).

Animals, cells, and DNA

Mice were from Charles River Breeding Laboratories (Sulzfeld, Germany); genomic DNAs were from The Jackson Laboratory (Bar Harbor, ME). T cells were prepared for flow cytometry as described (3). B cells were depleted by MACS using anti-B220 magnetic beads (Miltenyi Biotec, Bergisch-Gladbach, Germany). 293HEK cells were from American Type Culture Collection (Manassas, VA).

Assays for calcium uptake, PS exposure, and pore formation

Calcium uptake was assayed by preincubation of cells with 2 µM Fluo-3/0.04% Pluronic F-127 for 20 min at room temperature before FACS analysis. Staining with Annexin V^FITC (BD PharMingen, Heidelberg, Germany) and PI was as described previously (3). For assay of YO-PRO-1 uptake, cells were incubated at 37°C with ATP in PBS or sucrose buffer (24), and YO-PRO-1 (1 µg/ml) was added for the last 2 (PBS) or 10 (sucrose) min before FACS analysis.

Cloning, PCR, and cell transfections

P2X₇R cDNAs were PCR amplified with high-fidelity Platinium Taq polymerase (Invitrogen, Groningen, The Netherlands) from purified BALB/c or C57BL/6 T cells using P2X7 specific primers described elsewhere (25), and cloned into the pCR4Blunt-Topo vector. Two clones were sequenced completely on both strands (Genome Express, Montreuil, France). The single point mutation was confirmed by direct sequencing of PCR products from two separate PCR using internal primers. For functional expression, cDNAs were subcloned into the pCDNA6/V5-HisB vector (Invitrogen). 293HEK cells (1 x 10⁶) were transfected with 1 µg of expression construct using FuGENE6 transfection reagent (Roche, Mannheim, Germany). Stable transfectants were selected with 6 µg/ml blasticidin. Allele-specific PCR amplification was performed with AmpliTaq Gold polymerase (Applied Biosystems, Weiterstadt, Germany) using allele-specific forward primers 451P-F (CTATCTCTCCACGACTCACCCCC) or 451L-F (CTATCTCT CCACGACTCACCCCT) in combination with P2X7-R (TATAATCCCGGGAGGGATACTTGAAGCCACTGTAC) for 30 cycles (96°C for 30 s, 60°C for 1 min, 72°C for 1 min). Western blot analysis was performed as described previously (29).

	Results and Discussion

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Differential sensitivities of T cells from BALB/c and C57BL/6 mice to ATP-induced calcium uptake and PS exposure

Extracellular ATP induces calcium uptake and death by apoptosis in T cells (28). The latter can be assessed by exposure of PS on the outer leaflet of the plasma membrane, and ultimately by failure to exclude PI. T cells from BALB/c and C57BL/6 mice differ markedly in their sensitivity to these effects of ATP (Fig. 1).

View larger version (43K): [in this window] [in a new window]   FIGURE 1. BALB/c and C57BL/6 T cells differ in sensitivity to ATP-induced calcium uptake and PS exposure. A, Purified splenic T cells from BALB/c and C57BL/6 mice were loaded with the calcium-sensitive fluorescent dye Fluo-3 and analyzed by flow cytometry. At the indicated time point, cells were treated with ATP. B, Cells were incubated for 2 h at 37°C in the presence or absence of ATP and stained with Annexin vFITC and PI. C, Cells were incubated for 30 min at 37°C with the indicated concentrations of ATP and stained as in B.

To determine which purinergic P2 receptor(s) were involved in ATP-mediated PS exposure, the effects of known receptor agonists and antagonists (15, 27) were evaluated. The rank order of sensitivity suggested involvement of P2X₇R, because 2',3'-O-(benzoyl-4-benzoyl)-ATP (bzATP), a known P2X₇R agonist, was more efficient than ATP itself, and the effect was blocked by 1-[N, O-bis(5-isoquinolinesulfonyl)-N-methyl-L-tyrosyl]-4-phenylpiperazine and oxidized ATP, known inhibitors of P2X₇R-mediated responses (Fig. 2, A–C). As seen in Fig. 1, reactivity was markedly reduced in C57BL/6 T cells. P2X₇R differs from other members of the P2 family by its capacity to induce pores in the cell membrane that are permeable to the DNA-binding dye YO-PRO-1. As observed for ATP-induced PS exposure, bzATP-induced YO-PRO-1 uptake was also reduced in C57BL/6 vs BALB/c T cells (Fig. 2D). Collectively, these observations indicate that ATP-induced PS exposure is mediated by P2X₇R, and that P2X₇R function is impaired in C57BL/6 mice.

View larger version (38K): [in this window] [in a new window]   FIGURE 2. ATP-mediated PS exposure is mediated by P2X7R. Purified splenic T cells from BALB/c (A) and C57BL/6 (B) mice were incubated for 30 min at 37°C with P2 receptor agonists and analyzed as in Fig. 1B. C, Purified BALB/c T cells were treated for 2 h at 37°C with the indicated P2 receptor antagonists before treatment with 500 µM ATP. D, BALB/c and C57BL/6 mice differ in sensitivity to ATP-induced dye uptake. Purified lymph node T cells from BALB/c (open histograms) and C57BL/6 (filled histograms) mice were incubated for 10 min in the absence (top panel) or presence (bottom panel) of 100 µM bzATP. The DNA-staining dye YO-PRO-1 was added for the last 2 min before FACS analysis. ,-ATP, ,-methylene-ATP; ,-ATP, ,-methylene-ATP; MeSATP, 2-methylthio-ATP; KN-62, 1-[N,O-bis(5-isoquinolinesulfonyl)-N-methyl-L-tyrosyl]-4-phenylpiperazine; o-ATP, oxidized ATP.

To examine whether this difference in function reflects a variation in primary structure, full-length P2X₇R cDNAs were PCR amplified and sequenced from both BALB/c and C57BL/6 mice. A single coding mutation (T1352C) was found in the C57BL/6 allele, resulting in a change from proline to leucine at position 451 (P451L) of the deduced amino acid sequence (Fig. 3A, arrow). Sequence alignment showed that the BALB/c allele is in accord with the rat and human orthologs at this position, while the only mouse P2X₇R sequence in the databases (NM_011027) shares the P451L mutation with the C57BL/6 allele (not shown). Interestingly, this mutation lies within a region of the C-terminal cytoplasmic domain showing homology to the TNFR 1-death domain (TNFR1-DD) and to a fragment of the Src homology (SH)3-binding protein (SH3BP) 1 (Ref. 21 ; Fig. 3).

View larger version (38K): [in this window] [in a new window]   FIGURE 3. BALB/c and C57BL/6 mice differ in a single amino acid residue in the P2X7R C-terminal cytoplasmic domain. A, Alignment of a fragment of the P2X7R cytoplasmic tail with fragments of TNFR1 and SH3BP1 (21 ). The P451L mutation is indicated by an arrow, the E496A mutation found in chronic lymphocytic leukemia patients (22 ) by an asterisk. Conserved residues (*), conserved (:), and semiconserved (.) substitutions of P2X7R to TNFR1 and SH3BP are indicated below the respective sequences. The six helices of the TNFR1-DD (34 ) are indicated by . -Helical domains of the P2X7R cytoplasmic tail were predicted using the profile network from Heidelbus (PHD) algorithm (35 ) based on an alignment of mouse, rat, and human P2X7R, and are shown as . Predictions for residues with an expected accuracy >82% are indicated by H for "helical" and L for "loop". B, Schematic diagram of P2X7R, showing the P451L and E496A mutations and regions of similarity with TNFR1, SH3BP1, and a putative LPS-binding domain (21 ). C, Distribution of the P451L mutation among inbred mouse strains. DNA from the indicated strains was PCR amplified using primers specific for the 451P or L alleles. D, ATP-induced PS exposure is reduced in mice carrying the 451L allele. Purified splenic T cells from the indicated mouse strains were incubated with 500 µM ATP and analyzed for annexin V binding as in Fig. 1B. NOD, nonobese diabetic; NZW, New Zealand White.

Analysis of T cells from DBA/1 mice, a second strain carrying the P451L mutation, showed reduced ATP-induced PS exposure in this strain also, confirming the association of P2X₇R function with the genotype at this locus (Fig. 3D).

To determine whether the P451L mutation is the cause for the observed differences in P2X₇R function, HEK cells were transfected with cDNAs encoding the two variants. Though lack of reagents precluded surface staining, Western blot analysis showed comparable expression of both variants (Fig. 4A). ATP-induced YO-PRO-1 uptake, PS exposure, and calcium influx were stronger in cells transfected with the 451P allele than in their 451L counterparts (Figs. 4, B–F). Because the two cDNAs differ in a single coding mutation, these experiments conclusively show that the P451L substitution severely affects the function of P2X₇R as cation channel and macropore.

View larger version (46K): [in this window] [in a new window]   FIGURE 4. The P451L mutation impairs P2X7R function. A, Western blot analysis of P2X7R expression in HEK cells and subclones stably transfected with the 451P or 451L P2X7R alleles. B, ATP-induced pore formation is reduced in cells carrying the 451L allele. Transfected HEK cells were incubated with YO-PRO-1 and 1 mM ATP for 2 min and analyzed by flow cytometry. Shaded histograms represent parental 293HEK cells. C, ATP-induced PS exposure is reduced in cells carrying the 451L allele. Transfected HEK cells were incubated with Annexin VFITC and 1 mM ATP for 5 min, and were analyzed by flow cytometry. Shaded histograms represent parental 293HEK cells. D, Kinetics of dye uptake by HEK 451L and 451P transfectants. Cells were incubated with YO-PRO-1, and baseline fluorescence was determined in a flow cytometer. The increase in mean fluorescence intensity relative to baseline following addition of 1 mM ATP is shown. E, Dose response to ATP of HEK transfectants. Uptake of YO-PRO-1 by transfected HEK cells (eight independent clones bearing the 451P and four bearing the 451L allele) was determined in sucrose buffer (24 ). F, Calcium uptake by HEK 451L and 451P transfectants. Calcium uptake was measured in HEK transfectants as in Fig. 1.

Our findings have implications also for the evaluation of previous studies concerning mouse P2X₇R. Transfection studies showed that mouse P2X₇R is much less sensitive to ATP than its rat or human orthologs (17, 26). This may be explained by the presence of the P451L mutation in the NM_011027 cDNA used for transfection. Our findings also bear relevance for studies using P2X₇R-deficient mice (30, 31, 32). In some of these, the P2X₇R^-/- phenotype may have been underestimated because it was analyzed against genetic backgrounds (C57BL/6 or DBA/2) already carrying a naturally defective variant.

In conclusion, our findings provide a second example of a naturally occurring point mutation within the P2X₇R cytoplasmic domain that severely impairs important functions of this receptor, namely pore formation and reorganization of the plasma membrane. Both of these are likely crucial steps involved in biological responses mediated by this receptor such as the induction of apoptosis and cytokine secretion (33). The occurrence of the P451L mutation within a region of similarity to both the TNFR-death domain and an SH3-binding domain supports the notion that these observed homologies may be of functional significance. The further analysis of this mutation thus may provide important insights into the molecular mechanisms of P2X₇R action.

	Acknowledgments

 
We thank S. Pechberty, G. Dubberke, D. Freese, and W. Ohlrogge for excellent assistance.

	Footnotes

 
¹ This work was supported by a grant from the Ministère de la Recherche et de la Technologie and by Deutsche Forschungsgemeinschaft Grant SFB 545/B9 (to F.K.-N. and F.H.). S.A. is a recipient of a fellowship from the Association pour la Recherche sur le Cancer.

² Address correspondence and reprint requests to Dr. Friedrich Haag, Institute of Immunology, Martinistrasse 52, D-20246 Hamburg, Germany. E-mail address: haag{at}uke.uni-hamburg.de

³ Abbreviations used in this paper: PS, phosphatidylserine; PI, propidium iodide; P2X₇R, P2X7 receptor; YO-PRO-1, quinolinium, 4-(3-methyl-2[³H]-benzoxazolylidene)methyl)-1–1(3-(triethylammonio)propyl) diodide; HEK, human embryonic kidney; bzATP, 2',3'-O-(benzoyl-4-benzoyl)-ATP; SH, Src homology; SH3BP, SH3-binding protein; TNFR1-DD, TNFR1-death domain.

Received for publication June 14, 2002. Accepted for publication August 28, 2002.

	References

Top Abstract Introduction Materials and Methods Results and Discussion References

 

1. Gordon, J. L.. 1986. Extracellular ATP: effects, sources and fate. Biochem. J. 233:309.[Medline]
2. Goding, J. W., M. C. Howard. 1998. Ecto-enzymes of lymphoid cells. Immunol. Rev. 161:5.[Medline]
3. Adriouch, S., W. Ohlrogge, F. Haag, F. Koch-Nolte, M. Seman. 2001. Rapid induction of naive T cell apoptosis by ecto-nicotinamide adenine dinucleotide: requirement for mono(ADP-ribosyl)transferase 2 and a downstream effector. J. Immunol. 167:196.[Abstract/Free Full Text]
4. Kichenin, K., S. Decollogne, J. Angignard, M. Seman. 2000. Cardiovascular and pulmonary response to oral administration of ATP in rabbits. J. Appl. Physiol. 88:1962.[Abstract/Free Full Text]
5. Kichenin, K., M. Seman. 2000. Chronic oral administration of ATP modulates nucleoside transport and purine metabolism in rats. J. Pharmacol. Exp. Ther. 294:126.[Abstract/Free Full Text]
6. Buisman, H. P., T. H. Steinberg, J. Fischbarg, S. C. Silverstein, S. A. Vogelzang, C. Ince, D. L. Ypey, P. C. Leijh. 1988. Extracellular ATP induces a large nonselective conductance in macrophage plasma membranes. Proc. Natl. Acad. Sci. USA 85:7988.[Abstract/Free Full Text]
7. Di Virgilio, F., P. Pizzo, P. Zanovello, V. Bronte, D. Collavo. 1990. Extracellular ATP as a possible mediator of cell-mediated cytotoxicity. Immunol. Today 11:274.[Medline]
8. Filippini, A., R. E. Taffs, M. V. Sitkovsky. 1990. Extracellular ATP in T-lymphocyte activation: possible role in effector functions. Proc. Natl. Acad. Sci. USA 87:8267.[Abstract/Free Full Text]
9. Blanchard, D. K., S. Wei, C. Duan, F. Pericle, J. I. Diaz, J. Y. Djeu. 1995. Role of extracellular adenosine triphosphate in the cytotoxic T-lymphocyte-mediated lysis of antigen presenting cells. Blood 85:3173.[Abstract/Free Full Text]
10. Di Virgilio, F., P. Chiozzi, D. Ferrari, S. Falzoni, J. M. Sanz, A. Morelli, M. Torboli, G. Bolognesi, O. R. Baricordi. 2001. Nucleotide receptors: an emerging family of regulatory molecules in blood cells. Blood 97:587.[Abstract/Free Full Text]
11. Cotrina, M. L., J. H. Lin, A. Alves-Rodrigues, S. Liu, J. Li, H. Azmi-Ghadimi, J. Kang, C. C. Naus, M. Nedergaard. 1998. Connexins regulate calcium signaling by controlling ATP release. Proc. Natl. Acad. Sci. USA 95:15735.[Abstract/Free Full Text]
12. Jiang, Q., D. Mak, S. Devidas, E. M. Schwiebert, A. Bragin, Y. Zhang, W. R. Skach, W. B. Guggino, J. K. Foskett, J. F. Engelhardt. 1998. Cystic fibrosis transmembrane conductance regulator-associated ATP release is controlled by a chloride sensor. J. Cell Biol. 143:645.[Abstract/Free Full Text]
13. Surprenant, A., F. Rassendren, E. Kawashima, R. A. North, G. Buell. 1996. The cytolytic P2Z receptor for extracellular ATP identified as a P2X receptor (P2X7). Science 272:735.[Abstract]
14. Rassendren, F., G. N. Buell, C. Virginio, G. Collo, R. A. North, A. Surprenant. 1997. The permeabilizing ATP receptor, P2X7: cloning and expression of a human cDNA. J. Biol. Chem. 272:5482.[Abstract/Free Full Text]
15. Abbracchio, M. P., G. Burnstock. 1994. Purinoceptors: are there families of P2X and P2Y purinoceptors?. Pharmacol. Ther. 64:445.[Medline]
16. Greenberg, S., F. Di Virgilio, T. H. Steinberg, S. C. Silverstein. 1988. Extracellular nucleotides mediate Ca²⁺ fluxes in J774 macrophages by two distinct mechanisms. J. Biol. Chem. 263:10337.[Abstract/Free Full Text]
17. Hibell, A. D., E. J. Kidd, I. P. Chessell, P. P. Humphrey, A. D. Michel. 2000. Apparent species differences in the kinetic properties of P2X₇ receptors. Br. J. Pharmacol. 130:167.[Medline]
18. Di Virgilio, F.. 1995. The P2Z purinoceptor: an intriguing role in immunity, inflammation and cell death. Immunol. Today 16:524.[Medline]
19. Ferrari, D., M. Los, M. K. Bauer, P. Vandenabeele, S. Wesselborg, K. Schulze-Osthoff. 1999. P2Z purinoreceptor ligation induces activation of caspases with distinct roles in apoptotic and necrotic alterations of cell death. FEBS Lett. 447:71.[Medline]
20. Kim, M., L. H. Jiang, H. L. Wilson, R. A. North, A. Surprenant. 2001. Proteomic and functional evidence for a P2X7 receptor signalling complex. EMBO J. 20:6347.[Medline]
21. Denlinger, L. C., P. L. Fisette, J. A. Sommer, J. J. Watters, U. Prabhu, G. R. Dubyak, R. A. Proctor, P. J. Bertics. 2001. Cutting edge: the nucleotide receptor P2X7 contains multiple protein- and lipid-interaction motifs including a potential binding site for bacterial lipopolysaccharide. J. Immunol. 167:1871.[Abstract/Free Full Text]
22. Gu, B. J., W. Zhang, R. A. Worthington, R. Sluyter, P. Dao-Ung, S. Petrou, J. A. Barden, J. S. Wiley. 2001. A Glu⁴⁹⁶ to Ala polymorphism leads to loss of function of the human P2X7 receptor. J. Biol. Chem. 276:11135.[Abstract/Free Full Text]
23. Wiley, J. S., L. P. Dao-Ung, B. J. Gu, R. Sluyter, A. N. Shemon, C. Li, J. Taper, J. Gallo, A. Manoharan. 2002. A loss-of-function polymorphic mutation in the cytolytic P2X7 receptor gene and chronic lymphocytic leukaemia: a molecular study. Lancet 359:1114.[Medline]
24. Hibell, A. D., K. M. Thompson, M. Xing, P. P. Humphrey, A. D. Michel. 2001. Complexities of measuring antagonist potency at P2X₇ receptor orthologs. J. Pharmacol. Exp. Ther. 296:947.[Abstract/Free Full Text]
25. Chessell, I. P., J. Simon, A. D. Hibell, A. D. Michel, E. A. Barnard, P. P. Humphrey. 1998. Cloning and functional characterisation of the mouse P2X7 receptor. FEBS Lett. 439:26.[Medline]
26. Hibell, A. D., K. M. Thompson, J. Simon, M. Xing, P. P. Humphrey, A. D. Michel. 2001. Species- and agonist-dependent differences in the deactivation-kinetics of P2X7 receptors. Naunyn Schmiedeberg’s Arch. Pharmacol. 363:639.[Medline]
27. North, R. A., A. Surprenant. 2000. Pharmacology of cloned P2X receptors. Annu. Rev. Pharmacol. Toxicol. 40:563.[Medline]
28. Di Virgilio, F., V. Bronte, D. Collavo, P. Zanovello. 1989. Responses of mouse lymphocytes to extracellular adenosine 5'-triphosphate (ATP): lymphocytes with cytotoxic activity are resistant to the permeabilizing effects of ATP. J. Immunol. 143:1955.[Abstract]
29. Kahl, S., M. Nissen, R. Girisch, T. Duffy, E. H. Leiter, F. Haag, F. Koch-Nolte. 2000. Metalloprotease-mediated shedding of enzymatically active mouse ecto-ADP-ribosyltransferase ART2.2 upon T cell activation. J. Immunol. 165:4463.[Abstract/Free Full Text]
30. Sikora, A., J. Liu, C. Brosnan, G. Buell, I. Chessel, B. R. Bloom. 1999. Cutting edge: purinergic signaling regulates radical-mediated bacterial killing mechanisms in macrophages through a P2X7-independent mechanism. J. Immunol. 163:558.[Abstract/Free Full Text]
31. Solle, M., J. Labasi, D. G. Perregaux, E. Stam, N. Petrushova, B. H. Koller, R. J. Griffiths, C. A. Gabel. 2001. Altered cytokine production in mice lacking P2X₇ receptors. J. Biol. Chem. 276:125.[Abstract/Free Full Text]
32. Labasi, J. M., N. Petrushova, C. Donovan, S. McCurdy, P. Lira, M. M. Payette, W. Brissette, J. R. Wicks, L. Audoly, C. A. Gabel. 2002. Absence of the P2X7 receptor alters leukocyte function and attenuates an inflammatory response. J. Immunol. 168:6436.[Abstract/Free Full Text]
33. Ferrari, D., P. Chiozzi, S. Falzoni, M. Dal Susino, L. Melchiorri, O. R. Baricordi, F. Di Virgilio. 1997. Extracellular ATP triggers IL-1 release by activating the purinergic P2Z receptor of human macrophages. J. Immunol. 159:1451.[Abstract]
34. Sukits, S. F., L. L. Lin, S. Hsu, K. Malakian, R. Powers, G. Y. Xu. 2001. Solution structure of the tumor necrosis factor receptor-1 death domain. J. Mol. Biol. 310:895.[Medline]
35. Rost, B., C. Sander. 1993. Prediction of protein secondary structure at better than 70% accuracy. J. Mol. Biol. 232:584.[Medline]

This article has been cited by other articles:

				C. Mayo, R. Ren, C. Rich, M. A. Stepp, and V. Trinkaus-Randall Regulation by P2X7: Epithelial Migration and Stromal Organization in the Cornea Invest. Ophthalmol. Vis. Sci., October 1, 2008; 49(10): 4384 - 4391. [Abstract] [Full Text] [PDF]

				K. Heiss, N. Janner, B. Mahnss, V. Schumacher, F. Koch-Nolte, F. Haag, and H.-W. Mittrucker High Sensitivity of Intestinal CD8+ T Cells to Nucleotides Indicates P2X7 as a Regulator for Intestinal T Cell Responses J. Immunol., September 15, 2008; 181(6): 3861 - 3869. [Abstract] [Full Text] [PDF]

				R. Iglesias, S. Locovei, A. Roque, A. P. Alberto, G. Dahl, D. C. Spray, and E. Scemes P2X7 receptor-Pannexin1 complex: pharmacology and signaling Am J Physiol Cell Physiol, September 1, 2008; 295(3): C752 - C760. [Abstract] [Full Text] [PDF]

				P. Pelegrin, C. Barroso-Gutierrez, and A. Surprenant P2X7 Receptor Differentially Couples to Distinct Release Pathways for IL-1{beta} in Mouse Macrophage J. Immunol., June 1, 2008; 180(11): 7147 - 7157. [Abstract] [Full Text] [PDF]

				S. Adriouch, P. Bannas, N. Schwarz, R. Fliegert, A. H. Guse, M. Seman, F. Haag, and F. Koch-Nolte ADP-ribosylation at R125 gates the P2X7 ion channel by presenting a covalent ligand to its nucleotide binding site FASEB J, March 1, 2008; 22(3): 861 - 869. [Abstract] [Full Text] [PDF]

				S. R. J. Taylor, M. Gonzalez-Begne, S. Dewhurst, G. Chimini, C. F. Higgins, J. E. Melvin, and J. I. Elliott Sequential Shrinkage and Swelling Underlie P2X7-Stimulated Lymphocyte Phosphatidylserine Exposure and Death J. Immunol., January 1, 2008; 180(1): 300 - 308. [Abstract] [Full Text] [PDF]

				D.-J. Jun, J. Kim, S.-Y. Jung, R. Song, J.-H. Noh, Y.-S. Park, S.-H. Ryu, J.-H. Kim, Y.-Y. Kong, J.-M. Chung, et al. Extracellular ATP Mediates Necrotic Cell Swelling in SN4741 Dopaminergic Neurons through P2X7 Receptors J. Biol. Chem., December 28, 2007; 282(52): 37350 - 37358. [Abstract] [Full Text] [PDF]

				R. Sluyter, A. N. Shemon, W. E. Hughes, R. O. Stevenson, J. G. Georgiou, G. D. Eslick, R. M. Taylor, and J. S. Wiley Canine erythrocytes express the P2X7 receptor: greatly increased function compared with human erythrocytes Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2007; 293(5): R2090 - R2098. [Abstract] [Full Text] [PDF]

				T. Darville, L. Welter-Stahl, C. Cruz, A. A. Sater, C. W. Andrews Jr., and D. M. Ojcius Effect of the Purinergic Receptor P2X7 on Chlamydia Infection in Cervical Epithelial Cells and Vaginally Infected Mice J. Immunol., September 15, 2007; 179(6): 3707 - 3714. [Abstract] [Full Text] [PDF]

				S. Adriouch, S. Hubert, S. Pechberty, F. Koch-Nolte, F. Haag, and M. Seman NAD+ Released during Inflammation Participates in T Cell Homeostasis by Inducing ART2-Mediated Death of Naive T Cells In Vivo J. Immunol., July 1, 2007; 179(1): 186 - 194. [Abstract] [Full Text] [PDF]

				M. T. Young, P. Pelegrin, and A. Surprenant Amino Acid Residues in the P2X7 Receptor that Mediate Differential Sensitivity to ATP and BzATP Mol. Pharmacol., January 1, 2007; 71(1): 92 - 100. [Abstract] [Full Text] [PDF]

				M. Tsukimoto, M. Maehata, H. Harada, A. Ikari, K. Takagi, and M. Degawa P2X7 Receptor-Dependent Cell Death Is Modulated during Murine T Cell Maturation and Mediated by Dual Signaling Pathways. J. Immunol., September 1, 2006; 177(5): 2842 - 2850. [Abstract] [Full Text] [PDF]

				Y.-H. Feng, X. Li, L. Wang, L. Zhou, and G. I. Gorodeski A Truncated P2X7 Receptor Variant (P2X7-j) Endogenously Expressed in Cervical Cancer Cells Antagonizes the Full-length P2X7 Receptor through Hetero-oligomerization J. Biol. Chem., June 23, 2006; 281(25): 17228 - 17237. [Abstract] [Full Text] [PDF]

				D. Yeung, K. Zablocki, C.-F. Lien, T. Jiang, S. Arkle, W. Brutkowski, J. Brown, H. Lochmuller, J. Simon, E. A. Barnard, et al. Increased susceptibility to ATP via alteration of P2X receptor function in dystrophic mdx mouse muscle cells FASEB J, April 1, 2006; 20(6): 610 - 620. [Abstract] [Full Text] [PDF]

				L. Chen and C. F. Brosnan Exacerbation of Experimental Autoimmune Encephalomyelitis in P2X7R-/- Mice: Evidence for Loss of Apoptotic Activity in Lymphocytes. J. Immunol., March 1, 2006; 176(5): 3115 - 3126. [Abstract] [Full Text] [PDF]

				A. N. Shemon, R. Sluyter, S. L. Fernando, A. L. Clarke, L.-P. Dao-Ung, K. K. Skarratt, B. M. Saunders, K. S. Tan, B. J. Gu, S. J. Fuller, et al. A Thr357 to Ser Polymorphism in Homozygous and Compound Heterozygous Subjects Causes Absent or Reduced P2X7 Function and Impairs ATP-induced Mycobacterial Killing by Macrophages J. Biol. Chem., January 27, 2006; 281(4): 2079 - 2086. [Abstract] [Full Text] [PDF]

				P. A. Verhoef, S. B. Kertesy, K. Lundberg, J. M. Kahlenberg, and G. R. Dubyak Inhibitory Effects of Chloride on the Activation of Caspase-1, IL-1{beta} Secretion, and Cytolysis by the P2X7 Receptor J. Immunol., December 1, 2005; 175(11): 7623 - 7634. [Abstract] [Full Text] [PDF]

				F. Aswad, H. Kawamura, and G. Dennert High Sensitivity of CD4+CD25+ Regulatory T Cells to Extracellular Metabolites Nicotinamide Adenine Dinucleotide and ATP: A Role for P2X7 Receptors J. Immunol., September 1, 2005; 175(5): 3075 - 3083. [Abstract] [Full Text] [PDF]

				R. Auger, I. Motta, K. Benihoud, D. M. Ojcius, and J. M. Kanellopoulos A Role for Mitogen-activated Protein KinaseErk1/2 Activation and Non-selective Pore Formation in P2X7 Receptor-mediated Thymocyte Death J. Biol. Chem., July 29, 2005; 280(30): 28142 - 28151. [Abstract] [Full Text] [PDF]

				L. C. Denlinger, G. Angelini, K. Schell, D. N. Green, A. G. Guadarrama, U. Prabhu, D. B. Coursin, P. J. Bertics, and K. Hogan Detection of Human P2X7 Nucleotide Receptor Polymorphisms by a Novel Monocyte Pore Assay Predictive of Alterations in Lipopolysaccharide-Induced Cytokine Production J. Immunol., April 1, 2005; 174(7): 4424 - 4431. [Abstract] [Full Text] [PDF]

				C. Krebs, S. Adriouch, F. Braasch, W. Koestner, E. H. Leiter, M. Seman, F. E. Lund, N. Oppenheimer, F. Haag, and F. Koch-Nolte CD38 Controls ADP-Ribosyltransferase-2-Catalyzed ADP-Ribosylation of T Cell Surface Proteins J. Immunol., March 15, 2005; 174(6): 3298 - 3305. [Abstract] [Full Text] [PDF]

				H. Kawamura, F. Aswad, M. Minagawa, K. Malone, H. Kaslow, F. Koch-Nolte, W. H. Schott, E. H. Leiter, and G. Dennert P2X7 Receptor-Dependent and -Independent T Cell Death Is Induced by Nicotinamide Adenine Dinucleotide J. Immunol., February 15, 2005; 174(4): 1971 - 1979. [Abstract] [Full Text] [PDF]

				R. Sluyter, A. N. Shemon, J. A. Barden, and J. S. Wiley Extracellular ATP Increases Cation Fluxes in Human Erythrocytes by Activation of the P2X7 Receptor J. Biol. Chem., October 22, 2004; 279(43): 44749 - 44755. [Abstract] [Full Text] [PDF]

				J. I. Elliott and C. F. Higgins Major Histocompatibility Complex Class I Shedding and Programmed Cell Death Stimulated Through the Proinflammatory P2X7 Receptor: A Candidate Susceptibility Gene for NOD Diabetes Diabetes, August 1, 2004; 53(8): 2012 - 2017. [Abstract] [Full Text] [PDF]

				J. F. Hiken and T. H. Steinberg ATP downregulates P2X7 and inhibits osteoclast formation in RAW cells Am J Physiol Cell Physiol, August 1, 2004; 287(2): C403 - C412. [Abstract] [Full Text] [PDF]

				C. Grose, S. Tyler, G. Peters, J. Hiebert, G. M. Stephens, W. T. Ruyechan, W. Jackson, J. Storlie, and G. A. Tipples Complete DNA Sequence Analyses of the First Two Varicella-Zoster Virus Glycoprotein E (D150N) Mutant Viruses Found in North America: Evolution of Genotypes with an Accelerated Cell Spread Phenotype J. Virol., July 1, 2004; 78(13): 6799 - 6807. [Abstract] [Full Text] [PDF]

				M.-P. Courageot, S. Lepine, M. Hours, F. Giraud, and J.-C. Sulpice Involvement of Sodium in Early Phosphatidylserine Exposure and Phospholipid Scrambling Induced by P2X7 Purinoceptor Activation in Thymocytes J. Biol. Chem., May 21, 2004; 279(21): 21815 - 21823. [Abstract] [Full Text] [PDF]

				H. Le Stunff, R. Auger, J. Kanellopoulos, and M.-N. Raymond The Pro-451 to Leu Polymorphism within the C-terminal Tail of P2X7 Receptor Impairs Cell Death but Not Phospholipase D Activation in Murine Thymocytes J. Biol. Chem., April 23, 2004; 279(17): 16918 - 16926. [Abstract] [Full Text] [PDF]

				L. C. Denlinger, K. Schell, G. Angelini, D. Green, A. Guadarrama, U. Prabhu, D. B. Coursin, K. Hogan, and P. J. Bertics A novel assay to detect nucleotide receptor P2X7 genetic polymorphisms influencing numerous innate immune functions Innate Immunity, April 1, 2004; 10(2): 137 - 142. [Abstract] [PDF]

				J. S. Wiley, L.-P. Dao-Ung, C. Li, A. N. Shemon, B. J. Gu, M. L. Smart, S. J. Fuller, J. A. Barden, S. Petrou, and R. Sluyter An Ile-568 to Asn Polymorphism Prevents Normal Trafficking and Function of the Human P2X7 Receptor J. Biol. Chem., May 2, 2003; 278(19): 17108 - 17113. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services