|
|
||||||||



* Department of Microbiology, Center for Immunology, University of Minnesota Medical School, Minneapolis MN 55455;
Department of Medicine, Division of Immunology, University of Connecticut Health Center, Farmington, CT 06030; and
Epithelial Pathobiology Division, Department of Pathology and Laboratory Medicine, Emory University, Atlanta, GA 30322
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Recent studies have demonstrated that microbe-induced DC maturation/activation can be initiated by ligation of cell surface receptors that detect soluble products of microbial metabolism, allowing the host to rapidly identify common classes of infectious agents (8). Specifically, the Toll-like receptors (TLRs) are a recently described family of molecules capable of sensing bacterial cell wall components, such as LPS (9, 10), lipoteichoic acids (11), and peptidoglycan (12, 13), as well as other microbial products, such as dsRNA (14) and CpG DNA (15). Although a number of cell types are thought to express some TLRs, immature and activated DC have been shown to express a wide variety (16, 17) and are also found in close physical contact with naive T cells in vivo (18). Therefore, DC are ideally suited to recognize microbial products and present foreign Ag to naive CD4 T cells.
Bacterial flagellin has long been studied as a useful model Ag
(19, 20) and was recently found to be a target of CD4 T
cells during murine Salmonella typhimurium infection
(21, 22, 23). In addition to being a target of the adaptive
immune system, bacterial flagellin can directly activate innate immune
responses in monocytes (24, 25, 26) and epithelial cells
(27, 28). Specifically, exposure to flagellin in vitro
induces these cells to activate NF-
B and secrete inflammatory
cytokines (27, 28). This immunostimulatory capacity was
recently shown to be mediated by the mammalian surface receptor TLR-5
(29, 30) that is expressed by monocytes (16),
immature DC (17), and epithelial cells
(29).
The innate ability to induce an inflammatory response by TLR ligands also correlates with the capacity of these products to function as effective adjuvants. For example, LPS induces an inflammatory response in the host via TLR-4 and also increases the clonal expansion of CD4 T cells in vivo (9, 10, 31, 32). Additionally, CpG DNA induces an inflammatory response via TLR-9 and can function as an adjuvant in vivo (33, 34, 35). We therefore reasoned that bacterial flagellin might function in a similar manner. Here, we demonstrate that flagellin is an effective adjuvant for CD4 T cells responding to OVA in vivo. Since flagellin is ubiquitously expressed in the gut and can be transported across gut epithelia by some pathogens (27), it may also contribute to the activation of CD4 T cells in the intestine.
| Materials and Methods |
|---|
|
|
|---|
Flagellin was purified from S. typhimurium (SL3201)-conditioned medium by anion/cation exchange chromatography, as previously described (27) with one additional step added. To remove potential remaining trace levels of LPS, the purified protein was incubated with polymyxin B agarose beads (1%, v/v; Sigma, St. Louis, MO) as previously described (36). SDS-PAGE analysis revealed no contaminating proteins accompanying the expected 49-/50-kDa previously described flagellin doublet. To prepare recombinant flagellin from HeLa cells, the entire FliC-coding region was prepared by PCR from S. typhimurium (SL3201) genomic DNA using the following PCR primers: GAATTCATGGCACAAGTCATTAATACAA and TCTAGATTAACGCAGTAAAGAGAGGACG. This PCR product was digested with EcoRI and Xba and inserted into pcDNA4/HisMax (Invitrogen, San Diego, CA) using corresponding vector sites. Following sequencing to verify the integrity of the plasmid, HeLa cells were transiently transfected using Lipofectamine (Invitrogen), and cell lysate was collected 24 h later. Recombinant flagellin was purified according to the protocol of the Probond Purification System (Invitrogen). Briefly, lysate was cleared by centrifugation, added to the Probond column, and rocked for 30 min. After washing the column, His-tagged flagellin was eluted using 350 mM imidazole, concentrated using Centricon concentrators (Millipore, Bedford, MA), dialyzed overnight in sterile PBS using a 10,000 m.w. Slide-A-Lyzer (Pierce, Rockford, IL), and stored at -80°C until use. As the yield of flagellin was too low for detection by protein assays, it was quantified by Western blot/densitometry with a mAb to flagellin (Igen, Gaithersburg, MD), using flagellin purified from bacteria as a standard.
IL-8 induction
IL-8 secretion from polarized T84 cells was assessed as previously described (27). HUVEC were plated on passage 3 in 24-well tissue culture plates and stimulated with LPS or flagellin for 6 h, after which supernatants were collected and assayed for IL-8 by ELISA. Human polymorphonuclear neutrophil (PMN) were isolated from peripheral blood of healthy donors by dextran sedimentation and density gradient centrifugation, followed by hypotonic lysis. Immediately following isolation, PMN were placed in HBSS at 106/ml and stimulated with Pam3Cys (a gift from M. Fenton, Boston University, Boston, MA) or flagellin for 3 h, at which time supernatants were isolated and assayed for IL-8 by ELISA. The Limulus assay kit was purchased from Cape Cod Associates (Falmouth, MA), and tests were performed according to the manufacturers instructions. Buffers for the Limulus assay were reconstituted using the same double-deionized (via U.S. Filter, Bradley, IL and Millipore Systems) water used throughout these studies, which, when tested by Cape Cod Associates, was found to have an endotoxin concentration of <0.005 ng/ml.
Mice and adoptive transfer
DO11.10 and DO11.10 recombinase-activating gene (RAG)-deficient TCR transgenic mice (37) were bred in a pathogen-free facility according to National Institutes of Health guidelines and screened as previously described (38). Female BALB/c (H-2d) mice were purchased from the National Cancer Institute (Frederick, MD) and used at 816 wk of age. BALB/c recipient mice were adoptively transferred with 2.5 x 106 CFSE (Molecular Probes, Eugene, OR)-labeled (39) DO11.10 TCR or DO11.10 RAG-deficient transgenic T cells i.v. as previously described (38).
Immunization
Mice were immunized i.v. with 100 µg OVA peptide 323339 in
the presence and the absence of flagellin (10 µg) or LPS (25 µg).
In some experiments aliquots of flagellin or PBS were incubated with
proteinase K (100 µg/ml; Roche, Indianapolis, IN) at 37°C for 24
h, followed by 1 h at 70°C to denature the enzyme. Proteinase
K-treated samples were mixed with OVA peptide after denaturation and
immediately before i.v. injection. For in vitro restimulation,
splenocytes were harvested from mice 9 days after immunization and
plated in duplicate in 96-well flat-bottom plates (Corning, Coring, NY)
at a final concentration of 1 x 106
cells/well. Cultures were incubated for 48 h in the presence or
the absence of OVA peptide (323339) and analyzed for the presence of
IFN-
and IL-4. The presence of cytokines in culture medium was
measured by sandwich ELISA based on noncompeting pairs of
anti-IFN-
or anti-IL-4 mAb (BD PharMingen, San Diego, CA)
according to a standard protocol, and amounts were calculated based on
a standard curve generated by recombinant mouse IFN-
or IL-4 (BD
PharMingen). For in vivo blocking experiments, CTLA-4-Ig was prepared
as previously described (32), and mice were injected i.p.
with 280 µg 4 h before Ag injection.
Isolation of APC for DC analysis
APC from spleens were isolated as previously described (40). Briefly, organs were subjected to mild digestion with collagenase D (Roche) at 37°C for 25 min. Low density cells were recovered by centrifugation on a 35% BSA gradient (Sigma) and then directly stained on ice.
Flow cytometry
Cell suspensions were prepared from the spleen of immunized and
control mice and incubated on ice with CyChrome-conjugated anti-CD4
(BD PharMingen) and biotinylated KJ1-26 mAb (41),
followed by streptavidin-PE (Caltag, South San Francisco, CA) as
previously described (38). For DC analysis, cells were
incubated on ice with CyChrome-conjugated anti-CD8
,
FITC-conjugated anti-CD11c, and PE-conjugated anti-CD80 and
anti-CD86 (BD PharMingen). A FACScan flow cytometer (BD
Biosciences, Mountain View, CA) was used to collect 25,000 events after
creating an appropriate live gate. FACS data were analyzed using FlowJo
software (TreeStar, San Carlos, CA).
| Results |
|---|
|
|
|---|
|
1/50th that of LPS mass/volume;
data not shown). As this assay does not appear able to adequately
discriminate between LPS and flagellin, LPS contamination was also
measured by an alternative method. HUVEC cells secreted IL-8 in
response to as little as 50 pg/ml E. coli LPS, and treatment
with proteinase K had no affect on its ability to induce this response
(data not shown). Bacterial flagellin induced modest amounts of IL-8
secretion from HUVEC cells, but bacterial flagellin pretreated with
proteinase K did not induce detectable IL-8 secretion at any
concentration tested, the highest being 50 µg/ml (data not
shown).
We next used a similar strategy to quantitate the amount of lipopeptide
present in our purified flagellin. Human PMN produced detectable levels
of IL-8 in response to as little as 50 ng/ml of the synthetic TLR2
agonist Pam3Cys, but no response to any tested
concentration of flagellin (up to 50 µg/ml), indicating that
concentrations of TLR2 ligands copurified with flagellin were not
significant. From these data we estimate that the 10 µg flagellin
used in our in vivo studies contains <10 ng of both LPS and
lipoprotein contaminants. These results combined with the failure of
bacterial flagellin to activate NF-
B in HeLa cells expressing all
known TLRs except TLR5 (29) strongly suggest that the in
vivo bioactivity of flagellin is the result of a response to flagellin
itself rather than any contaminant.
The ability of flagellin to function as an adjuvant in vivo was tested
by immunizing BALB/c mice with OVA peptide (323339) in the presence
or the absence of flagellin. Splenocytes from mice immunized with OVA
peptide plus flagellin produced IFN-
upon in vitro restimulation
with peptide, while splenocytes from mice immunized with OVA peptide
alone or OVA peptide plus proteinase K-treated flagellin did not
secrete detectable IFN-
(Fig. 2
). To
examine this adjuvant effect in more detail, we tracked the in vivo
response to OVA using a well-characterized adoptive transfer system
(38). A trace population of OVA-specific CD4 T cells was
detected in the spleen of BALB/c mice following adoptive transfer (Fig. 3
A), and clonal expansion of
these cells was observed, 3 days after i.v. injection of OVA peptide
(Fig. 3
B). Coinjection of Salmonella flagellin
with OVA peptide markedly increased the clonal expansion of
OVA-specific T cells compared with that of OVA peptide alone (Fig. 3
C). This adjuvant effect usually accounted for a 3- to
10-fold increase in the absolute number of splenic DO11.10 cells in
different experiments (data not shown). Pretreatment of flagellin with
proteinase K completely ablated the flagellin-mediated enhancement of
clonal expansion (Fig. 3
D), consistent with the fact that
proteinaceous material, including flagellin, is digested by this
treatment. Proteinase K treatment itself did not affect T cell
expansion, as mock (PBS) samples treated with proteinase K did not
affect the response of DO11.10 T cells to OVA peptide (data not
shown).
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
in
vitro. The presence of flagellin during CD4 T cell priming resulted in
increased Ag-specific T cell numbers at the peak of clonal expansion
and after clonal contraction had occurred. Such an effect is likely to
be advantageous for the host immune response to a flagellated pathogen,
since this would result in a larger pool of pathogen-specific T cells.
Although our results have not examined the immune response to enteric
bacteria, it is likely that flagellin expression in the intestine could
modulate the immune response to mucosal Ags. It is likely that flagellin increases clonal expansion of T cells by influencing cell division and not cell death, since CFSE dye dilution experiments revealed more cell division by DO11.10 T cells in the presence of flagellin. However, we cannot rule out an additional effect of flagellin on the rate of T cell death in vivo. We think it likely that flagellin influences the rate of CD4 T cell division by increasing the expression of B7 molecules on DC in vivo. The enhanced clonal expansion of OVA-specific CD4 T cells in vivo correlated with the capacity of flagellin to induce B7-1 expression on DC in vivo and was also blocked by CTLA-4-Ig treatment. Although our blocking experiments do not specifically target the expression of B7 molecules by DC, it is likely that the block occurs during T cell interactions with this cell subset in vivo.
Although a number of TLR agonists function as adjuvants, flagellin
might be a particularly attractive candidate for the development of
synthetic adjuvants. In contrast to all other defined TLR agonists,
flagellin is a protein, allowing it to be encoded within current
nucleic acid based vaccine vectors (e.g., plasmid-carrying liposomes
and viruses). In support of this idea, we demonstrate that recombinant
flagellin made in eukaryotic cells (as opposed to bacteria) is
equipotent at inducing TLR5-mediated responses compared with the
bacterial product (Fig. 1
). Recent studies suggest that the
TLR5-activating region of flagellin is comprised of amino acids from
various portions of this 47-kDa molecule (45) and will
serve as important groundwork for developing such a strategy.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Stephen J. McSorley, Department of Medicine, Division of Immunology, University of Connecticut Health Center, 263 Farmington Avenue, Farmington, CT 06030-1319. E-mail address: mcsorley{at}uchc.edu ![]()
3 Abbreviations used in this paper: DC, dendritic cell; RAG, recombinase-activating gene; TLR, Toll-like receptor; PMN, polymorphonuclear neutrophil. ![]()
Received for publication June 5, 2002. Accepted for publication July 31, 2002.
| References |
|---|
|
|
|---|
B by Toll-like receptor 3. Nature 413:732.[Medline]
in a human promonocytic cell line. Infect. Immun. 66:1127.
B
degradation, induction of nitric oxide synthase, induction of proinflammatory mediators, and cardiovascular dysfunction. J. Immunol. 166:1248.This article has been cited by other articles:
![]() |
J. T. Bates, S. Uematsu, S. Akira, and S. B. Mizel Direct Stimulation of tlr5+/+ CD11c+ Cells Is Necessary for the Adjuvant Activity of Flagellin J. Immunol., June 15, 2009; 182(12): 7539 - 7547. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. T. Weimer, H. Lu, N. D. Kock, D. J. Wozniak, and S. B. Mizel A Fusion Protein Vaccine Containing OprF Epitope 8, OprI, and Type A and B Flagellins Promotes Enhanced Clearance of Nonmucoid Pseudomonas aeruginosa Infect. Immun., June 1, 2009; 77(6): 2356 - 2366. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. M. Braga, G. M. G. Rittner, J. E. Munoz Henao, A. F. Teixeira, L. M. Massis, M. E. Sbrogio-Almeida, C. P. Taborda, L. R. Travassos, and L. C. S. Ferreira Paracoccidioides brasiliensis Vaccine Formulations Based on the gp43-Derived P10 Sequence and the Salmonella enterica FliC Flagellin Infect. Immun., April 1, 2009; 77(4): 1700 - 1707. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Mizel, A. H. Graff, N. Sriranganathan, S. Ervin, C. J. Lees, M. O. Lively, R. R. Hantgan, M. J. Thomas, J. Wood, and B. Bell Flagellin-F1-V Fusion Protein Is an Effective Plague Vaccine in Mice and Two Species of Nonhuman Primates Clin. Vaccine Immunol., January 1, 2009; 16(1): 21 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kumar, H. Wu, L. S. Collier-Hyams, Y.-M. Kwon, J. M. Hanson, and A. S. Neish The Bacterial Fermentation Product Butyrate Influences Epithelial Signaling via Reactive Oxygen Species-Mediated Changes in Cullin-1 Neddylation J. Immunol., January 1, 2009; 182(1): 538 - 546. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-Z. Wang, F.-S. Quan, S.-M. Kang, J. Bozja, I. Skountzou, and R. W. Compans Incorporation of Membrane-Anchored Flagellin into Influenza Virus-Like Particles Enhances the Breadth of Immune Responses J. Virol., December 1, 2008; 82(23): 11813 - 11823. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Shen, B. M. Tesar, W. E. Walker, and D. R. Goldstein Dual Signaling of MyD88 and TRIF Is Critical for Maximal TLR4-Induced Dendritic Cell Maturation J. Immunol., August 1, 2008; 181(3): 1849 - 1858. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Nempont, D. Cayet, M. Rumbo, C. Bompard, V. Villeret, and J.-C. Sirard Deletion of Flagellin's Hypervariable Region Abrogates Antibody-Mediated Neutralization and Systemic Activation of TLR5-Dependent Immunity J. Immunol., August 1, 2008; 181(3): 2036 - 2043. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Sanders, D. A. Moore III, I. R. Williams, and A. T. Gewirtz Both Radioresistant and Hemopoietic Cells Promote Innate and Adaptive Immune Responses to Flagellin J. Immunol., June 1, 2008; 180(11): 7184 - 7192. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Wilmanski, T. Petnicki-Ocwieja, and K. S. Kobayashi NLR proteins: integral members of innate immunity and mediators of inflammatory diseases J. Leukoc. Biol., January 1, 2008; 83(1): 13 - 30. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Fransen, C. J. Boog, J. P. van Putten, and P. van der Ley Agonists of Toll-Like Receptors 3, 4, 7, and 9 Are Candidates for Use as Adjuvants in an Outer Membrane Vaccine against Neisseria meningitidis Serogroup B Infect. Immun., December 1, 2007; 75(12): 5939 - 5946. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.-M. Salazar-Gonzalez, A. Srinivasan, A. Griffin, G. Muralimohan, J. M. Ertelt, R. Ravindran, A. T. Vella, and S. J. McSorley Salmonella Flagellin Induces Bystander Activation of Splenic Dendritic Cells and Hinders Bacterial Replication In Vivo J. Immunol., November 1, 2007; 179(9): 6169 - 6175. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Saha, F. Takeshita, T. Matsuda, N. Jounai, K. Kobiyama, T. Matsumoto, S. Sasaki, A. Yoshida, K.-Q. Xin, D. M. Klinman, et al. Blocking of the TLR5 Activation Domain Hampers Protective Potential of Flagellin DNA Vaccine J. Immunol., July 15, 2007; 179(2): 1147 - 1154. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. T. Gewirtz TLRs in the Gut. III. Immune responses to flagellin in Crohn's disease: good, bad, or irrelevant? Am J Physiol Gastrointest Liver Physiol, March 1, 2007; 292(3): G706 - G710. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Alaniz, L. A. Cummings, M. A. Bergman, S. L. Rassoulian-Barrett, and B. T. Cookson Salmonella typhimurium Coordinately Regulates FliC Location and Reduces Dendritic Cell Activation and Antigen Presentation to CD4+ T cells J. Immunol., September 15, 2006; 177(6): 3983 - 3993. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Sanders, Y. Yu, D. A. Moore III, I. R. Williams, and A. T. Gewirtz Humoral immune response to flagellin requires T cells and activation of innate immunity. J. Immunol., September 1, 2006; 177(5): 2810 - 2818. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Sfondrini, A. Rossini, D. Besusso, A. Merlo, E. Tagliabue, S. Menard, and A. Balsari Antitumor Activity of the TLR-5 Ligand Flagellin in Mouse Models of Cancer. J. Immunol., June 1, 2006; 176(11): 6624 - 6630. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. T. Gewirtz, M. Vijay-Kumar, S. R. Brant, R. H. Duerr, D. L. Nicolae, and J. H. Cho Dominant-negative TLR5 polymorphism reduces adaptive immune response to flagellin and negatively associates with Crohn's disease Am J Physiol Gastrointest Liver Physiol, June 1, 2006; 290(6): G1157 - G1163. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yu, S. Nagai, H. Wu, A. S. Neish, S. Koyasu, and A. T. Gewirtz TLR5-Mediated Phosphoinositide 3-Kinase Activation Negatively Regulates Flagellin-Induced Proinflammatory Gene Expression J. Immunol., May 15, 2006; 176(10): 6194 - 6201. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Honko, N. Sriranganathan, C. J. Lees, and S. B. Mizel Flagellin Is an Effective Adjuvant for Immunization against Lethal Respiratory Challenge with Yersinia pestis Infect. Immun., February 1, 2006; 74(2): 1113 - 1120. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Lee, S. Y. Kim, B. C. Jeong, Y. R. Kim, S. J. Bae, O. S. Ahn, J.-J. Lee, H.-C. Song, J. M. Kim, H. E. Choy, et al. A Bacterial Flagellin, Vibrio vulnificus FlaB, Has a Strong Mucosal Adjuvant Activity To Induce Protective Immunity Infect. Immun., January 1, 2006; 74(1): 694 - 702. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Bergman, L. A. Cummings, R. C. Alaniz, L. Mayeda, I. Fellnerova, and B. T. Cookson CD4+-T-Cell Responses Generated during Murine Salmonella enterica Serovar Typhimurium Infection Are Directed towards Multiple Epitopes within the Natural Antigen FliC Infect. Immun., November 1, 2005; 73(11): 7226 - 7235. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. S. Lopez-Boado, L. M. Cobb, and R. Deora Bordetella bronchiseptica Flagellin Is a Proinflammatory Determinant for Airway Epithelial Cells Infect. Immun., November 1, 2005; 73(11): 7525 - 7534. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Pino, M. Martin, and S. M. Michalek Cellular Mechanisms of the Adjuvant Activity of the Flagellin Component FljB of Salmonella enterica Serovar Typhimurium To Potentiate Mucosal and Systemic Responses Infect. Immun., October 1, 2005; 73(10): 6763 - 6770. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Applequist, E. Rollman, M. D. Wareing, M. Liden, B. Rozell, J. Hinkula, and H.-G. Ljunggren Activation of Innate Immunity, Inflammation, and Potentiation of DNA Vaccination through Mammalian Expression of the TLR5 Agonist Flagellin J. Immunol., September 15, 2005; 175(6): 3882 - 3891. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Hawn, H. Wu, J. M. Grossman, B. H. Hahn, B. P. Tsao, and A. Aderem A stop codon polymorphism of Toll-like receptor 5 is associated with resistance to systemic lupus erythematosus PNAS, July 26, 2005; 102(30): 10593 - 10597. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Andersen-Nissen, K. D. Smith, K. L. Strobe, S. L. R. Barrett, B. T. Cookson, S. M. Logan, and A. Aderem Evasion of Toll-like receptor 5 by flagellated bacteria PNAS, June 28, 2005; 102(26): 9247 - 9252. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Vijay-Kumar, J. R. Gentsch, W. J. Kaiser, N. Borregaard, M. K. Offermann, A. S. Neish, and A. T. Gewirtz Protein Kinase R Mediates Intestinal Epithelial Gene Remodeling in Response to Double-Stranded RNA and Live Rotavirus J. Immunol., May 15, 2005; 174(10): 6322 - 6331. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Pulendran Variegation of the Immune Response with Dendritic Cells and Pathogen Recognition Receptors J. Immunol., March 1, 2005; 174(5): 2457 - 2465. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. V. Sitaraman, J.-M. Klapproth, D. A. Moore III, C. Landers, S. Targan, I. R. Williams, and A. T. Gewirtz Elevated flagellin-specific immunoglobulins in Crohn's disease Am J Physiol Gastrointest Liver Physiol, February 1, 2005; 288(2): G403 - G406. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lyons, L. Wang, J. E. Casanova, S. V. Sitaraman, D. Merlin, and A. T. Gewirtz Salmonella typhimurium transcytoses flagellin via an SPI2-mediated vesicular transport pathway J. Cell Sci., November 15, 2004; 117(24): 5771 - 5780. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Honko and S. B. Mizel Mucosal Administration of Flagellin Induces Innate Immunity in the Mouse Lung Infect. Immun., November 1, 2004; 72(11): 6676 - 6679. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Cobb, J. C. Mychaleckyj, D. J. Wozniak, and Y. S. Lopez-Boado Pseudomonas aeruginosa Flagellin and Alginate Elicit Very Distinct Gene Expression Patterns in Airway Epithelial Cells: Implications for Cystic Fibrosis Disease J. Immunol., November 1, 2004; 173(9): 5659 - 5670. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Anjuere, C. Luci, M. Lebens, D. Rousseau, C. Hervouet, G. Milon, J. Holmgren, C. Ardavin, and C. Czerkinsky In Vivo Adjuvant-Induced Mobilization and Maturation of Gut Dendritic Cells after Oral Administration of Cholera Toxin J. Immunol., October 15, 2004; 173(8): 5103 - 5111. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yu, H. Zeng, M. Vijay-Kumar, A. S. Neish, D. Merlin, S. V. Sitaraman, and A. T. Gewirtz STAT Signaling Underlies Difference between Flagellin-induced and Tumor Necrosis Factor-{alpha}-induced Epithelial Gene Expression J. Biol. Chem., August 20, 2004; 279(34): 35210 - 35218. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Srinivasan, J. Foley, and S. J. McSorley Massive Number of Antigen-Specific CD4 T Cells during Vaccination with Live Attenuated Salmonella Causes Interclonal Competition J. Immunol., June 1, 2004; 172(11): 6884 - 6893. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Didierlaurent, I. Ferrero, L. A. Otten, B. Dubois, M. Reinhardt, H. Carlsen, R. Blomhoff, S. Akira, J.-P. Kraehenbuhl, and J.-C. Sirard Flagellin Promotes Myeloid Differentiation Factor 88-Dependent Development of Th2-Type Response J. Immunol., June 1, 2004; 172(11): 6922 - 6930. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cuadros, F. J. Lopez-Hernandez, A. L. Dominguez, M. McClelland, and J. Lustgarten Flagellin Fusion Proteins as Adjuvants or Vaccines Induce Specific Immune Responses Infect. Immun., May 1, 2004; 72(5): 2810 - 2816. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. S. Lopez-Boado, M. Espinola, S. Bahr, and A. Belaaouaj Neutrophil Serine Proteinases Cleave Bacterial Flagellin, Abrogating Its Host Response-Inducing Activity J. Immunol., January 1, 2004; 172(1): 509 - 515. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Agrawal, A. Agrawal, B. Doughty, A. Gerwitz, J. Blenis, T. Van Dyke, and B. Pulendran Cutting Edge: Different Toll-Like Receptor Agonists Instruct Dendritic Cells to Induce Distinct Th Responses via Differential Modulation of Extracellular Signal-Regulated Kinase-Mitogen-Activated Protein Kinase and c-Fos J. Immunol., November 15, 2003; 171(10): 4984 - 4989. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zeng, A. Q. Carlson, Y. Guo, Y. Yu, L. S. Collier-Hyams, J. L. Madara, A. T. Gewirtz, and A. S. Neish Flagellin Is the Major Proinflammatory Determinant of Enteropathogenic Salmonella J. Immunol., October 1, 2003; 171(7): 3668 - 3674. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yu, H. Zeng, S. Lyons, A. Carlson, D. Merlin, A. S. Neish, and A. T. Gewirtz TLR5-mediated activation of p38 MAPK regulates epithelial IL-8 expression via posttranscriptional mechanism Am J Physiol Gastrointest Liver Physiol, July 7, 2003; 285(2): G282 - G290. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Means, F. Hayashi, K. D. Smith, A. Aderem, and A. D. Luster The Toll-Like Receptor 5 Stimulus Bacterial Flagellin Induces Maturation and Chemokine Production in Human Dendritic Cells J. Immunol., May 15, 2003; 170(10): 5165 - 5175. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |