|
|
||||||||
Pathway1
Department of Molecular Biology and Biochemistry, University of California, Irvine, CA 92697
| Abstract |
|---|
|
|
|---|
(GSK-3
), which
rephosphorylates NFAT and promotes nuclear export, is inhibited by EC
costimulation. GSK-3
is a component of the wnt signaling pathway,
and EC express wnt-5a and T cells express frizzled-5, a wnt-5a
receptor. Wnt-5a promotes T cell NFAT nuclear accumulation in the
presence of CsA, an effect mimicked by Li+, a potent
inhibitor of GSK-3
. The protein kinase C agonist PMA dramatically
synergizes with both EC and wnt-5a in stimulating T cell IL-2
synthesis, and inhibition of either protein kinase C by Ro-31-8425 or
G-proteins by pertussis toxin effectively blocks the actions of wnt-5a
on T cells. Finally, a secreted, dominant-negative form of frizzled-5
blocks EC-mediated CsA resistance. Thus, EC promote CsA-resistant
nuclear localization of NFAT and subsequent IL-2 synthesis through a
noncanonical wnt-dependent pathway. | Introduction |
|---|
|
|
|---|
T cell activation requires an Ag-specific signal mediated via the
TCR/CD3 complex, and non-Ag-specific signals provided by costimulatory
molecules such as CD2 and CD28. Upon receipt of these signals, a series
of intracellular events is triggered, including
Ca2+ mobilization and protein kinase C (PKC)
activation, leading to cytokine production and cell proliferation.
Critical to this process is the synthesis or translocation of several
transcription factors, including those of the AP-1, NF-
B, and NFAT
families. Members of the NFAT family preexist in the cytoplasm and,
upon activation, translocate to the nucleus where they act in synergy
with AP-1 and possibly other proteins (3, 4, 5, 6, 7) to
transactivate several cytokine and cell surface receptor genes,
including IL-2 (8), IL-4 (9, 10), TNF-
(11, 12), and CD40 ligand (13).
Members of the NFAT family are widely expressed by cells of the immune system; however, in normal human T cells, only NFAT1 (NFATp), NFAT2 (NFATc), and NFAT4 have been observed (14). NFAT1 is the predominant species in normal T cells and is constitutively expressed. NFAT4 is also present constitutively, but its expression is extremely low and is not enhanced upon stimulation. NFAT2 is induced following T cell stimulation to the same level as NFAT1; however, in nuclear extracts from activated T cells, nearly all the NFAT that bound to a probe corresponding to the distal NFAT site of the human IL-2 promoter was attributable to NFAT1 (14). In contrast to normal T cells, NFAT2 seems to play the major role in driving IL-2 transcription in Jurkat T cells (15).
The activity of NFAT proteins is regulated by their phosphorylation
state, which is controlled by the opposing action of the
Ca2+-dependent Ser/Thr phosphatase, calcineurin
(CaN), and the Ser/Thr kinase, glycogen synthase kinase-3
(GSK-3
). In resting T cells, NFAT is phosphorylated and localized to
the cytoplasm; upon cell stimulation, it is dephosphorylated by CaN,
resulting in nuclear translocation and enhanced DNA-binding affinity
(16, 17, 18). The activity of CaN is highly sensitive to the
immunosuppressive drugs CsA and FK506 (4, 18, 19, 20), which
act to prevent CaN-dependent nuclear translocation of NFAT. Nuclear
NFAT is rapidly rephosphorylated by a priming kinase and GSK-3
,
facilitating its rapid nuclear export (21). The activity
of GSK-3
is decreased following T cell activation with PMA
(22), or by activation of the phosphatidylinositol
3-kinase or wnt signaling pathways (23, 24, 25). Furthermore,
wnt signaling has been shown to activate NFAT in Xenopus
(26), and overexpression of a constitutively active form
of GSK-3
in mouse T cells results in reduced IL-2 synthesis and
proliferation (27). The duration of nuclear residence of
NFAT has been correlated with the pattern of cytokine expression in T
cells, suggesting that fine tuning of the pathways regulating this
transcription factor is critical for cell differentiation
(28).
Graft arteriosclerosis, the chronic inflammation of the vessels in transplanted organs (29, 30), has been attributed to presentation of allogeneic MHC molecules by graft EC to the host immune system (1). Interestingly, human EC can activate resting CD4+ T cells in culture and provide signals resulting in T cell resistance to CsA and FK506, suggesting a mechanism for bypassing immunosuppression in vivo (2, 31, 32). T cell resistance to CsA requires contact with EC and is dependent on EC expression of CD2 ligands (2). Although a combination of PMA and CD28 mAb has also been shown to induce CsA resistance in T cells (33, 34), CD28 ligands are not expressed by EC, and Abs or fusion proteins that block CD28, B7.1, and B7.2 do not block EC-mediated T cell CsA resistance (2). Interestingly, in T cells made resistant to CsA by PMA + CD28 mAb treatment, nuclear NFAT is still observed (14, 35).
In the present study, we asked the question whether T cell NFAT becomes
localized in the nucleus during EC-mediated CsA resistance, and if so,
by what mechanism. We find that in the presence of EC, neither CsA nor
a competitive CaN-blocking peptide are able to block the accumulation
of NFAT in the nucleus of activated T cells. Furthermore, the ability
of EC to induce T cell CsA resistance involves activation of the
wnt/GSK3-
pathway.
| Materials and Methods |
|---|
|
|
|---|
PHA, pertussis toxin, and CsA were from Sigma-Aldrich (St. Louis, MO). PMA, ionomycin, and Ro-31-8425 were from Calbiochem (La Jolla, CA). Abs to HLA-DR (HB145) and CD11b (HB204) were purified from culture supernatants of cells obtained from American Type Culture Collection (Rockville, MD). Polyclonal rabbit anti-NFATp (67.1) was a generous gift from Dr. A. Rao (Harvard Medical School, Boston, MA), and goat anti-rabbit IgG-FITC was from Sigma-Aldrich.
The NFAT "sprite" (SHPSPRIEITPSH) and control (SGSGSGPAIAIAPSH)
peptides were synthesized by Chiron Technologies (Melbourne,
Australia). Both were modified by an N-terminal acetylation and a
C-terminal amidation to prevent proteolytic degradation and extend
their intracellular half-lives. The hemagglutinin (HA)-tagged
GSK-3
expression plasmid was a kind gift from Dr. G. Crabtree
(Stanford University, Stanford, CA).
Cell isolation and culture
Human EC were isolated from umbilical veins and cultured as previously described on gelatin-coated tissue culture plastic in Medium 199 supplemented with 20% FBS, penicillin/streptomycin (all from Life Technologies, Grand Island, NY), endothelial cell growth supplement (Collaborative Biomedical, Bedford, MA), and heparin (Sigma-Aldrich; Ref. 36). EC were used between passages 3 and 5.
PBMC were obtained from heparinized venous blood by centrifugation over Lymphocyte Separation Medium (Organon Tecknika, Durham, NC). Purified T cells were isolated from PBMC by negative selection over magnetic beads (BioSource International, Camarillo, CA), using Abs to CD11b and HLA-DR. The purity of the T cell population was assessed by two-color FACS analysis using directly conjugated Abs to CD3, CD4, CD8, CD14, CD19, CD56, and HLA-DR (BD Biosciences, Mountain View, CA). Samples were analyzed on a FACSCalibur flow cytometer (BD Biosciences). We consistently obtained <2% B cells and monocytes, and >93% CD3+ T cells.
T cell coculture with EC or Chinese hamster ovary (CHO) cells
EC were plated and grown to confluence in gelatin-coated 96-, 24-, or 6-well plates, onto FBS-coated glass coverslips, or onto fibronectin-coated glass chamber slides (Fisher, Tustin, CA) and grown to confluence. CHO cells were plated in 24-well plates or on glass chamber slides and grown to confluence. Medium was removed and 14 x 105 or 510 x 106 resting T cells added in RPMI 1640 containing 10% FBS, penicillin/streptomycin (all from Life Technologies), and 50 µM 2-ME (Sigma-Aldrich). PHA, PMA, ionomycin, LiCl, and CsA were added as indicated. In some experiments, cells were transfected or pretreated with drug before coculture (see below).
At the times indicated, the cells were stained for NFAT or lysed for kinase assay, and/or the supernatants were assayed for IL-2 by bioassay using IL-2-dependent HT-2 cells as previously described (36). The ID50 values, which represent the CsA concentration that reduces IL-2 secretion to 50% of the level secreted in the absence of CsA, were determined as previously described (2).
Immunofluorescent staining
For NFAT staining, coverslips were gently washed to remove
nonadherent cells. Adherent cells were fixed with 4% paraformaldehyde
for 10 min, permeabilized for 10 min with 10x permeabilizing solution
(BD Biosciences), and then incubated 1 h with 67.1 (
NFAT1) or
normal rabbit serum diluted 1/1000 in PBS/1% BSA/1% goat serum. Ab
binding was visualized by a 30-min incubation with goat anti-rabbit
IgG-FITC (1/200 in PBS/1% BSA/1% goat serum). Coverslips were mounted
in Vectashield mounting medium (Vector Laboratories, Burlingame, CA),
and viewed by epifluorescence on a Zeiss Axiophot (Zeiss, Oberkochen,
Germany). Quantitative data were obtained by scoring cells in at
least five randomly chosen fields as nuclear or cytoplasmic for NFAT.
Photographs were shot on Kodak Ektachrome 400ASA (Kodak, Rochester, NY)
and the slides digitally scanned. Areas of interest were cropped
and the contrast adjusted using Adobe Photoshop (Adobe Systems,
Mountain View, CA). The images were not altered in any
other way.
PCR and cloning of wnt-5a and frizzled (Fz)-5
RNA from resting or activated T cells (1 x 107 cells) and EC (1 x 106 cells) was isolated using the TRIzol method (Life Technologies). cDNA was prepared from 2 µg of random-primed RNA using Superscript II RT (Life Technologies). Fz-5 was amplified using the following primers: fz-5 upper, GGGCCCGTTCGTGTGCAAGTGTCG, and fz-5 lower, GCAGGGCCCGTGGTCTCGTAGTGGA. Full-length wnt-5a was amplified by PCR using the primers: upper, 5'-CCCCAAGCTTAAGCCCAGGAGTTGC-3' and lower, 5'-CCGGGATTCACCCACTACTTGCACA-3', cloned into the HindIII and EcoRI sites of pcDNA-3.1(+) (Invitrogen, Carlsbad, CA), and confirmed by sequencing. For cloning of the Fz-5 extracellular domain (secreted Fz-5, sFz-5), pcDNA-3.1(+) was first modified to carry a FLAG tag by insertion of the FLAG sequence between the restriction enzyme Asp 718 and EcoRI sites. The extracellular domain was amplified by PCR using the primers: upper, 5'-TAGCTGCTAGCGGATTCCTCTGCCTGTGT-3' and lower, 5'-TAGCTAAGCTTCCAGAAGGTGGCGAA-3', cloned into the NheI and HindIII sites of the FLAG/pcDNA-3.1(+) vector and confirmed by sequencing. Expression of FLAG/sFz-5 was confirmed by Western blot. The PCR were conducted for 3540 cycles at an annealing temperature of 68°C for Fz-5, 59°C for wnt-5a, and 55°C for sFz-5. GAPDH was used as a positive control, and no-RT controls were run to confirm lack of genomic contamination.
Peptide delivery to resting T cells
Resting PBMC were loaded with 0.5 mM control or SPRIEIT peptide
by electroporation at 250 mV, 960 µF, and allowed to rest 1 h at
37°C before coculture. Electroporation did not significantly affect
cell viability as IL-2 production was reduced by <5% in cells
electroporated with control peptide compared with nonelectroporated
cells (data not shown). Using a FITC-labeled protein (Ig) as a marker,
we estimate that
50% of the cells are electroporated under these
conditions (data not shown).
Transfections
Transient transfections of EC or CHO cells were achieved using Lipofectamine (Life Technologies) or electroporation (EC). For transfection by Lipofectamine, EC were plated at 50% confluence and maintained without a change of medium for 4 days to synchronize the cells in G1; CHO cells were maintained in log phase growth. Cells were then trypsinized and replated at 40% confluence on 6-well plates with fresh growth medium. Twenty-six to 30 h later, cells were washed twice with serum-free medium and incubated with 1 µg of DNA in Optimem medium (Life Technologies). After 90 min at 37°C, cells were washed once and incubated overnight with EC or CHO growth medium. For electroporation of EC, cells were maintained in log phase growth. A total of 1 x 106 cells were suspended in 500 µl M199/5% FBS with 510 µg of DNA and pulsed once at 250 mV, 960 µF. Cotransfection with a green fluorescent protein plasmid showed typical transfection efficiencies of 1030% for Lipofectamine-transfected EC, and 5070% for CHO cells and electroporated EC.
Resting T cells were transfected using the Nucleofector system (Amaxa Biosystems, Germany), a modified form of electroporation that delivers the DNA directly into the nucleus. The procedure provided by the manufacturer was followed. Briefly, 5 x 106 T cells were suspended in 100 µl Human T Cell Nuleofector solution containing 5 µg DNA and pulsed once under program U-14. Typical transfection efficiencies were 3550%, as determined by cotransfection with a green fluorescent protein plasmid.
