The JI Acurri Cytometers
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sherman, M. A.
Right arrow Articles by Brown, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sherman, M. A.
Right arrow Articles by Brown, M. A.
The Journal of Immunology, 2002, 169: 3811-3818.
Copyright © 2002 by The American Association of Immunologists

IL-4 Induces the Proteolytic Processing of Mast Cell STAT61

Melanie A. Sherman, Doris R. Powell and Melissa A. Brown2

Department of Pathology and Laboratory Medicine, Emory University, Atlanta, GA 30322


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-4 is a potent, pleiotropic cytokine that, in general, directs cellular activation, differentiation, and rescue from apoptosis. However, in mast cells, IL-4 induces the down-regulation of activation receptors and promotes cell death. Mast cells have been shown to transduce IL-4 signals through a unique C-terminally truncated isoform of STAT6. In this study, we examine the mechanism through which STAT6 is processed to generate this isoform. We demonstrate that STAT6 processing in mast cells is initiated by IL-4-induced phosphorylation and nuclear translocation of full-length STAT6 and subsequent cleavage by a nuclear serine-family protease. The location of the protease in the nucleus ensures that the truncated STAT6 has preferential access to bind DNA. IL-4-responsive target genes in mast cells are identified by chromatin immunoprecipitation of STAT6, including the IL-4 gene itself. These results suggest a molecular explanation for the suppressive effects of IL-4 on STAT6-regulated genes in mast cells.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Signal transducer and activator or transcription 6, a latent cytoplasmic transcription factor, is a member of a family of signaling molecules that mediate responses to cytokines. IL-4 (and IL-13) binding to its receptor results in the activation of Janus kinase (JAK)3 1 and JAK3, receptor-associated tyrosine kinases (1, 2). JAK1 and 3 directly phosphorylate tyrosine residues within STAT6 Src homology (SH)2 domains leading to dimerization and translocation to the nucleus where STAT6 can associate with regulatory elements that control IL-4 (and/or IL-13) responsive genes. Numerous studies using STAT6-/- mice have demonstrated the importance of this molecule in providing immunological competence (3, 4, 5). For example, the STAT6 signaling pathway is of particular significance in the development of Th2 immunity to extracellular pathogens. STAT6-/- mice are extremely vulnerable to these infections, and T cells from these mice are unable to produce adequate amounts of the Th2 cytokines IL-4, IL-13, and IL-5 (3, 4, 5). B cell isotype switching, immunity to some tumors (6, 7), and development of contact hypersensitivity (8) are also compromised in STAT6-/- mice.

Because IL-4 plays a central role in the regulation of immune responses, the magnitude and duration of STAT6-induced responses must be tightly controlled. At least two mechanisms have been described to accomplish this regulation. First, suppressor of cytokine signaling (SOCS) proteins are up-regulated by cytokine-induced STAT activation and either compete with STAT for binding to receptors or bind to and inhibit JAK kinase activity (reviewed by Chen et al. in Ref. 9). SOCS-1 is an IL-4-inducible protein and thus acts relatively late in the STAT6 signaling cascade to inhibit JAK1 and limit the duration of STAT6 activation (10). Second, alternate isoforms of STAT proteins have been described for several STAT family members (11, 12, 13, 14, 15). These {beta} isoforms (identified for STATs 1, 3, 5A, and 5B) lack the transactivation domain (TAD) but retain DNA binding ability. Therefore, by competing with the transcriptionally active form of STAT for binding to DNA, they effectively inhibit the early transcription of cytokine-responsive genes.

The biological significance of STAT isoforms that act as dominant negative transcription factors is clearly evident from studies of STAT5, a signaling molecule activated in response to IL-2, IL-3, IL-5, stem cell factor, and IL-15 (16, 17, 18). The truncated STAT5{beta} isoforms are expressed uniquely in myeloid progenitor cells and are responsible for maintaining an IL-3-refractive state (15). Upon differentiation, these cells lose expression of STAT5{beta} and express only full-length STAT5, coincident with a gain of IL-3 responsiveness (19). The truncated STAT5 proteins are generated through proteolysis of full-length STAT5 by a nuclear protease found only in immature myelocytes (20). This protease, termed modulator of STAT activity (MSA) is a 25-kDa member of the serine protease family. Its recognition and cleavage site in STAT5 has been identified, and mutation of this site results in a STAT5 protein that resists proteolysis (19).

We previously identified a STAT6 isoform that shares characteristics with the {beta} forms of the other STAT family members (21). In contrast to the 100-kDa full-length STAT6 molecule, STAT6{beta} is truncated to ~65 kDa. Results from epitope mapping studies demonstrate that STAT6{beta} lacks the C-terminal TAD, but it appears to retain a high affinity for DNA. STAT6{beta} is expressed in a cell type-specific manner and is present in mast cells, but not in B or T cells. Interestingly, while IL-4-induced STAT6 is associated with an activating phenotype in B cells and T cells, it is often suppressive for mast cell gene expression. Mast cell receptors c-kit and Fc{epsilon}RI are down-regulated in response to IL-4 stimulation (22, 23, 24) and the induction of several cytokines is inhibited upon long-term IL-4 exposure (23).

In this study, we set out to 1) characterize the STAT6 protein in mast cells with regard to the mechanism of isoform generation, phosphorylation status, and cellular localization, and 2) identify a role of STAT6{beta} in mast cell gene transcription. We demonstrate that analogous to STAT5{beta}, STAT6{beta} is also generated by proteolytic processing. Although distinct from STAT5 MSA, the mast cell STAT6 protease is a member of the serine protease family and is located in the nucleus. We show that mast cell STAT6 is phosphorylated in response to IL-4 and binds in vivo to a STAT6 binding site in the IL-4 promoter in mast cells. Mast cell STAT6 is also associated with the promoters of apoptosis regulator genes bax and bcl-2. The restricted expression and binding of this isoform to IL-4 responsive genes in mast cells could account for the cell-type specific inhibitory effects of IL-4.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell culture and stimulation

CFTL-15, a murine IL-3 dependent mast cell line (C15; Ref. 25), WEHI-3B, an immature myeloid cell line (26), and M12.4.1, a transformed B cell line (27), were cultured in complete RPMI (10% heat-inactivated FBS, 0.5% penicillin/streptomycin, 2 mM glutamine, 1.0 mM sodium pyruvate, 50 µM 2-ME). C15 culture medium also contained 25% WEHI-3B supernatant as a source of IL-3, a crucial growth factor for mast cells (26). DO11.10 cells (OVA-specific T cells; Ref. 28) were stimulated with BALB/c spleen cells, IL-2 (104 U/ml), and OVA323–339 peptide (0.5 µM) every 7–10 days. Bone marrow-derived mast cells (BMMC) were harvested from BALB/c mice (The Jackson Laboratory, Bar Harbor, ME) and STAT6-/- BALB/c mice (The Jackson Laboratory) (4) and were differentiated with 25% WEHI-3B supernatant. BMMC were used after 4 wk in culture at >90% purity as determined by FACS analysis (FACScan; BD Biosciences, Mountain View, CA) of c-kit and Fc{epsilon}RI expression. To induce STAT6 activation, cells were stimulated with rIL-4 (a kind gift of C. Watson and W. E. Paul, National Institutes of Health, Bethesda, MD) at 10,000 U/ml for 15 min at 37°C.

Cell extract preparation

BMMC whole cell extracts were prepared in the presence of high concentrations of protease inhibitors (Roche, Indianapolis, IN) according to the published protocol (29). Briefly, after treatment with IL-4 (15 min at 37°C), cells were pelleted, washed in PBS, resuspended in lysis buffer (50 mM Tris, pH 8.0, 0.5% Nonidet P-40, 200 mM NaCl, 10% glycerol, 0.1 mM EDTA, 1.0 mM DTT, 100 µM sodium orthovanadate, and protease inhibitors), and incubated for 60 min on ice. Following high-speed microcentrifugation at 4°C (13,000 rpm) (model 5522; Forma Scientific, Marietta, OH), supernatants were collected and protein concentration was determined by the Bradford procedure (Ref. 30 ; Bio-Rad, Hercules, CA).

Nuclear extracts were prepared following the procedure of Fiering et al. (31). Briefly, cells were harvested and washed once in ice-cold PBS and once in cold buffer A (10 mM HEPES, pH 7.8, 15 mM KCl, 2 mM MgCl2, 1 mM DTT, 0.1 mM EDTA, 1x protease inhibitors). Cells were then lysed in buffer B (buffer A plus 0.2% Nonidet P-40) on ice for 5 min with vortexing. Nuclei were pelleted by high-speed microcentrifugation and the supernatant was saved as the "cytosolic fraction." Pelleted nuclei were resuspended in buffer C (50 mM HEPES, pH 7.8, 50 mM KCl, 0.1 mM EDTA, 1 mM DTT, 10% (v/v) glycerol, 1x protease inhibitors; Roche) and 10% volume of 3 M (NH4)2SO4, pH 7.9, was added for a final concentration of 0.3 M (NH4)2SO4. After a 30-min incubation on a rotating platform, the sample was centrifuged at 200,000 x g for 15 min. An equal volume of 3 M (NH4)2SO4 was added to the supernatant, and precipitated proteins were pelleted at 100,000 x g for 10 min. The proteins were resuspended in 100 µl buffer B per 108 cell equivalents and used for mixing experiments with M12 B cells or stored at -80°C.

To prepare SDS lysates, cells were pelleted and washed once with cold PBS. The cell pellet was then suspended directly in 1x SDS-PAGE loading buffer (58 mM Tris-HCl, pH 6.8, 5% (v/v) glycerol, 1.6% SDS, 1.5% DTT, 0.002% bromophenol blue) at the ratio of 2500 cells to 1 µl buffer. The viscous lysate was then sonicated (4 x 1 s pulses on power setting 3) (Sonic Dismembrator Model 100; Fisher Scientific, Pittsburgh, PA) and frozen at -80°C.

For each gel lane, 50 µg protein (for extracts) or 5 x 103 cell equivalents (for SDS lysates) were used for Western blot analysis.

Western blot analyses

Western blot analyses were performed with rabbit polyclonal anti-STAT6 Abs raised against the C-terminal domain (M20X; Santa Cruz Biotechnology, Santa Cruz, CA), the DNA-binding domain (M200X; Santa Cruz Biotechnology), or the phosphorylated tyrosine 641 of murine STAT6 (Cell Signaling, Beverly, MA) and rabbit polyclonal anti-JAK3 and anti-upstream stimulatory factor (USF; Santa Cruz Biotechnology). Cell extracts (20 µg) were electrophoresed on a 10% SDS-PAGE gel and transferred to nylon membrane. The blot was blocked in 5% milk/TBST (10 mM Tris, pH 8.0, 150 mM NaCl, 0.5% Tween) overnight at 4°C. Abs (1 µg/ml) were added in 2% milk/TBST (the phospho-STAT6 Ab was diluted in 3% BSA/Tween 20 + TBS) and incubated 1 h at room temperature. HRP-conjugated donkey anti-rabbit secondary Abs (Amersham, Arlington Heights, IL) were added at a 1/5000 dilution in 2% milk/TBST and incubated 1 h at room temperature. Reactive proteins were visualized by ECL (DuPont, Boston, MA) and radiography.

Northern blot analysis

For analysis of STAT6 expression in cell lines, 10 µg of total RNA was electrophoresed on a 1% formaldehyde gel and transferred to nitrocellulose. The STAT6 DNA probe (bp 1–384 from STAT6 sequence, Accession no. AF481809) was labeled by random hexamer priming.

RNase protection analysis

Total RNA samples from C15 and M12 cell lines were isolated using the RNA-STAT-60 reagent according to the manufacturer’s instructions (Tel-Test, Friendswood, TX). RNase protection assays were performed using four different STAT6 cDNA fragments as templates for the synthesis of antisense RNA labeled with [32P]UTP (Riboprobe kit; Promega, Madison, WI). The probes correspond to the following sequences of STAT6 cDNA, GenBank accession no. AF481809: probe 1, bp 1718–2392; probe 2, bp 2093–2392; probe 3, bp 2422–2887; probe 4, bp 2134–2463. Full-length RNA probes were gel-purified and hybridized (5 x 105 cpm) to 10 µg of total RNA overnight at 45°C in 40 mM PIPES, pH 6.4, 400 mM NaCl, 1 mM EDTA, and 80% formamide in a total volume of 30 µl. Samples were incubated for 1 h at 30°C after the addition of 350 µl of digestion buffer (10 mM Tris, pH 7.5, 5 mM EDTA, 300 mM NaCl, 0.14 µg of RNase T1, and 1 µg of RNase A). Proteinase K (50 µg) and SDS (10 µl of 20% solution) were added and incubated for an additional 30 min at 37°C. Samples were extracted with phenol/chloroform, precipitated, resuspended in gel loading buffer, and analyzed by 6% denaturing PAGE.

Chromatin immunoprecipitation (ChIP) assays

Formaldehyde cross-linked chromatin was prepared from 4 x 106 cells for each sample. Abs (5 µg per immunoprecipitation (IP) sample) were precleared with 40 µg each sonicated salmon sperm DNA and yeast tRNA in 900 µl IP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl, pH 8.0, 167 mM NaCl) for 15 min at 4°C on a rocking platform. Chromatin (100 µl; one-fifth of the original sample) was added to the Ab solution for a further 2-h incubation at 4°C. Protein A/G agarose beads (Santa Cruz Biotechnology) were simultaneously pretreated with yeast tRNA (for each sample, 20 µl beads and 200 µg yeast tRNA). The pretreated beads were added to the Ab/chromatin mixture and incubated for an additional hour at 4°C. The beads were washed extensively: three times with IP dilution buffer, three times with 1x dialysis buffer (2 mM EDTA, 50 mM Tris-HCl, pH 8.0, 0.2% Sarkosyl), three times with IP wash buffer (100 mM Tris-HCl, pH 9.0, 500 mM LiCl, 1% Nonidet P-40, 1% deoxycholic acid), and once with 10 mM Tris 0.1 mM EDTA. The Ab complexes were eluted with 150 µl elution buffer (50 mM NaCO, 1% SDS), rocking the tubes for 5 min at room temperature. The beads were pelleted and the elution was repeated, pooling eluates (300 µl total). The cross-links were reversed by adding 1 µg RNase and 17.6 µl 5 M NaCl to each sample and heating to 67°C for at least 4 h. The DNA was then precipitated and resuspended in 125 µl 1x proteinase K buffer (50 mM Tris-HCl, pH 7.5, 25 mM EDTA, 1.25% SDS) with 20 µg proteinase K. The DNA was phenol/chloroform extracted and then precipitated with 20 µg glycogen as a carrier. The DNA was resuspended in 50 µl 10 mM Tris 0.1 mM EDTA and 1 µl (or 10-fold dilutions) was used for PCR analysis. Conditions for PCR were 40 cycles (94°C for 30 s, 50°C for 30 s, 72°C for 1 min) using HotStarTaq (Qiagen, Valencia, CA). PCR primers: IL-4 promoter (forward): GTGGCAACCCTACGCTGATAAG; (reverse): GCTAACAATGCAATGCTGGCAG; IL-4 intron (forward): GGATCCTGCAGGACATCTCTCTTCCCTTTC; (reverse): CATTCTGCATCAGACTCCTGGAG; bax promoter (forward): GCTAGGCCCTGCTGGTGTG; (reverse): TTCGTTCATTGCTGGTGGCTCTCA; bcl-x promoter(forward): AGCTGGCTGGTCCTTTCAA; (reverse): GGGCTCAACCAGTCCATT; bcl-2 promoter (forward): AACCCTCCCCCACCACCTCCTTCT; (reverse): CCTTCTTCTCGGCAATTTACACTT.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
STAT6{beta} is induced by IL-4 treatment of mast cells

In previous studies we established that mast cells express both a 100- and a 65-kDa isoform of STAT6, and it is the smaller form that preferentially binds DNA in vitro (21). Because STAT6 requires activation by IL-4 signaling to dimerize, translocate to the nucleus, and bind DNA, we sought to determine the relationship between the 65-kDa isoform (herein referred to as the {beta} form of STAT6) and IL-4 activation of mast cells. BMMCs, as well as B cells and WEHI-3B myeloid cells, were treated with IL-4 for 2 h before cell lysis. To denature any proteases that could result in artifactual proteolysis during the extract procedure, cells were directly lysed in 1x SDS-PAGE sample buffer. The extracts were analyzed by Western blot using M200, an Ab that detects both full-length and {beta} forms of STAT6. As shown in Fig. 1Go, IL-4 treatment increases the presence of the {beta} form in mast cells, but not in B cells or WEHI-3B.



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 1. A, IL-4-induced expression of STAT6{beta} in mast cells. Resting (lane 1) or IL-4 treated (lane 2) BMMC were lysed directly in 1x SDS-PAGE sample buffer. Samples (5 x 104 cell equivalents) were analyzed by Western blot with the Ab M200, which is specific for the central domain of STAT6. B, The STAT6{beta} isoform is mast cell-specific. Extracts were prepared from IL-4-treated M12 B cells, WEHI-3B myeloid cells, and BMMC by direct lysis in 1x SDS-PAGE sample buffer.

 
STAT6{beta} is phosphorylated on Y641 and translocates to the nucleus in response to IL-4

STAT6 typically resides in the cytoplasm of resting cells, possibly associated with scaffolding proteins (32). IL-4-induced activation leads to phosphorylation of Y641, translocation of STAT6 to the nucleus, and subsequent DNA binding (33, 34, 35). Using a commercially available Ab specific for the Y-641 epitope in Western blot analysis, we observed rapid phosphorylation of STAT6{beta} upon exposure of the mast cells to IL-4 (Fig. 2GoA). Phosphorylation persisted over a 24-h period (Fig. 2GoB), similar to the long kinetics observed in B cells (33). Cytoplasmic and nuclear fractions were also isolated and examined for the presence of STAT6{beta}. As shown in Fig. 2GoC, after IL-4 treatment of mast cells, the STAT6 isoform is located primarily in the mast cell nucleus, consistent with its phosphorylated state. These results indicate that STAT6{beta} is subject to phosphorylation and can translocate to the nucleus in a manner similar to the full-length protein.



View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 2. STAT6{beta} is phosphorylated and located in the mast cell nucleus. A, Mast cells and B cells were left untreated (-) or treated with IL-4 for 15 min before extract preparation (+). Western blot analysis was performed using an Ab specific for phosphorylated Y641 of STAT6. B, Mast cells were treated with IL-4 for the indicated times before whole cell lysis with Nonidet P-40 and Western blot analysis with the phospho-STAT6-specific Ab. C, Mast cells and B cells were treated with IL-4 for 15 min before cell membrane lysis by 0.2% Nonidet P-40. The nuclei were pelleted, washed, and lysed in ammonium sulfate buffer. The cytoplasmic (C) and nuclear (N) fractions were analyzed for STAT6 (using the pan M200 STAT6 Ab), JAK3 (as a marker for the cytoplasmic fraction), and the transcription factor USF (as a marker for the nuclear fraction).

 
STAT6 is proteolytically processed in mast cells

STAT5 isoforms are proteolytically processed in immature myeloid cells by MSA, a serine family protease that is located in the nucleus (36). Due to the rapid kinetics of STAT6{beta} expression, its induction by IL-4 treatment, and its nuclear location, we considered the possibility that STAT6{beta} could be generated by a similar mechanism in mast cells. To address this possibility, mast cells were cultured for 16 h with a protease inhibitor mixture. After confirming cell viability, whole cell extracts were prepared. As shown in Fig. 3Go, the addition of protease inhibitors to live cells prevents the generation of the truncated STAT6 protein, indicating that the generation of the truncated STAT6 molecule is an active and specific process that occurs in viable cells. In contrast, simply increasing the concentration of protease inhibitors (up to five times the recommended dose) in the lysis buffer when preparing mast cell extracts does not prevent the appearance of STAT6{beta} (37), because the STAT6 protein is processed in live mast cells before lysis.



View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 3. Culture of live mast cells with protease inhibitors inhibits STAT6{beta} expression. A, BMMC and M12 B cells remained untreated (-) or were cultured with 1x protease inhibitor mixture for 16 h before whole cell Nonidet P-40 lysis (+). B, BMMC were cultured with either a mixture of all or each individual protease inhibitor using the following concentrations: 1 mM EDTA, 1 mM PMSF, 1 µg/ml leupeptin, 3 µg/ml aprotinin, and/or 2 µg/ml pepstatin A for 16 h. Whole cell extracts were analyzed for STAT6{beta} by Western blot with the pan STAT6 M200 Ab (Santa Cruz Biotechnology).

 
Mast cells also were preincubated with individual protease inhibitors before IL-4 treatment and cell lysis to determine the class of protease that acts on STAT6. Treatment with a mixture of protease inhibitors or with 1 mM PMSF and 1 mM EDTA, but not leupeptin, aprotinin or pepstatin A, inhibits the generation of STAT6{beta} (Fig. 3GoB). Thus, the STAT6 protease (like STAT5 MSA) appears to be a member of the serine protease family. Of note, STAT6 does not contain the MSA recognition and cleavage sequence (ATY*MDQA) (20). In addition, MSA does not appear to cleave STAT6 (38), and STAT5 remains intact in mast cells (21, 37). Taken together, these data indicate that the mast cell STAT6 protease and STAT5 MSA are distinct proteins.

STAT1{beta} and STAT3{beta} are generated by alternative RNA splicing (11, 12, 13) and STAT5 RNA can be processed to yield a truncated {beta} form as well (14). To address the possibility that RNA processing may also contribute to the generation of STAT6 isoforms, we analyzed mast cell STAT6 transcripts by Northern blot analysis (Fig. 4GoA). RNase protection assays were also performed using four distinct probes (Fig. 4GoB). Only a single STAT6 mRNA species was detected in mast cells using both analyses. These results support the idea that the generation of the STAT6{beta} protein is solely due to nuclear proteolytic processing in mast cells.



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 4. Evaluation of mast cell RNA for alternative STAT6 transcripts. A, Total RNA (10 µg) from resting or PMA/ionomycin-stimulated C15 mast cells and DO11.10 T cells was used in Northern blot analysis with a STAT6 probe (bp 257–642 of STAT6 cDNA). B, Total RNA (10 µg) from resting M12 B cells (B) and C15 mast cells (M) was incubated with four different riboprobes from the 3' STAT6 sequence. Only one major product was detected in the samples for each probe used.

 
STAT6{beta} and the STAT6 protease colocalize in the mast cell nucleus

We demonstrate that STAT6{beta} is enriched in nuclear fractions and previous studies show that STAT5 MSA resides in the nucleus of myeloid progenitors (20). To determine whether the STAT6 protease is also a nuclear protein, we examined the ability of isolated mast cell fractions to generate the truncated STAT6{beta} using B cell STAT6 as a source of the full-length protein. STAT6-deficient BMMC were used in these experiments to avoid contributions from mast cell-derived STAT6 isoforms. Intact mast cells and B cells were mixed together in a 1:1 ratio in the absence of protease inhibitors during extract preparation. Extracts were analyzed by Western blot using the M200 Ab. As shown in Fig. 5GoA, full-length STAT6 is cleaved by a mast cell protease. Mast cell extracts were then fractionated before mixing with B cells to localize the proteolytic activity. Incubation with the insoluble (uncleared) nuclear fraction and the whole cell extract, but not the cytoplasmic fraction, leads to the generation of STAT6{beta} (Fig. 5GoB). Freeze-thawing the extracts or including PMSF/EDTA in the lysis buffer inhibits the STAT6 protease (Fig. 5GoA and data not shown). The results demonstrate that the proteolytic activity is localized in the nucleus of mast cells. Furthermore, STAT6 does not have to be activated (phosphorylated) to be processed by the STAT6 protease. This conclusion is based on the fact that STAT6 derived from resting B cells can be cleaved. The compartmentalization of the STAT6{beta} isoform in the nucleus explains why both full-length and truncated STAT6 are observed in whole mast cell extracts (Fig. 3GoB and Refs. 21 and 37).



View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 5. The STAT6 protease is located in the mast cell nucleus. A, Resting M12 B cells were lysed in the absence or presence (1:1 ratio) of STAT6-/- BMMC extracts. One mixture sample contains protease inhibitors, which block STAT6 processing. IL-4-treated wild-type BMMC are included for size comparison. B, Resting M12 B cells were lysed in the presence of fractionated STAT6-/- BMMC extracts (whole cell, cytoplasmic, or nuclear fractions). Mixed extracts were analyzed for STAT6 protein by Western blot with the pan-STAT6 Ab M200.

 
STAT6{beta} binds to the mast cell IL-4 promoter in vivo

We have previously postulated that STAT6{beta} is involved in negatively regulating mast cell IL-4 production. A STAT6 binding site is present in the IL-4 proximal promoter, and mutational studies have demonstrated that it confers transcriptional repression (39). STAT6 binding to this element could act to limit IL-4 transcription by interfering with positive transcriptional activators such as NFAT (40, 41). Alternatively, preferential binding of STAT6{beta}, which presumably lacks the ability to transactivate because of the truncation of the parent protein, may directly interfere with transcription. EMSA analysis has demonstrated that STAT6{beta} preferentially associates with the IL-4 promoter STAT6 site in vitro (21). To test the ability of STAT6 to bind to the IL-4 promoter in vivo, ChIP experiments were performed with mast cell chromatin and STAT6 antisera. Mast cell chromatin precipitated with anti-STAT6 but not normal rabbit IgG yields PCR-amplified IL-4 promoter fragments (Fig. 6GoA, upper panels). This finding indicates that STAT6 binds to the IL-4 proximal promoter sequences in vivo in mast cells. STAT6 was not associated with this site in B cells, Th1, or Th2 cells, a result consistent with our previous observations that IL-4 transcription in mast cells uses cell-specific regulatory mechanisms (39, 42, 43). As a control, PCR was also performed using primers for the IL-4 second intron, which contains a binding site for STAT5 (44). This region was not amplified from STAT6-associated chromatin (Fig. 6GoA, lower panels), suggesting that STAT6 is specifically associated with the promoter element of the IL-4 gene. In addition, stimulation of the mast cells with ionomycin (which activates IL-4 transcription) appears to result in decreased STAT6 binding to the IL-4 promoter (Fig. 6GoB, lanes 3 and 4), a finding that supports the hypothesis that the STAT6 isoform acts as a negative repressor.



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 6. Specific in vivo binding of STAT6 to IL-4-responsive genes in mast cells. A, In vivo binding of STAT6 to the IL-4 promoter in resting BMMC, M12 B cells, and DO11.10 Th1 and Th2 cells was assessed by ChIP. Formaldehyde cross-linked DNA-protein complexes were immunoprecipitated with control rabbit IgG (-) or the STAT6-specific antisera M200 (+). IL-4 PCR primers amplify the -291 to +11 region of the proximal IL-4 promoter (upper panels) and 353 bp of a BglII fragment of the intron between exons 1 and 2 (44 ). As a control to show that the samples from each cell type contain equivalent amounts of target DNA, PCR was also performed on the immunoprecipitation supernatants ("total input chromatin"). B, ChIP analysis of BMMC stimulated for 2 h with IL-4 alone (lanes 1 and 2) or IL-4 plus the calcium ionophore ionomycin, which induces IL-4 transcription (lanes 3 and 4). Immunoprecipitated DNA and the IP supernatants ("total input chromatin") were amplified using IL-4 promoter-specific primers. C, ChIP analysis of IL-4-treated BMMC with primers specific for the promoters of apoptosis regulator proteins bcl-2, bax and bcl-x.

 
Finally, we also examined STAT6 involvement in apoptosis gene regulation in mast cells. Recently, STAT6 has been implicated in induction of mast cell apoptosis through IL-4/IL-10 cosignaling (45) and protection of mast cell apoptosis through IL-15 signaling (46). The ratio of anti-apoptotic proteins (such as bcl-2 and bcl-x) to proapoptotic proteins (such as bax and bad) can determine the probability of a cell’s survival (reviewed by Zornig et al. in Ref. 47). Three of these genes (bcl-2, bcl-x, and bax) have been shown to regulate mast cell apoptosis (45, 46, 48). Thus, ChIP was performed on chromatin from IL-4-stimulated mast cells using the STAT6 Ab M200 and primers specific for the apoptosis genes bcl-2, bcl-x, and bax. As shown in Fig. 6GoC, we observed no detectable STAT6 binding to the bcl-x promoter, a region that does contain one consensus STAT6 site and can bind STAT6 in vitro (46). However, we did observe STAT6 binding to the proapoptotic gene bax, and to the prosurvival gene bcl-2. The demonstration of in vivo binding of STAT6 to these genes supports the hypothesis proposed by others (45, 46) that STAT6 can regulate apoptosis in mast cells.

The STAT6-specific antisera used in these ChIP experiments can associate with both full-length and truncated STAT6, and a STAT6 isoform-specific Ab does not yet exist. Therefore, we cannot definitively demonstrate that the STAT6{beta} isoform (rather than full-length STAT6) is associated with mast cell chromatin. However, the STAT6 isoform is the predominant species in the mast cell nucleus (Fig. 2Go), and the isoform preferentially binds DNA in vitro despite the presence of full-length STAT6 (21). To provide further evidence for the idea that STAT6{beta} preferentially binds STAT6-regulated genes in mast cells in vivo, parallel immunoprecipitations were performed using two STAT6 Abs: M200X, which binds both full-length and truncated STAT6{beta}, and M20X, which associates with full-length STAT6 only (21). As shown in Fig. 7Go, both samples resulted in amplification of the IL-4 promoter sequence, suggesting that both full-length and truncated STAT6{beta} are present in the mast cell nucleus. However, dilutions of the immunoprecipitated chromatin material demonstrated that the M200-associated sample contains at least 10-fold more template, consistent with our Western blot analysis (Fig. 2GoC) showing that most of the STAT6 protein in the nucleus is processed to the {beta} isoform.



View larger version (39K):
[in this window]
[in a new window]
  		FIGURE 7. Comparison of chromatin associated with full-length STAT6 (M20 Ab immunoprecipitation) and full-length STAT6 plus STAT6{beta} ("pan" M200 Ab immunoprecipitation). Chromatin from IL-4-treated BMMC was immunoprecipitated with M20, M200, and control rabbit antiserum and analyzed by PCR with IL-4 promoter-specific primers. Template material was serially diluted 10-fold before PCR analysis.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In this study, we demonstrate that a C-terminally-truncated isoform of STAT6, termed STAT6{beta}, is generated by posttranslational processing in mast cells and is associated with the promoter of the IL-4, bax, and bcl-2 genes in vivo. Although both STAT6 isoforms exist in mast cells, it is the full-length STAT6 that predominates in resting cells. We propose that IL-4 interaction with its receptor activates the conventional JAK-STAT signaling pathway in mast cells. The full-length molecule is phosphorylated on tyrosine 641, dimerizes, and translocates to the nucleus where it is subject to proteolysis by a protease sequestered in the nucleus giving rise to STAT6{beta}. Thus, the generation of STAT6{beta} is dependent on IL-4-induced nuclear translocation.

This model can account for the apparently conflicting data previously reported by other groups. Suzuki et al. (49) observed that the 65-kDa STAT6 isoform is phosphorylated by IL-4 treatment of mast cells. Conversely, Masuda et al. (50) did not detect the STAT6 isoform in resting MC/9 mast cells or BMMC and proposed that the use of a different lot of M200 Ab in Western blot analysis may be responsible for failure to detect STAT6{beta}. However, without exposure to IL-4, MC/9 mast cells and BMMC would not express appreciable amounts of STAT6{beta}. Notably, small amounts of STAT6{beta} are sometimes detected in our resting mast cell lysates. This may be a result of a procedural artifact that allows the protease access to STAT6 during cell lysis. Alternatively, resting mast cells can express and release small amounts of IL-4 (51), thus activating STAT6 in a subset of cells. Regardless, our results clearly show that mast cell exposure to IL-4 is necessary for optimal STAT6{beta} generation. Interestingly, in vivo administration of IL-4 induces the appearance of activated STAT6{beta} in murine lymph nodes (52). Although the cellular source of this STAT6 was not identified in this study, mast cells have been demonstrated to be present in lymph nodes after immunologic stimulation (53).

The C terminus of STAT6, a region containing a defined TAD (54), is absent in STAT6{beta}. Yet DNA binding activity is retained, suggesting that this molecule may act as a dominant-negative regulator of transcriptional activity by binding to the regulatory elements of STAT6-regulated genes and blocking the binding and/or action of positive-acting transcription factors. The regulation of STAT6 by the phosphatase sulfhydryl-2 domain-containing tyrosine phosphatase-1 (SHP-1) is also unique in mast cells: SHP-1 suppresses STAT6 activation in B cells but does not affect mast cell STAT6 (55), possibly due to the loss of a SHP-1 recognition site in the truncated STAT6{beta} molecule. These features of the STAT6{beta} isoform and its differential regulation are consistent with the known effects of IL-4 signaling in mast cells. In cell types where the full-length STAT6 protein is expressed, IL-4 exerts positive effects on differentiation and effector function. For example, in B cells, IL-4 induces expression of class II MHC Ags, Ig isotope switching, and proliferation. Endothelial cells induce VCAM-1 expression (56) when exposed to IL-4. The differentiation of CD4+ T cells to Th2 cells, a pathway essential for effective immune responses to extracellular pathogens, is also dependent on IL-4 (reviewed by Nelms et al. in Ref. 57). However, IL-4 acts to suppress the expression of several mast cell genes. Long-term exposure to IL-4 induces the down-regulation of Fc{epsilon}RI and c-kit expression and significantly reduces the activation-dependent expression of IL-4, IL-5, IL-13, and IL-6. (22, 23, 24). The dominant-negative STAT6 isoform may play a direct role in this process.

We have postulated that mast cell IL-4 expression is regulated through a negative feedback mechanism (37). Previous data from our laboratory confirms that the STAT6 binding site in the IL-4 promoter acts as a negative regulatory element (39), and work by others has shown that IL-4 signaling induces a down-regulation of further IL-4 expression by activated mast cells (23). Our demonstration that STAT6 binds to the IL-4 promoter in mast cells in vivo provides further data to support this hypothesis. We did not detect STAT6 binding to the IL-4 promoter in B cells or Th1 cells, consistent with the "closed" conformation of the IL-4 gene in these non-IL-4-producing cell types (58). We also did not detect STAT6 binding to the IL-4 promoter in Th2 cells, however, a recent report using ChIP analysis demonstrated that STAT6 does bind to the IL-4 promoter in Th2 cells after IL-4 stimulation (59). The difference in our results may reflect the fact that our chromatin was derived from resting Th2 cells and Avni et al. (59) used IL-4 treated Th2 cells, which would induce STAT6 binding to DNA.

Of particular interest is our finding that STAT6 associates with the proximal IL-4 promoter in resting, but not activated, mast cells. As mentioned above, mast cells continuously produce and release small amounts of IL-4 that may result in a low level of STAT6{beta} in the nucleus. Powerful cell stimulation (such as the ionophore used in our studies) may recruit strong transactivators of IL-4, such as NFAT, which could displace STAT6{beta} on the IL-4 promoter. We propose that the binding of STAT6{beta} to the promoter limits active transcription in resting cells and may regulate the duration of IL-4 production after cell activation. Thus, STAT6 could facilitate a negative feedback response in mast cells. This response may be important physiologically during the generation of Th cell responses where early sources of IL-4, such as those from mast cells, can drive Th2 cell differentiation. Timely suppression of mast cell IL-4 may regulate the magnitude of the Th2 response. Consistent with this idea, Morris et al. (60) recently showed that treatment of mice with IL-4 before Ag challenge induces a rapid increase in IFN-{gamma} and a suppression of Th2 cytokines. This finding is supportive evidence that a negative IL-4 feedback loop does exist in vivo.

Given the predominance of STAT6{beta} in IL-4-activated mast cells, it is not clear how STAT6 can positively affect gene expression in these cells. Some insight into this question may be gleaned from studies of the effect of IL-4 on mast cell apoptosis. The mechanisms that regulate mast cell programmed cell death are distinct from those that control lymphocyte apoptosis in several ways: 1) IL-4 alone does not protect mast cells from apoptosis (61, 62) as it does in B and T cells (63, 64, 65, 66, 67, 68, 69, 70); 2) a combination of signals resulting from exposure to both IL-4 and IL-10 induces genes that promote apoptosis, events that are STAT6-dependent (45), and 3) IL-15 (which in most cell types activates STAT5) protects mast cells from apoptosis through STAT6 induction of the bcl-x gene (46). These data indicate that mast cell STAT6 does play a positive role in apoptosis gene regulation, but only if STAT6 is activated through another receptor (IL-15) or if STAT6 is induced coincident with other cytokine signals. Other studies have also revealed instances where the negative effects of IL-4 on mast cell gene transcription are abrogated if other cytokine signaling pathways are activated simultaneously. For example, if mast cells are exposed to both IL-4 and IL-6 or stem cell factor, the cells proliferate and express Th2 cytokines (71). Thus, the mast cell-specific STAT6 protease may act to render mast cells insensitive to IL-4-induced gene activation alone. Only through costimulation of mast cells or alternative pathways of STAT6 activation will STAT6 mediate gene activation in mast cells. Our preliminary experiments show in vivo binding of mast cell STAT6 to the promoter of the apoptotic genes bax and bcl-2 after IL-4 treatment alone. It will be interesting to determine whether STAT6 can be induced to bind to other promoters, such as bcl-x, upon IL-15 treatment. Also, the long-term effects of cytokine signaling (such as IL-10 treatment) on the activity of the STAT6 protease may also reveal clues as to the mechanism of STAT6 gene activation and repression in mast cells.

There are several parallels that can be drawn between the STAT5 and STAT6 {beta} isoforms. Both are expressed in a cell-specific manner, and both are generated by a serine-family nuclear protease. Recently, it was shown that differentiation of myeloid precursors with GM-CSF causes the loss of STAT5 protease expression and recovery of their ability to respond to IL-3 (19). Ectopic expression of STAT5 cleavage site mutant proteins prevent the maturation of myelocytes, indicating that MSA and STAT5{beta} are crucial for regulating differentiation in these cells (20). There is a correlation between expression of the truncated STAT5 and resistance to apoptosis (72) and relapse of acute myeloid leukemia (38, 73), suggesting that the MSA protease is important in myeloid homeostasis. Mast cells are known for their ability to adapt their phenotype to their surroundings, so it will be important to determine whether mast cells can similarly be induced to lose STAT6 protease activity under growth conditions with select cytokines, leading to a unique IL-4-responsive phenotype in different tissue sites.

Note added in proof.

While this manuscript was in submission, Suzuki et al. (74) published similar results showing that mast cells express a nuclear serine protease that cleaves STAT6. This group also demonstrated that the cleavage site is at aa 685 (aspartic acid) of the STAT6 protein sequence and a cleavage-resistant STAT6 mutant confers hypersensitivity to IL-4 in mast cells as measured by Fc{epsilon}R1 down-regulation and apoptosis.


   Acknowledgments
 
We thank Shveta Shah for technical assistance and Drs. Jeremy Boss and S. Wright Caughman for helpful discussions and critical review of the manuscript.


   Footnotes
 
1 This work was supported by National Institutes of Health Grants AR02157 (to M.A.S.) and CA47992 (to M.A.B.). Back

2 Address correspondence and reprint requests to Dr. Melissa A. Brown, 7311 Woodruff Memorial Research Building, Department of Pathology and Laboratory Medicine, Emory University, 1639 Pierce Drive, Atlanta, GA 30322. E-mail address: mbrow18{at}emory.edu Back

3 Abbreviations used in this paper: JAK, Janus kinase; SH, Src homology; SOCS, suppressor of cytokine signaling; TAD, transactivation domain; MSA, modulator of STAT activity; BMMC, bone marrow-derived mast cells; USF, upstream stimulatory factor; IP, immunoprecipitation; ChIP, chromatin IP; SHP-1, sulfhydryl-2 domain-containing tyrosine phosphatase-1. Back

Received for publication June 17, 2002. Accepted for publication July 31, 2002.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Takeda, K., T. Kishimoto, S. Akira. 1997. STAT6: its role in interleukin 4-mediated biological functions. J. Mol. Med. 75:317.[Medline]
  2. Wurster, A. L., T. Tanaka, M. J. Grusby. 2000. The biology of Stat4 and Stat6. Oncogene 19:2577.[Medline]
  3. Takeda, K., T. Tanaka, W. Shi, M. Matsumoto, M. Minami, S. Kashiwamura, K. Nakanishi, N. Yoshida, T. Kishimoto, S. Akira. 1996. Essential role of Stat6 in IL-4 signalling. Nature 380:627.[Medline]
  4. Kaplan, M. H., U. Schindler, S. T. Smiley, M. J. Grusby. 1996. Stat6 is required for mediating responses to IL-4 and for development of Th2 cells. Immunity 4:313.[Medline]
  5. Shimoda, K., J. van Deursen, M. Y. Sangster, S. R. Sarawar, R. T. Carson, R. A. Tripp, C. Chu, F. W. Quelle, T. Nosaka, D. A. Vignali, et al 1996. Lack of IL-4-induced Th2 response and IgE class switching in mice with disrupted Stat6 gene. Nature 380:630.[Medline]
  6. Ostrand-Rosenberg, S., M. J. Grusby, V. K. Clements. 2000. Cutting edge: STAT6-deficient mice have enhanced tumor immunity to primary and metastatic mammary carcinoma. J. Immunol. 165:6015.[Abstract/Free Full Text]
  7. Kacha, A. K., F. Fallarino, M. A. Markiewicz, T. F. Gajewski. 2000. Cutting edge: spontaneous rejection of poorly immunogenic P1.HTR tumors by Stat6-deficient mice. J. Immunol. 165:6024.[Abstract/Free Full Text]
  8. Yokozeki, H., M. Ghoreishi, S. Takagawa, K. Takayama, T. Satoh, I. Katayama, K. Takeda, S. Akira, K. Nishioka. 2000. Signal transducer and activator of transcription 6 is essential in the induction of contact hypersensitivity. J. Exp. Med. 191:995.[Abstract/Free Full Text]
  9. Chen, X. P., J. A. Losman, P. Rothman. 2000. SOCS proteins, regulators of intracellular signaling. Immunity 13:287.[Medline]
  10. Losman, J. A., X. P. Chen, D. Hilton, P. Rothman. 1999. Cutting edge: SOCS-1 is a potent inhibitor of IL-4 signal transduction. J. Immunol. 162:3770.[Abstract/Free Full Text]
  11. Caldenhoven, E., T. B. van Dijk, R. Solari, J. Armstrong, J. A. Raaijmakers, J. W. Lammers, L. Koenderman, R. P. de Groot. 1996. STAT3{beta}, a splice variant of transcription factor STAT3, is a dominant negative regulator of transcription. J. Biol. Chem. 271:13221.[Abstract/Free Full Text]
  12. Schindler, C., X. Y. Fu, T. Improta, R. Aebersold, Jr J. E. Darnell. 1992. Proteins of transcription factor ISGF-3: one gene encodes the 91- and 84-kDa ISGF-3 proteins that are activated by interferon {alpha}. Proc. Natl. Acad. Sci. USA 89:7836.[Abstract/Free Full Text]
  13. Shuai, K., G. R. Stark, I. M. Kerr, Jr J. E. Darnell. 1993. A single phosphotyrosine residue of Stat91 required for gene activation by interferon-{gamma}. Science 261:1744.[Abstract/Free Full Text]
  14. Wang, D., D. Stravopodis, S. Teglund, J. Kitazawa, J. N. Ihle. 1996. Naturally occurring dominant negative variants of Stat5. Mol. Cell. Biol. 16:6141.[Abstract]
  15. Azam, M., C. Lee, I. Strehlow, C. Schindler. 1997. Functionally distinct isoforms of STAT5 are generated by protein processing. Immunity 6:691.[Medline]
  16. Azam, M., H. Erdjument-Bromage, B. L. Kreider, M. Xia, F. Quelle, R. Basu, C. Saris, P. Tempst, J. N. Ihle, C. Schindler. 1995. Interleukin-3 signals through multiple isoforms of Stat5. EMBO J. 14:1402.[Medline]
  17. Mui, A. L., H. Wakao, A. M. O’Farrell, N. Harada, A. Miyajima. 1995. Interleukin-3, granulocyte-macrophage colony stimulating factor and interleukin-5 transduce signals through two STAT5 homologs. EMBO J. 14:1166.[Medline]
  18. Johnston, J. A., C. M. Bacon, D. S. Finbloom, R. C. Rees, D. Kaplan, K. Shibuya, J. R. Ortaldo, S. Gupta, Y. Q. Chen, J. D. Giri, et al 1995. Tyrosine phosphorylation and activation of STAT5, STAT3, and Janus kinases by interleukins 2 and 15. Proc. Natl. Acad. Sci. USA 92:8705.[Abstract/Free Full Text]
  19. Piazza, F., J. Valens, E. Lagasse, C. Schindler. 2000. Myeloid differentiation of FdCP1 cells is dependent on Stat5 processing. Blood 96:1358.[Abstract/Free Full Text]
  20. Lee, C., F. Piazza, S. Brutsaert, J. Valens, I. Strehlow, M. Jarosinski, C. Saris, C. Schindler. 1999. Characterization of the Stat5 protease. J. Biol. Chem. 274:26767.[Abstract/Free Full Text]
  21. Sherman, M. A., V. H. Secor, M. A. Brown. 1999. IL-4 preferentially activates a novel STAT6 isoform in mast cells. J. Immunol. 162:2703.[Abstract/Free Full Text]
  22. Mirmonsef, P., C. P. Shelburne, II C. Fitzhugh Yeatman, H. J. Chong, J. J. Ryan. 1999. Inhibition of kit expression by IL-4 and IL-10 in murine mast cells: role of STAT6 and phosphatidylinositol 3'-kinase. J. Immunol. 163:2530.[Abstract/Free Full Text]
  23. Ryan, J. J., S. DeSimone, G. Klisch, C. Shelburne, L. J. McReynolds, K. Han, R. Kovacs, P. Mirmonsef, T. F. Huff. 1998. IL-4 inhibits mouse mast cell Fc{epsilon}RI expression through a STAT6-dependent mechanism. J. Immunol. 161:6915.[Abstract/Free Full Text]
  24. Nilsson, G., U. Miettinen, T. Ishizaka, L. K. Ashman, A. M. Irani, L. B. Schwartz. 1994. Interleukin-4 inhibits the expression of kit and tryptase during stem cell factor-dependent development of human mast cells from fetal liver cells. Blood 84:1519.[Abstract/Free Full Text]
  25. Pierce, J. H., P. P. Di Fiore, S. A. Aaronson, M. Potter, J. Pumphrey, A. Scott, J. N. Ihle. 1985. Neoplastic transformation of mast cells by Abelson-MuLV: abrogation of IL-3 dependence by a nonautocrine mechanism. Cell 41:685.[Medline]
  26. Yung, Y. P., R. Eger, G. Tertian, M. A. Moore. 1981. Long-term in vitro culture of murine mast cells. II. Purification of a mast cell growth factor and its dissociation from TCGF. J. Immunol. 127:794.[Abstract]
  27. Alt, F. W., N. Rosenberg, R. J. Casanova, E. Thomas, D. Baltimore. 1982. Immunoglobulin heavy-chain expression and class switching in a murine leukaemia cell line. Nature 296:325.[Medline]
  28. Murphy, K. M., A. B. Heimberger, D. Y. Loh. 1990. Induction by antigen of intrathymic apoptosis of CD4+CD8+TCRlo thymocytes in vivo. Science 250:1720.[Abstract/Free Full Text]
  29. Lu, B., M. Reichel, D. A. Fisher, J. F. Smith, P. Rothman. 1997. Identification of a STAT6 domain required for IL-4-induced activation of transcription. J. Immunol. 159:1255.[Abstract]
  30. Bradford, M. M.. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248.[Medline]
  31. Fiering, S., J. P. Northrop, G. P. Nolan, P. S. Mattila, G. R. Crabtree, L. A. Herzenberg. 1990. Single cell assay of a transcription factor reveals a threshold in transcription activated by signals emanating from the T-cell antigen receptor. Genes Dev. 4:1823.[Abstract/Free Full Text]
  32. Ndubuisi, M. I., G. G. Guo, V. A. Fried, J. D. Etlinger, P. B. Sehgal. 1999. Cellular physiology of STAT3: where’s the cytoplasmic monomer?. J. Biol. Chem. 274:25499.[Abstract/Free Full Text]
  33. Schindler, C., H. Kashleva, A. Pernis, R. Pine, P. Rothman. 1994. STF-IL-4: a novel IL-4-induced signal transducing factor. EMBO J. 13:1350.[Medline]
  34. Hou, J., U. Schindler, W. J. Henzel, T. C. Ho, M. Brasseur, S. L. McKnight. 1994. An interleukin-4-induced transcription factor: IL-4 Stat. Science 265:1701.[Abstract/Free Full Text]
  35. Kotanides, H., N. C. Reich. 1993. Requirement of tyrosine phosphorylation for rapid activation of a DNA binding factor by IL-4. Science 262:1265.[Abstract/Free Full Text]
  36. Meyer, J., M. Jucker, W. Ostertag, C. Stocking. 1998. Carboxyl-truncated STAT5{beta} is generated by a nucleus-associated serine protease in early hematopoietic progenitors. Blood 91:1901.[Abstract/Free Full Text]
  37. Sherman, M. A.. 2001. The role of STAT6 in mast cell IL-4 production. Immunol. Rev. 179:48.[Medline]
  38. Xia, Z., R. R. Salzler, D. P. Kunz, M. R. Baer, L. Kazim, H. Baumann, M. Wetzler. 2001. A novel serine-dependent proteolytic activity is responsible for truncated signal transducer and activator of transcription proteins in acute myeloid leukemia blasts. Cancer Res. 61:1747.[Abstract/Free Full Text]
  39. Sherman, M. A., V. H. Secor, S. K. Lee, R. D. Lopez, M. A. Brown. 1999. STAT6-independent production of IL-4 by mast cells. Eur. J. Immunol. 29:1235.[Medline]
  40. Tara, D., D. L. Weiss, M. A. Brown. 1995. Characterization of the constitutive and inducible components of a T cell IL-4 activation responsive element. J. Immunol. 154:4592.[Abstract]
  41. Weiss, D. L., J. Hural, D. Tara, L. A. Timmerman, G. Henkel, M. A. Brown. 1996. Nuclear factor of activated T cells is associated with a mast cell interleukin 4 transcription complex. Mol. Cell. Biol. 16:228.[Abstract]
  42. Sherman, M. A., D. R. Powell, D. L. Weiss, M. A. Brown. 1999. NF-ATc isoforms are differentially expressed and regulated in murine T and mast cells. J. Immunol. 162:2820.[Abstract/Free Full Text]
  43. Sherman, M. A., T. Y. Nachman, M. A. Brown. 1999. Cutting edge: IL-4 production by mast cells does not require c-maf. J. Immunol. 163:1733.[Abstract/Free Full Text]
  44. Hural, J. A., M. Kwan, G. Henkel, M. B. Hock, M. A. Brown. 2000. An intron transcriptional enhancer element regulates IL-4 gene locus accessibility in mast cells. J. Immunol. 165:3239.[Abstract/Free Full Text]
  45. II Yeatman, C. F., S. M. Jacobs-Helber, P. Mirmonsef, S. R. Gillespie, L. A. Bouton, H. A. Collins, S. T. Sawyer, C. P. Shelburne, J. J. Ryan. 2000. Combined stimulation with the T helper cell type 2 cytokines interleukin (IL)-4 and IL-10 induces mouse mast cell apoptosis. J. Exp. Med. 192:1093.[Abstract/Free Full Text]
  46. Masuda, A., T. Matsuguchi, K. Yamaki, T. Hayakawa, Y. Yoshikai. 2001. Interleukin-15 prevents mouse mast cell apoptosis through STAT6- mediated Bcl-xL expression. J. Biol. Chem. 276:26107.[Abstract/Free Full Text]
  47. Zornig, M., A. Hueber, W. Baum, G. Evan. 2001. Apoptosis regulators and their role in tumorigenesis. Biochim. Biophys. Acta 1551:F1.[Medline]
  48. Freeman, J. G., J. J. Ryan, C. P. Shelburne, D. P. Bailey, L. A. Bouton, N. Narasimhachari, J. Domen, N. Simeon, F. Couderc, J. K. Stewart. 2001. Catecholamines in murine bone marrow derived mast cells. J. Neuroimmunol. 119:231.[Medline]
  49. Suzuki, K., H. Nakajima, N. Watanabe, S. Kagami, A. Suto, Y. Saito, T. Saito, I. Iwamoto. 2000. Role of common cytokine receptor {gamma} chain ({gamma}c)- and Jak3-dependent signaling in the proliferation and survival of murine mast cells. Blood 96:2172.[Abstract/Free Full Text]
  50. Masuda, A., T. Matsuguchi, K. Yamaki, T. Hayakawa, M. Kubo, W. J. LaRochelle, Y. Yoshikai. 2000. Interleukin-15 induces rapid tyrosine phosphorylation of STAT6 and the expression of interleukin-4 in mouse mast cells. J. Biol. Chem. 275:29331.[Abstract/Free Full Text]
  51. Brown, M. A., J. H. Pierce, C. J. Watson, J. Falco, J. N. Ihle, W. E. Paul. 1987. B cell stimulatory factor-1/interleukin-4 mRNA is expressed by normal and transformed mast cells. Cell 50:809.[Medline]
  52. Garren, H., P. J. Ruiz, T. A. Watkins, P. Fontoura, L. T. Nguyen, E. R. Estline, D. L. Hirschberg, L. Steinman. 2001. Combination of gene delivery and DNA vaccination to protect from and reverse Th1 autoimmune disease via deviation to the Th2 pathway. Immunity 15:15.[Medline]
  53. Wang, H. W., N. Tedla, A. R. Lloyd, D. Wakefield, P. H. McNeil. 1998. Mast cell activation and migration to lymph nodes during induction of an immune response in mice. J. Clin. Invest. 102:1617.[Medline]
  54. Mikita, T., D. Campbell, P. Wu, K. Williamson, U. Schindler. 1996. Requirements for interleukin-4-induced gene expression and functional characterization of Stat6. Mol. Cell. Biol. 16:5811.[Abstract]
  55. White, E. D., R. P. Andrews, G. K. Hershey. 2001. Sulfhydryl-2 domain-containing protein tyrosine phosphatase-1 is not a negative regulator of interleukin-4 signaling in murine mast cells. J. Leukocyte Biol. 69:825.[Abstract/Free Full Text]
  56. Schleimer, R. P., S. A. Sterbinsky, J. Kaiser, C. A. Bickel, D. A. Klunk, K. Tomioka, W. Newman, F. W. Luscinskas, Jr M. A. Gimbrone, B. W. McIntyre, et al 1992. IL-4 induces adherence of human eosinophils and basophils but not neutrophils to endothelium: association with expression of VCAM-1. J. Immunol. 148:1086.[Abstract]
  57. Nelms, K., A. D. Keegan, J. Zamorano, J. J. Ryan, W. E. Paul. 1999. The IL-4 receptor: signaling mechanisms and biologic functions. Annu. Rev. Immunol. 17:701.[Medline]
  58. Agarwal, S., A. Rao. 1998. Modulation of chromatin structure regulates cytokine gene expression during T cell differentiation. Immunity 9:765.[Medline]
  59. Avni, O., D. Lee, F. Macian, S. Szabo, L. Glimcher, A. Rao. 2002. Th cell differentiation is accompanied by dynamic changes in histone acetylation of cytokine genes. Nat. Immunol. 3:643.[Medline]
  60. Morris, S. C., W. C. Gause, F. D. Finkelman. 2000. IL-4 suppression of in vivo T cell activation and antibody production. J. Immunol. 164:1734.[Abstract/Free Full Text]
  61. Oskeritzian, C. A., Z. Wang, J. P. Kochan, M. Grimes, Z. Du, H. W. Chang, S. Grant, L. B. Schwartz. 1999. Recombinant human (rh)IL-4-mediated apoptosis and recombinant human IL-6-mediated protection of recombinant human stem cell factor-dependent human mast cells derived from cord blood mononuclear cell progenitors. J. Immunol. 163:5105.[Abstract/Free Full Text]
  62. Bischoff, S. C., G. Sellge, A. Lorentz, W. Sebald, R. Raab, M. P. Manns. 1999. IL-4 enhances proliferation and mediator release in mature human mast cells. Proc. Natl. Acad. Sci. USA 96:8080.[Abstract/Free Full Text]
  63. Vella, A., T. K. Teague, J. Ihle, J. Kappler, P. Marrack. 1997. Interleukin 4 (IL-4) or IL-7 prevents the death of resting T cells: Stat6 is probably not required for the effect of IL-4. J. Exp. Med. 186:325.[Abstract/Free Full Text]
  64. Zamorano, J., A. L. Mora, M. Boothby, A. D. Keegan. 2001. NF-{kappa}B activation plays an important role in the IL-4-induced protection from apoptosis. Int. Immunol. 13:1479.[Abstract/Free Full Text]
  65. Foote, L. C., R. G. Howard, A. Marshak-Rothstein, T. L. Rothstein. 1996. IL-4 induces Fas resistance in B cells. J. Immunol. 157:2749.[Abstract]
  66. Brunetti, M., N. Martelli, A. Colasante, M. Piantelli, P. Musiani, F. B. Aiello. 1995. Spontaneous and glucocorticoid-induced apoptosis in human mature T lymphocytes. Blood 86:4199.[Abstract/Free Full Text]
  67. Illera, V. A., C. E. Perandones, L. L. Stunz, Jr D. A. Mower, R. F. Ashman. 1993. Apoptosis in splenic B lymphocytes. Regulation by protein kinase C and IL-4. J. Immunol. 151:2965.[Abstract]
  68. Parry, S. L., J. Hasbold, M. Holman, G. G. Klaus. 1994. Hypercross-linking surface IgM or IgD receptors on mature B cells induces apoptosis that is reversed by costimulation with IL-4 and anti-CD40. J. Immunol. 152:2821.[Abstract]
  69. Zamorano, J., H. Y. Wang, L. M. Wang, J. H. Pierce, A. D. Keegan. 1996. IL-4 protects cells from apoptosis via the insulin receptor substrate pathway and a second independent signaling pathway. J. Immunol. 157:4926.[Abstract]
  70. Wurster, A. L., D. J. Withers, T. Uchida, M. F. White, M. J. Grusby. 2002. Stat6 and IRS-2 cooperate in interleukin 4 (IL-4)-induced proliferation and differentiation but are dispensable for IL-4-dependent rescue from apoptosis. Mol. Cell. Biol. 22:117.[Abstract/Free Full Text]
  71. Bischoff, S. C., G. Sellge, M. P. Manns, A. Lorentz. 2001. Interleukin-4 induces a switch of human intestinal mast cells from proinflammatory cells to Th2-type cells. Int. Arch. Allergy Immunol. 124:151.[Medline]
  72. Bovolenta, C., L. Testolin, L. Benussi, P. M. Lievens, E. Liboi. 1998. Positive selection of apoptosis-resistant cells correlates with activation of dominant-negative STAT5. J. Biol. Chem. 273:20779.[Abstract/Free Full Text]
  73. Xia, Z., S. N. Sait, M. R. Baer, M. Barcos, K. A. Donohue, D. Lawrence, L. A. Ford, A. M. Block, H. Baumann, M. Wetzler. 2001. Truncated STAT proteins are prevalent at relapse of acute myeloid leukemia. Leuk. Res. 25:473.[Medline]
  74. Suzuki, K., H. Nakajima, S. Kagami, A. Suto, K. Ikeda, K. Hirose, T. Hiwasa, K. Takeda, Y. Saito, S. Akira, I. Iwamoto. 2002. Proteolytic processing of Stat6 signaling in mast cells as a negative regulatory mechanism. J. Exp. Med. 196:27.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
Y. Huang, J. Qiu, S. Dong, M. S. Redell, V. Poli, M. A. Mancini, and D. J. Tweardy
Stat3 Isoforms, {alpha} and , Demonstrate Distinct Intracellular Dynamics with Prolonged Nuclear Retention of Stat3 Mapping to Its Unique C-terminal End
J. Biol. Chem., November 30, 2007; 282(48): 34958 - 34967.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. Zhao, P. Yin, L. A. Bach, and C. Duan
Several Acidic Amino Acids in the N-domain of Insulin-like Growth Factor-binding Protein-5 Are Important for Its Transactivation Activity
J. Biol. Chem., May 19, 2006; 281(20): 14184 - 14191.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. Zamorano, M. D. Rivas, F. Setien, and M. Perez-G
Proteolytic Regulation of Activated STAT6 by Calpains
J. Immunol., March 1, 2005; 174(5): 2843 - 2848.
[Abstract] [Full Text] [PDF]