Kinase assay
For GSK-3
kinase assay, resting T cells were transfected with
an HA-tagged GSK-3
expression plasmid. Following treatment, cells
were collected and resuspended in lysis buffer (10 mM Tris-HCl (pH
7.4), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 20 µM NaF, 0.1 mM
Na3VO4, and protease
inhibitor mixture (Roche, Indianapolis, IN)). Lysates were precleared
with 75 µl protein A agarose (Sigma-Aldrich), then added to 75 µl
protein A agarose preincubated with anti-HA Ab. Following
incubation for 1 h at 4°C, the beads were pelleted and washed
once with lysis buffer and once with kinase assay buffer (8 mM MOPS (pH
7.4), 10 mM Mg acetate, and 2 mM EDTA). After washing, the beads were
resuspended in 40 µl kinase assay buffer containing 10 µCi
[
-32P]ATP, 125 µM unlabeled ATP, and 200
µM GSK-3
substrate or control peptide (Upstate Biotechnology, Lake
Placid, NY). Reactions were incubated for 30 min at 30°C and stopped
by pelleting and adding the supernatant to 20 µl of 40% TCA.
Reactions were spotted onto P-81 filters and washed three times with
0.75% H3PO4 and once with
acetone before quantitation by scintillation counting.
| Results |
|---|
|
|
|---|
CsA is a potent inhibitor of IL-2 synthesis, with a half maximal effect (ID50) of 13 ng/ml in most assays. However, T cells polyclonally activated in the presence of EC are largely resistant to CsA, the ID50 increasing 30- to 100-fold to 100300 ng/ml (2). Resistance is not due to either sequestration of CsA by EC or to degradation of CsA, as CsA preincubated with EC for 24 h is equally as effective as freshly prepared CsA (Ref. 2 and data not shown).
The major immunosuppressive action of CsA is to block cytokine
production by inhibiting nuclear translocation of the transcription
factor NFAT. Therefore, CsA-resistant IL-2 synthesis could be due to
mechanisms that circumvent the block imposed by CsA, thus allowing NFAT
translocation, or be due to the presence of redundantly acting
transcription factors compensating for the absence of nuclear NFAT. To
answer this question, we costimulated T cells with EC in the presence
or absence of CsA, and examined over time the location of NFAT and the
production of IL-2. Through the first 8 h, the T cells were
completely sensitive to CsA and no IL-2 was produced, regardless of the
presence or absence of EC (Fig. 1
a). However, between 8 and
12 h, T cells in the presence (but not the absence) of EC began to
develop resistance to the drug and started secreting IL-2. By 24 h
in the presence or absence of CsA, IL-2 levels had reached a plateau
which was maintained to at least 30 h (Fig. 1
a and data
not shown), suggesting that the lower levels seen in the presence of
CsA are not due simply to a delay in the onset of synthesis.
|
These data indicate that in the presence of CsA, NFAT can still enter the nucleus of T cells costimulated with EC, and that the time course of its accumulation in the nucleus correlates well with the induction of IL-2 secretion between 8 and 12 h.
EC also provide resistance to a CaN-blocking peptide
When introduced into T cells, the 7-aa peptide
110SPRIEIT (sprite), contained in the regulatory
domain of NFAT1, blocks recognition and dephosphorylation of NFAT1 by
CaN and subsequent nuclear localization (37). This
sequence is conserved in NFAT2, and a similar sequence is present in
NFAT3 and NFAT4. T cells were transfected with SPRIEIT or control
peptide and examined for NFAT localization and IL-2 secretion following
12 h of stimulation in the presence or absence of EC. Peptides
were protected from degradation by N- and C-terminal blocking (see
Materials and Methods). In the absence of EC, the SPRIEIT
peptide reduced IL-2 secretion by 45% relative to control peptide
(Fig. 2
), and NFAT translocation by 41%
(data not shown). Because our transfection efficiency was
50% (data
not shown), this corresponds to inhibition of IL-2 secretion by
transfected cells of >90%. In the presence of CsA, no IL-2 was
detectable. In contrast, in the presence of EC, T cells were completely
resistant to the effects of SPRIEIT peptide, and were mostly resistant
to CsA inhibition; IL-2 secretion was only blocked by 27%. In summary,
the presence of EC permits IL-2 secretion when CaN-mediated NFAT
translocation is blocked by three different methods: CsA, the SPRIEIT
peptide, and FK506 (2).
|
There is now good evidence that phosphatases other than CaN are also
critical for induction of IL-2 synthesis, as okadaic acid (OA), which
blocks Ser/Thr phosphatases such as PP1, PP2A, and PP5, blocks
activation of IL-2 transcription (39). This pathway
appears to be independent of CaN, which is not blocked by OA, but
presumably also targets NFAT, as activity of an NFAT reporter was
completely inhibited by OA (39). We reasoned that if NFAT
export from the nucleus were blocked, then slow nuclear accumulation of
NFAT under the influence of these phosphatases could account for
CsA-resistant cytokine synthesis. This could be achieved by inhibition
of GSK-3
activity, possibly by EC activation of the wnt pathway in T
cells.
As a first test of this hypothesis, we activated T cells in the
presence of CsA and tested the ability of Li+, a
potent GSK-3
inhibitor (40), to abrogate inhibition of
IL-2 synthesis by CsA. Treatment of T cells with CsA blocked IL-2
secretion by >95%. This effect was reversed by
Li+, which reduced the ability of CsA to inhibit
IL-2 synthesis from 95% to
50% (Fig. 3
a). Although EC act as
costimulatory cells, greatly enhancing IL-2 production, their ability
to block the effect of CsA was similar to that of
Li+. In the presence of EC, CsA inhibited IL-2
secretion by 31%, compared with 50% in the presence of
Li+, and >95% when neither EC nor
Li+ were present. Interestingly, there was no
additional effect of EC and Li+ (data not shown).
We found a similar effect of Li+ on NFAT
localization. T cells activated in the presence of CsA exhibited a 30%
reduction in nuclear localization of NFAT when
Li+ was also present, compared with a 90%
reduction in the absence of Li+ (Fig. 3
b). Thus, Li+ maintains NFAT in the
nucleus and induces resistance to CsA. Augmentation of IL-2 synthesis
by Li+ was recently reported
(27).
|
activity in T cells. It was
not possible to measure endogenous GSK-3
in T cells due to the
difficulty in separating EC and activated T cells. EC contain 10- to
20-fold more GSK-3
activity than T cells (data not shown) resulting
in uninterpretable data with as little as 5% EC contamination of the T
cell preparation. Therefore, T cells were transfected with an HA-tagged
GSK-3
expression plasmid and incubated 4 h in the presence or
absence of EC. Tagged GSK-3
was then immunoprecipitated with
anti-HA, and its activity assessed by kinase assay. As shown in
Table I
activity was inhibited
by 3070% in the presence of EC, demonstrating that T cell GSK-3
is regulated by EC costimulatory signals.
|
is a downstream target of the wnt signaling
pathway. It has been reported that EC express several wnts, including
wnt-5a (41). Using RT-PCR, we have confirmed expression of
wnt-5a by both resting and cytokine-activated EC, and demonstrated
expression of Fz-5, a receptor for wnt-5a (42), in T cells
activated with PMA + ionomycin or EC + PHA (Fig. 4
|
Wnt-5a has been reported to act primarily through PKC and
Ca2+, rather than by stabilization of
-catenin
(43, 44, 45), and GSK-3
is a direct downstream target of
PKC (23, 46). Moreover, PKC stimulation of the
wnt/adenomatous polyposis coli/
-catenin proliferative signaling
pathway has been demonstrated in vivo (47). Previously, we
had noted that chronic pretreatment of T cells with 2550 ng/ml of the
PKC activator PMA made the T cells largely refractory to subsequent EC
costimulatory signals, presumably due to down-regulation of the enzyme
(Refs. 48 and 49 , and our unpublished
observations). Addition of the specific PKC inhibitor Ro-31-8425
to cocultures resulted in the complete inhibition of T cell IL-2
synthesis, making it impossible to assess the contribution of EC
costimulation through this pathway (data not shown). Therefore, we
looked for synergy between EC and PMA. We examined the ability of EC to
enhance IL-2 secretion by T cells stimulated for 24 h over a range
of PMA concentrations, with ionomycin held constant at 1 µg/ml. EC
modestly enhanced IL-2 secretion at all PMA concentrations above 0.05
ng/ml, but with a particularly striking effect at 0.2 ng/ml (Fig. 5
). This result has been entirely
reproducible between 0.2 and 0.4 ng/ml over a series of six
experiments, and suggests that T cell PKC is indeed a target of EC
costimulation. We believe that the absence of a similarly high degree
of synergy at increased PMA concentrations, those typically used to
activate T cells, reflects the occurrence of PMA-induced PKC
down-regulation (48, 49).
|
|
The noncanoncial wnts, those that do not act through
-catenin,
have been shown to target PKC and to require G-protein activity
(43, 44, 45, 50). We further investigated the involvement of a
noncanonical wnt pathway by examining the effect of PKC or G-protein
inhibition on the ability of wnt-5a to potentiate nuclear accumulation
of NFAT in the presence of CsA. Again, ionomycin was used to drive NFAT
into the nucleus. In the presence of wnt-5a signaling, 45% of T cells
stimulated with ionomycin exhibit CsA-resistant nuclear localization of
NFAT, compared with only 1.5% in the absence of wnt-5a (Fig. 7
). However, when PKC activity was
inhibited by the addition of Ro-31-8425, or by prolonged pretreatment
of the T cells with PMA, this effect of wnt-5a was almost completely
abrogated. The addition of pertussis toxin, which blocks both G
- and
G
-mediated signaling by targeting G
o and
G
i subunits, also dramatically inhibited
CsA-resistant nuclear localization of NFAT in the presence of wnt-5a.
These data are entirely consistent with previous reports of
noncanonical wnts, such as wnt-5a, acting through PKC and G-proteins,
and moreover, support the hypothesis that EC-derived wnts may activate
this pathway in T cells.
|
3040 ng/ml. A
blocking Ab to Fz5 failed to reduce the ID50,
suggesting that wnt-5a does not mediate CsA resistance through Fz-5;
however, its ability to bind Fz-5 allows the soluble receptor to
effectively prevent wnt-5a from signaling through the appropriate
receptor (data not shown). Therefore, these data confirm that wnt
signaling is both necessary and sufficient for EC-mediated T cell
resistance to CsA, although contributions from additional pathways have
not been ruled out.
|
| Discussion |
|---|
|
|
|---|
There is now compelling evidence that GSK-3
regulates NFAT nuclear
localization. Direct phosphorylation of NFAT by GSK-3
has been shown
(21), and it was recently demonstrated that
Li+, a potent inhibitor of GSK-3
activity,
increases the level of nuclear NFAT and prolongs IL-2 synthesis
(27). We find that both EC and Li+
inhibit GSK-3
activity and allow nuclear accumulation of
NFAT, and IL-2 synthesis, in the presence of CsA. EC reduce GSK-3
activity by 3070% (Table I
), similar to the 6070% reduction we
see with Li+ (data not shown).
Li+ has previously been shown in NT2N neurons to
reduce GSK-3
activity by up to 80% (51). Therefore,
these data implicate GSK-3
in CsA resistance. Numerous previous
studies have demonstrated GSK-3
inactivation in response to wnts
(23, 25, 45). We used several approaches to test the
importance of the wnt pathway in CsA resistance, and find that wnt-5a
is both expressed by EC and can stimulate NFAT nuclear accumulation in
the presence of CsA. Moreover, we provide data suggesting that, in our
system, it is activation of the noncanonical wnt pathway in T cells
that is responsible for the regulation of NFAT localization.
Our data support a model (Fig. 9
) in
which NFAT slowly accumulates in the nucleus under the influence of
phosphatases not sensitive to CsA. The presumably weaker activity of
these phosphatases toward NFAT compared with CaN may explain the delay
in onset of resistance to CsA. We have confirmed the importance of
OA-sensitive phosphatases in T cell activation (data not shown),
although their specific targets are still to be determined. In this
model, NFAT is subsequently maintained in the nucleus due to an
inhibition of GSK-3
activity as a result of EC-derived wnt
signaling. The reduction in CsA-resistant IL-2 synthesis in the
presence of a dominant-negative Fz receptor is strong evidence
suggesting the important role of endogenous wnt signaling in the
generation of resistance in this system.
|
-catenin, pathway (reviewed
in Ref. 45). This regulates many developmental processes,
including body patterning, and involves a multiprotein complex
containing axin and dishevelled that targets the LEF/TCF transcription
factor family. The planar cell polarity pathway was first revealed in
Drosophila, and likewise involves dishevelled; however, the
major downstream target appears to be the c-Jun N-terminal kinase
pathway (52). Recently, a third pathway has
emerged, mostly studied in Xenopus, that is triggered by
noncanonical wnts and involves activation of G-proteins and PKC
(43, 44, 45, 53). There is also good in vitro and in vivo
evidence that PKC can directly target GSK-3
, leading to inactivation
(23, 46, 47). Our data strongly suggest a role for this
third pathway in the generation of T cell resistance to CsA.
Interestingly, NFAT was recently shown to be a wnt target in
Xenopus, where noncanonical wnt signaling leads to elevated
Ca2+ levels and CaN activation (26).
Therefore, it is possible that NFAT may be regulated by wnts in T cells
through two distinct mechanismsup-regulation of CaN activity and
down-regulation of GSK-3
activity. However, this
Ca2+-dependent pathway is unlikely to account for
CsA resistance as it involves activation of CaNthe CsA target.
Currently, we cannot say which wnt and Fz pair is most important for mediating resistance. Fz receptors are promiscuous, binding more than one wnt; and the wnts, likewise, can bind to more than one receptor. Wnt-5a can mediate CsA-resistant NFAT nuclear accumulation, and sFz-5 can inhibit CsA-resistant IL-2 synthesis, but a blocking Ab to Fz-5 cannot. This suggests that an alternative Fz that also binds wnt-5a may be involved (54). Only the development of new reagents and the definition of physiologic receptor-ligand pairings will answer this question definitively.
Very little is known about the role of wnt signaling in the immune
system. A recent report described a role for wnts in regulating mouse B
lymphocyte proliferation, although the Fz receptor mediating the effect
was not identified (55). Wnts have also been implicated in
human hematopoiesis, where wnts-5a, -2b, and -10b were shown to enhance
the proliferation of progenitor cells (56) and in
thymocyte development, where wnt activation of
-catenin was observed
(57). Again, the Fz receptors were not identified.
Interestingly, although much work has been done on LEF/TCF in T cells
and the role of
-catenin in modulating the activities of these
transcription factors, the receptors and ligands upstream of
-catenin have not been extensively studied.
Ghosh et al. (35) demonstrated that CsA-resistant IL-2
synthesis in response to PMA + CD28 mAb stimulation also involved NFAT
translocation. Human EC do not express ligands for CD28, but do appear
to target a PKC-dependent pathway (Fig. 5
) and presumably provide
other, necessary signals that allow for full T cell activation and IL-2
synthesis. It is possible that the combination of PMA and CD28 also
targets GSK-3
for down-regulation. We have previously demonstrated
that EC do not merely degrade CsA and that EC-T cell contact is
required for CsA-resistant IL-2 synthesis (32).
The chronic immune inflammation that is a hallmark of graft arteriosclerosis occurs in the presence of continued administration of CsA to patients. We have suggested that EC may be important initiators of graft arteriosclerosis in transplanted organs by presenting graft alloantigens to host T cells and inducing resistance to CsA (1, 58). In support of this, we have found that in SCID mice grafted with vascularized human skin, destruction of the human vasculature by cotransplanted allogeneic human T cells is not blocked by CsA (58); only a combination of CsA and rapamycin is protective. In this study, we present evidence that EC-mediated CsA resistance can be induced by wnt signaling; however, we have no evidence that this pathway is active during Ag presentation by classical APC. Indeed, activation of T cells by peripheral blood adherent cells, which are mostly monocyte/macrophages, does not induce resistance to CsA (2). Rather, we suggest that in the unique setting of a vascularized transplant, where the patient is receiving CsA or FK506 immunosuppression, the ability of EC-derived wnt signaling to affect NFAT localization may have profound consequences on local T cell activation and graft survival.
| Acknowledgments |
|---|
kinase assays. | Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Christopher C. W. Hughes, Department of Molecular Biology and Biochemistry, University of California, 3205 McGaugh Hall, Irvine, CA 92697. E-mail address: cchughes{at}uci.edu ![]()
3 Abbreviations used in this paper: CsA, cyclosporin A; EC, endothelial cell; CaN, calcineurin; GSK-3
, glycogen synthase kinase-3
; PKC, protein kinase C; OA, okadaic acid; CHO, Chinese hamster ovary; Fz, frizzled; sFz-5, secreted sFz-5; HA, hemagglutinin; CRD, cysteine-rich domain. ![]()
Received for publication August 17, 2001. Accepted for publication July 31, 2002.
| References |
|---|
|
|
|---|
gene promoter. J. Exp. Med. 178:1365.
gene transcription. J. Biol. Chem. 269:30445.
-catenin. Curr. Biol. 8:591.[Medline]
-catenin involves two interactive components: glycogen synthase kinase-3
inhibition and activation of protein kinase C. J. Biol. Chem. 275:17894.
-catenin and wnt/Ca2+ pathways. Oncogene 18:7860.[Medline]
by protein kinase C isotypes. J. Biol. Chem. 267:16878.
II induces colonic hyperproliferation and increased sensitivity to colon carcinogenesis. J. Cell Biol. 145:699.
phosphorylation by inhibition of glycogen synthase kinase-3. J. Biol. Chem. 272:25326.This article has been cited by other articles:
![]() |
M. Sen and G. Ghosh Transcriptional Outcome of Wnt-Frizzled Signal Transduction in Inflammation: Evolving Concepts J. Immunol., October 1, 2008; 181(7): 4441 - 4445. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. J. van der Velden, A. M. W. J. Schols, J. Willems, M. C. J. M. Kelders, and R. C. J. Langen Glycogen Synthase Kinase 3 Suppresses Myogenic Differentiation through Negative Regulation of NFATc3 J. Biol. Chem., January 4, 2008; 283(1): 358 - 366. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Dissanayake, M. Wade, C. E. Johnson, M. P. O'Connell, P. D. Leotlela, A. D. French, K. V. Shah, K. J. Hewitt, D. T. Rosenthal, F. E. Indig, et al. The Wnt5A/Protein Kinase C Pathway Mediates Motility in Melanoma Cells via the Inhibition of Metastasis Suppressors and Initiation of an Epithelial to Mesenchymal Transition J. Biol. Chem., June 8, 2007; 282(23): 17259 - 17271. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Tellides and J. S. Pober Interferon-{gamma} Axis in Graft Arteriosclerosis Circ. Res., March 16, 2007; 100(5): 622 - 632. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-S. Shi, N.-N. Huang, K. Harrison, S.-B. Han, and J. H. Kehrl The Mitogen-Activated Protein Kinase Kinase Kinase Kinase GCKR Positively Regulates Canonical and Noncanonical Wnt Signaling in B Lymphocytes. Mol. Cell. Biol., September 1, 2006; 26(17): 6511 - 6521. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dejmek, A. Safholm, C. Kamp Nielsen, T. Andersson, and K. Leandersson Wnt-5a/Ca2+-Induced NFAT Activity Is Counteracted by Wnt-5a/Yes-Cdc42-Casein Kinase 1{alpha} Signaling in Human Mammary Epithelial Cells. Mol. Cell. Biol., August 1, 2006; 26(16): 6024 - 6036. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Blumenthal, S. Ehlers, J. Lauber, J. Buer, C. Lange, T. Goldmann, H. Heine, E. Brandt, and N. Reiling The Wingless homolog WNT5A and its receptor Frizzled-5 regulate inflammatory responses of human mononuclear cells induced by microbial stimulation Blood, August 1, 2006; 108(3): 965 - 973. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wittmann, C. Killig, M. Bruder, R. Gutzmer, and T. Werfel Critical involvement of IL-12 in IFN-{gamma} induction by calcineurin antagonists in activated human lymphocytes J. Leukoc. Biol., July 1, 2006; 80(1): 75 - 86. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Reinhold, R. M. Kapadia, Z. Liao, and M. C. Naski The Wnt-inducible Transcription Factor Twist1 Inhibits Chondrogenesis J. Biol. Chem., January 20, 2006; 281(3): 1381 - 1388. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Choi, J. Walker, K. Talbert-Slagle, P. Wright, J. S. Pober, and L. Alexander Endothelial Cells Promote Human Immunodeficiency Virus Replication in Nondividing Memory T Cells via Nef-, Vpr-, and T-Cell Receptor-Dependent Activation of NFAT J. Virol., September 1, 2005; 79(17): 11194 - 11204. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wang, B. Lu, P. Wood, and R. D. Lund Grafting of ARPE-19 and Schwann Cells to the Subretinal Space in RCS Rats Invest. Ophthalmol. Vis. Sci., July 1, 2005; 46(7): 2552 - 2560. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. V. Komarova, A. Pereverzev, J. W. Shum, S. M. Sims, and S. J. Dixon Convergent signaling by acidosis and receptor activator of NF-{kappa}B ligand (RANKL) on the calcium/calcineurin/NFAT pathway in osteoclasts PNAS, February 15, 2005; 102(7): 2643 - 2648. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Puri, B. S. Magenheimer, R. L. Maser, E. M. Ryan, C. A. Zien, D. D. Walker, D. P. Wallace, S. J. Hempson, and J. P. Calvet Polycystin-1 Activates the Calcineurin/NFAT (Nuclear Factor of Activated T-cells) Signaling Pathway J. Biol. Chem., December 31, 2004; 279(53): 55455 - 55464. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kiani, I. Habermann, M. Haase, S. Feldmann, S. Boxberger, M. A. Sanchez-Fernandez, C. Thiede, M. Bornhauser, and G. Ehninger Expression and regulation of NFAT (nuclear factors of activated T cells) in human CD34+ cells: down-regulation upon myeloid differentiation J. Leukoc. Biol., November 1, 2004; 76(5): 1057 - 1065. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Liu, M. Holm, X.-Q. Xie, M. Wolf-Watz, and T. Grundstrom AML1/Runx1 Recruits Calcineurin to Regulate Granulocyte Macrophage Colony-stimulating Factor by Ets1 Activation J. Biol. Chem., July 9, 2004; 279(28): 29398 - 29408. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Lawrence, D. J. Keegan, E. M. Muir, P. J. Coffey, J. H. Rogers, M. J. Wilby, J. W. Fawcett, and R. D. Lund Transplantation of Schwann Cell Line Clones Secreting GDNF or BDNF into the Retinas of Dystrophic Royal College of Surgeons Rats Invest. Ophthalmol. Vis. Sci., January 1, 2004; 45(1): 267 - 274. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Gregory, H. Singh, A. S. Perry, and D. J. Prockop The Wnt Signaling Inhibitor Dickkopf-1 Is Required for Reentry into the Cell Cycle of Human Adult Stem Cells from Bone Marrow J. Biol. Chem., July 18, 2003; 278(30): 28067 - 28078. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Neal and N. A. Clipstone A Constitutively Active NFATc1 Mutant Induces a Transformed Phenotype in 3T3-L1 Fibroblasts J. Biol. Chem., May 2, 2003; 278(19): 17246 - 17254. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |