| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
B (RANK)/RANK Ligand Interactions: Impact on Tolerance Induction
Department of Inflammation, Immunex Corp., Seattle WA 98101
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B (RANK) and its cognate
ligand, RANKL, in vitro and in vivo. Our data show that although DC
isolated from mucosal lymphoid tissues expressed similar levels of
surface RANK compared with DC isolated from peripheral lymphoid
tissues, DC from the distinct anatomical sites displayed differential
responsiveness to RANK engagement with soluble RANKL. Whereas splenic
DC responded to RANKL stimulation with elevated IL-12 p40 mRNA
expression, Peyer’s patch DC instead preferentially displayed
increased IL-10 mRNA expression. Our data also show that the in vivo
functional capacity of mucosal DC can be modulated by RANKL. Treatment
with RANKL in vivo at the time of oral administration of soluble OVA
enhanced the induction of tolerance in two different mouse
models. These studies underscore the functional differences
between mucosal and peripheral DC and highlight a novel role for
RANK/RANKL interactions during the induction of mucosal immune
responses. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The structurally related proteins that comprise the TNF and TNF
receptor (TNFR) superfamilies mediate a number of important biological
activities, ranging from proliferation and differentiation to cell
survival and death (11, 12). An integral role for several
TNF/TNFR family members in DC biology has recently emerged. TNF and
CD40 ligand (CD40L) are both involved in the differentiation of DC from
CD34+ progenitor cells (13), and
CD40L plays a role in DC survival and can elicit DC cytokine production
(14). More recently, a new member of the TNFR family,
receptor activator of NF-B (RANK), and its ligand (RANKL; also known
as TNF-related activation-induced cytokine, osteoclast differentiation
factor, and osteoprotegrin ligand) have been cloned (15, 16). RANKL expression is restricted to T cells and lymphoid
tissues (15, 16). Similarly to CD40L, RANKL is reported to
increase the survival of bone marrow-derived DC in vitro by
up-regulating Bcl-xL expression (17)
and to enhance the ability of DC to stimulate naive T cell
proliferation in a mixed lymphocyte reaction (16, 18).
However, unlike CD40L, RANKL selectively acts on mature DC, but not B
cells (17). Splenic DC have been shown to express RANK
(16), and RANK mRNA is highly expressed in the intestine
(19), although which cells in the intestine express RANK
protein has not yet been determined.
In the present study we confirm that RANK is expressed on DC from the spleen (SPL), and now show that RANK is also expressed at a similar level on DC isolated from mucosal-associated lymphoid tissues (Peyer’s patch (PP) and mesenteric lymph node (MLN)). We have also discovered that engaging the RANK receptor on DC using soluble RANKL selectively increased IL-12 p40 expression in SPL DC as expected, but, surprisingly, did not alter IL-12 p40 expression in PP, MLN, or peripheral lymph node (PLN) DC. In contrast, exposure to RANKL increased the expression of IL-10 mRNA levels in PP DC, although IL-10 levels were not altered in MLN, SPL, or PLN DC. Using two different models of tolerance induced by feeding soluble OVA, the studies presented here highlight a novel functional role, in vivo, for RANK/RANKL interactions during the inductive phase of oral tolerance. We observed that mice treated with RANKL at the time of OVA feeding exhibited a more profound degree of tolerance than control untreated animals fed OVA. This was particularly evident in mice fed low doses of OVA, which were ineffective at inducing tolerance in control animals, but induced tolerance in RANKL-treated animals. These studies reveal the functional heterogeneity that exists between APC residing in distinct anatomical locations and provide important information pertinent to the design of immunotherapies or vaccines, particularly those targeted specifically to mucosal surfaces.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Female BALB/c mice (6–10 wk of age) were obtained from Taconic Farms (Germantown, NY) and maintained in a specific pathogen-free facility at Immunex in accordance with approved ethical guidelines. BALB/c DO11.10 OVA TCR transgenic (Tg) mice (20) were bred and maintained in the specific pathogen-free facility at Immunex.
Analysis of RANK expression on peripheral and gut-associated lymphoid tissues (GALT) DC using flow cytometry
SPL, PLN (two inguinal and popliteal lymph nodes per animal), MLN, and PP were removed from groups of five mice that had been injected i.p. daily for 10 days with 10 µg purified CHO-derived human Flt3 ligand (produced and purified at Immunex as previously described (21)), and single-cell suspensions were prepared. Previous studies have shown that Flt3 ligand (Flt3L) expands all DC populations without inducing their activation (2, 22). Cells were incubated for 40 min at 4°C with biotinylated anti-RANK Ab (clone M395; Immunex), together with FITC-labeled anti-CD11c (HL3, hamster IgG), both used at 10 µg/ml, in 50 µl blocking buffer (PBS containing 10 µg/ml anti-CD16 (BD PharMingen, San Diego, CA), 10% normal goat serum, 2% normal rabbit serum, and 2% normal rat serum). After being washed twice with PBS/2% FBS, cells were incubated with 10 µg/ml PE-labeled streptavidin (10 µg/ml; Molecular Probes, Eugene, OR) for an additional 20 min. Samples were washed three times, resuspended in PBS supplemented with 1% paraformaldehyde, and analyzed on a FACScan flow cytometer (BD Biosciences, San Jose, CA). At least 30,000 cells were analyzed per sample.
DC isolation and purification
Groups of 10 mice were injected daily with 10 µg Flt3L given
i.p. for 10 days to expand DC in vivo. The animals were sacrificed;
their SPL, PLN (two axillary, brachial, cervical, inguinal, and
popliteal lymph nodes per animal), MLN, and PP were removed; and
individual tissue types were pooled. Single-cell suspensions were
prepared by pressing the excised lymphoid tissues through nylon mesh.
The resultant suspension was then spun over a Nycodenz density gradient
(Nycomed Pharma, Oslo, Norway) at 1700 x g.
DC-enriched cell populations were harvested from the interface, washed,
and incubated with anti-mouse CD11c-coated magnetic beads for 20
min. After washing, CD11c+ cells were purified by
positive selection using MACS separation columns (Miltenyi Biotec,
Auburn, CA) according to the manufacturer’s instructions. In each of
three separate, independent experiments, the purified DC populations
were between 96 and 99% CD11c positive (Table I
).
|
Purified DC (3 x 105/well) were cultured for 18 h for RNA studies and for up to 120 h for DC survival studies in 96-well, flat-bottom, tissue culture plates in either complete RPMI (RPMI supplemented with 10% FBS, penicillin/streptomycin, L-glutamine, and 2-ME) or complete RPMI containing 10 µg/ml soluble murine RANKL-isoleucine zipper fusion protein, produced and purified at Immunex, in a total volume of 200 µl.
Isolation of RNA from DC cultures
RNA was prepared following homogenization of DC in guanidinium isothiocyanate buffer (4.5 M guanidinium isothiocyanate, 50 mM sodium citrate, 0.5% (w/v) sodium sarcosyl) containing 2% 2-ME (Life Technologies, Gaithersburg, MD). RNA was then extracted using acid phenol, as described previously (23). RNA samples were subsequently treated with DNase (DNA-free; Ambion, Austin, TX) to eliminate contaminating genomic DNA, and the resulting purified RNA samples were reverse transcribed to cDNA with random hexamers according to the manufacturer’s instructions (TaqMan Reverse Transcription Reagents; PerkinElmer, Boston, MA).
Primers and fluorogenic probes for real-time PCR
Oligonucleotide primers and TaqMan probes for murine IL-10,
IL-12 p40, and RANK were purchased from PerkinElmer. Primers and probes
for murine 
-actin and porphobilinogen deaminase (PBGD) were designed
using Primer Express software and were synthesized by PerkinElmer.
Forward primer, reverse primer, and probe sequences (5'-3') for
-actin (forward primer, TCCTTCGTTGCCGGTCCAC; reverse
primer, ACCAGCGCAGCGATATCGTC; probe, CCGCCACCAGTTCGCCATG) and PBGD
(forward primer, CTGGCCTACAGCGCATGG; reverse primer,
CATTCCTCTGGGTGCAAAATCT; probe, TGGCCCACCCGGTTCTGCCA) are shown in
parentheses.
Quantification of gene expression using real-time PCR
Levels of RANK, IL-10, and IL-12 p40 mRNA were determined by
TaqMan PCR analysis. Sequence-specific amplification of the genes of
interest was detected by an increased fluorescent signal of FAM
(reporter dye) during amplification. Murine -actin and PBGD were
used as endogenous controls in a multiplex TaqMan PCR (TaqMan Universal
PCR Master Mix; PE Biosystems, Foster City, CA) to allow for relative
mRNA quantification. Cytokine mRNA levels are presented as the
mean ± SD fold increase in gene expression observed in triplicate
wells of RANKL-treated DC relative to untreated DC and are
representative of data achieved in three separate, independent
experiments.
Assessment of oral tolerance in adoptive transfer mice
For adoptive transfer of OVA TCR Tg T cells, BALB/c mice were injected i.v. with 2.5 x 106 clonotypic TCR+ (CD4+KJ1.26+) Tg cells from DO11.10 mice, as previously described (2). Groups of three BALB/c mice were then treated with PBS or 10 µg/ml RANKL-isoleucine zipper fusion protein, given i.p. at -18, -3, and 0 h relative to OVA feeding. Mice were fed a single dose of 25 or 0.5 mg OVA in 0.2 ml saline, or saline only, 2 days after transfer of Tg T cells and were immunized s.c. in the footpad with 100 µg OVA in RIBI adjuvant (RIBI Immunochemicals, Hamilton, MT) 5 days later. After another 4 days, draining PLN were removed, and the Ag-specific proliferative capacity of the lymph node cells was examined by culturing the cells in complete RPMI medium at a density of 2 x 105 cells/well for 48–96 h. Cultures were performed in triplicate in 96-well flat-bottom plates in a total volume of 200 µl, either alone or in the presence of 1 or 0.3 mg/ml OVA. Proliferation was assessed by addition of 1 µCi/well [3H]thymidine (Amersham, Little Chalfont, U.K.) 18 h before harvesting. The amount of radioactivity incorporated into DNA was measured using a Matrix-96 cell harvester (Inotech, Lansing, MI) and a direct beta counter (Packard, Meridan, CT). In addition, the proportion of Tg T cells in adoptively transferred mice was determined by FACS analysis. Cells were incubated with mAb KJ1.26 FITC, which detects the clonotypic Tg TCR, and anti-CD4 PE (BD PharMingen) in 50 µl blocking buffer containing 10 µg/ml anti-CD16 (BD PharMingen), 10% normal goat serum, and 1% normal mouse serum and were analyzed on a FACScan (BD Biosciences) as described above.
Induction and assessment of conventional oral tolerance
BALB/c mice (six mice per group) were injected i.p. with PBS or 10 µg/ml RANKL, given at -18, -3, and 0 h relative to OVA feeding (given as a single dose of 0, 0.5, or 25 mg OVA in 0.2 ml saline by gavage). Ten days after OVA feeding, mice were immunized s.c. into the footpad with 100 µg OVA in 50 µl adjuvant (RIBI adjuvant). Twenty-one days after immunization, mice were assayed for systemic delayed-type hypersensitivity (DTH) responses by measuring the increase in footpad thickness 24 h after challenge with 100 µg heat-aggregated OVA in 50 µl saline as previously described (24). The mice were then sacrificed, and the draining PLN were removed for assessment of in vitro Ag-specific proliferative capability, as described above.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To determine expression levels of RANK on DC isolated from
peripheral and mucosal lymphoid tissues, DC were purified from SPL,
PLN, MLN, and PP of Flt3L-treated mice. RNA was then isolated, and
levels of RANK mRNA were measured using TaqMan Real-Time PCR. As shown
in Fig. 1A, RANK mRNA was
expressed at similar levels in DC isolated from each of these tissues.
To confirm these findings at the protein level, we also conducted flow
cytometric analysis to determine RANK expression on gated
CD11c+ SPL, MLN, and PP DC. Again, RANK was
detected at similar levels on each of these DC populations regardless
of the anatomical site (Fig. 1B). Although the level of
staining was low, the specificity of the FACS staining was confirmed by
cold competition with unlabeled anti-RANK mAb (data not shown).
|
Given the similar levels of RANK expression on DC from peripheral and mucosal lymphoid tissues, we next examined how DC isolated from each of these different anatomical compartments responded following RANK engagement. To examine the effect of RANK engagement on cytokine induction by each of these DC populations, DC were again purified from the SPL, PLN, MLN, and PP of Flt3L-treated mice and were incubated in the presence or the absence of soluble murine RANKL for 18 h. RNA was then isolated from the DC cultures, and levels of cytokine mRNA were measured using TaqMan real-time PCR.
Analysis of cytokine mRNA levels indicated that DC isolated from SPL,
PLN, MLN, and PP exhibited notably disparate gene expression profiles
for IL-10 and IL-12 p40 following RANKL stimulation (Fig. 2). While PLN, MLN, and PP-derived DC did
not show an appreciable difference in the levels of IL-12 p40 mRNA
after exposure to RANKL in vitro, expression of IL-12 p40 mRNA was
up-regulated several-fold in SPL DC. In contrast, whereas IL-10 mRNA
expression was not significantly altered in SPL, MLN, or PLN DC
following RANKL treatment, elevated IL-10 mRNA expression was observed
in RANKL-treated PP DC. Interestingly, IL-18 mRNA expression was
consistently down-regulated in SPL, MLN, and PP DC, but not in PLN DC,
following RANKL treatment in vitro (data not shown). Taken together,
these data suggest that DC isolated from different tissues behave
differently in response to stimulation with RANKL.
|
A), but no
increase in the survival of primary peripheral and mucosal DC was
observed (Fig. 3B).
|
We have recently highlighted a central role for DC as APC for oral tolerance induction (2, 10) and identified GALT as the inductive site for oral tolerance (25). Since we found that RANKL promoted increased expression of mRNA for the immunosuppressive cytokine IL-10 in PP DC, but not in DC from peripheral lymphoid tissues, we next wanted to determine whether RANK engagement in vivo could modulate the outcome of an immune response to orally administered soluble OVA.
We first used an adoptive transfer model in which OVA-specific Tg T
cells from D011.10 mice are transferred into normal unirradiated BALB/c
recipients and detected using the anti-clonotypic TCR mAb KJ1-26
(26). Previous studies have shown that the number of
OVA-specific Tg T cells detectable in draining lymph node (DLN) of
adoptively transferred mice is dramatically increased following
immunization (26). In contrast, when Ag is administered in
a tolerogenic manner such as by the oral route (27),
before immunization, the number of Tg T cells detectable in the DLN is
decreased, and these cells exhibit a reduced Ag-specific proliferative
capacity in vitro. As we have previously observed (2),
feeding OVA induced a dose-dependent reduction in the percentage (Fig. 4A), absolute number (Fig. 4B), and proliferative capacity (Fig. 4C) of Tg T
cells recovered from the DLN of adoptively transferred, immunized,
control (saline-injected) mice compared with saline fed mice. A single
low dose feeding of 0.5 mg OVA consistently promoted a small reduction
in Tg T cell numbers in control mice (Fig. 4, A and
B), but was consistently ineffective at reducing the
Ag-specific proliferative capacity of Tg T cells in vitro (Fig. 4C). A single high dose feeding of 25 mg OVA, in contrast,
promoted a much greater reduction in the percentage and absolute number
of Tg T cells detected in DLN (Fig. 4, A and B)
and dramatically reduced the Ag-specific proliferative capacity of
these Tg T cells (Fig. 4C).
|
A) and absolute number
(Fig. 4B) of Tg T cells compared with that seen in OVA-fed
mice that did not receive RANKL. However, the functional capacity of
DLN cells from RANKL-treated, OVA-fed mice was quite distinct from that
of cells from saline-treated, OVA-fed mice. This was particularly
evident at low doses of OVA, which were insufficient to induce
tolerance in saline-injected mice. Accordingly, DLN cells from
RANKL-treated mice fed low doses of OVA showed dramatically reduced
OVA-specific proliferation in vitro compared with cells from
saline-injected, OVA-fed mice (Fig. 4C). The markedly
reduced proliferation of DLN cells from RANKL-treated mice fed low dose
OVA resembled the diminished functional capacity of cells from
saline-injected mice fed high dose OVA (Fig. 4C). RANKL
treatment had little effect on the low levels of proliferation observed
at feeding a high dose OVA (Fig. 4C), most likely because
these levels were already maximally suppressed. Treatment with RANKL in vivo enhances tolerance in a conventional model of oral tolerance induction
The above findings led us to examine whether RANKL might also
modulate mucosal tolerance using a well-characterized, conventional
model of oral tolerance induction. Control (saline-injected) mice fed
soluble OVA before immunization with OVA plus adjuvant showed a
dose-dependent reduction in DTH and Ag-specific in vitro proliferative
responses (Fig. 5), as we have previously
described (2). Thus, while the DTH and proliferative
responses of control mice fed low dose OVA (0.5 mg) were essentially
normal (Fig. 5), control mice fed high dose OVA (25 mg), displayed
significantly suppressed in vivo and in vitro T cell responses (Fig. 5). The pattern of tolerance induced by feeding OVA to RANKL-treated
mice, was however, quite distinct from that observed in control OVA-fed
mice. RANKL-treated mice fed low dose OVA showed markedly suppressed
DTH and in vitro proliferative responses compared with equivalent
control mice fed this dose of Ag (Fig. 5), such that RANKL-treated mice
fed low dose OVA resembled control mice fed high dose OVA. RANKL had
less effect on the profound degree of tolerance exhibited in mice fed
high dose OVA. As such, RANKL-treated mice fed high dose OVA exhibited
the same markedly suppressed responses as saline-injected controls fed
high dose OVA (Fig. 5). Again, the fact that RANKL had little effect on
the suppressed responses observed in mice fed high dose OVA may be
attributed to the fact that these levels were already maximally
suppressed.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Previous studies that have examined the effect of RANKL on DC have indicated that RANKL can promote the survival of bone marrow-derived DC (18). Unlike bone marrow-derived DC, peripheral and mucosal DC do not appear to exhibit prolonged survival in response to RANKL treatment. Previous studies examining the effect of RANKL on DC have also shown that RANKL can enhance the allostimulatory capacity of splenic DC in MLR (16). Since RANKL does not increase levels of classical surface costimulatory molecules such as CD80, CD86, and ICAM-1 or MHC class I on splenic DC (17), the enhanced allostimulatory effects of RANKL on DC function are unlikely to be attributed to RANKL-induced alterations in DC surface phenotype. Rather, RANKL treatment of splenic DC has been shown to induce IL-12 expression (17). We therefore chose to focus our current studies on examining whether RANKL functions primarily to modulate this aspect of DC function, namely, cytokine expression. Analysis of cytokine mRNA levels by TaqMan real-time PCR revealed that while RANKL exposure increased IL-12 p40 mRNA expression in splenic DC, it had no effect on induction of IL-12 p40 mRNA in DC isolated from PLN, MLN, or PP. In contrast, RANKL selectively up-regulated IL-10 mRNA expression in PP DC, but not in splenic, PLN, or MLN DC. The fact that RANKL increased IL-10 mRNA in PP, but not MLN, DC points to differences in RANKL responsiveness within the mucosal DC compartment itself.
A topic of debate in the field of DC biology is the question of whether DC from different tissues behave similarly, or whether they are phenotypically and functionally distinct. Recent studies have suggested that PP and splenic DC may differ in terms of their cytokine profile and ability to induce the differentiation of distinct Th cell subsets (28). Our data suggest that DC from different anatomical sites may show even greater differences than anticipated. We found that although SPL, PLN, MLN, and PP DC exhibited comparable levels of surface RANK expression and similar survival patterns, these DC clearly displayed differential responsiveness to RANK engagement. While SPL DC responded to RANKL stimulation with elevated IL-12 p40 mRNA expression, PP DC instead preferentially displayed increased IL-10 mRNA expression. Previous studies performed using murine bone marrow-derived DC have demonstrated that RANK engagement using a recombinant TNF-related, activation-induced cytokine fusion protein also promoted increased IL-12 p40, but not IL-10, mRNA expression (29), suggesting that PP DC may be uniquely disposed to IL-10 production. Interestingly, it has recently been demonstrated that DC at another mucosal surface, the respiratory tract, may also mediate tolerance through induction of IL-10 (30).
The data presented here show that DC isolated from different sites respond differently to the same stimulus, in this case delivered by RANKL. This raises the question of whether DC localized in different tissues are congenitally different, or whether they become specialized in response to extrinsic factors in the local tissue microenvironment. To date it has not been possible to distinguish mucosal vs peripheral DC in terms of surface phenotype. However, this may simply reflect the lack of appropriate reagents available to make this distinction and is an important area for future studies. What relevance is there to the observed differential responsiveness of DC localized in GALT vs SPL? Studies in our own and other laboratories have shown that the inductive events leading to oral tolerance probably occur in the local GALT environment very early after Ag feeding (25). Furthermore, our studies support the idea that DC at these mucosal sites are involved in the presentation of orally encountered Ag to local T cell populations (2, 10, 25). In particular, we have observed that MLN and PP are the major sites of T cell reactivity following oral administration of Ag, and that the initial events associated with the induction of oral tolerance are heightened when increased numbers of DC are present at these sites (2). The present data show that DC localized in mucosal tissues respond to RANKL stimulation by up-regulating the expression of the suppressive cytokine, IL-10. This is likely to create a tolerogenic environment, conducive to promoting the T cell hyporesponsiveness normally observed in response to perorally administered soluble proteins. In agreement with this, our data indicate that RANKL-stimulated DC are functionally more efficient tolerogenic APC than unstimulated DC, and promote a greater level of oral tolerance than do their unstimulated counterparts. It is unlikely that the enhanced tolerance observed in RANKL-treated mice may be attributed to the previously described effect of RANKL as a DC survival factor (17, 29), since RANKL treatment did not appear to alter the survival of mucosal DC in vitro. DC are ostensibly the most potent APC and are described as professional APC, being equipped with all the necessary apparatus to promote active immune responses (1). Recently, we and others have expounded on the functionality of this cell type by demonstrating their ability to also behave as tolerogenic APC (3, 4, 5). An important issue that such studies have raised is the question of how can one cell type be concerned with the induction of both tolerance and active immunity, and when and how do DC decide to be tolerogenic vs immunogenic? We hypothesize that the location of the DC population may be an important determining factor. The intestine is constantly being challenged by both innocuous Ag, such as essential dietary proteins, and potentially harmful pathogens, such as Salmonella, Yersinia, and Shigella species. It is critical that the cellular components of the intestinal immune system be able to distinguish between these two different types of encounter and not mount inappropriate inflammatory responses to every antigenic challenge. We have previously shown that intestinal DC are specialized to carry out this dual functionality by employing tolerance as their default response to oral Ag, but that they can be converted into immunogenic APC upon activation with proinflammatory cytokines such as IL-1 (10) or, as others have demonstrated, when there is ongoing local inflammation (31, 32). The functional duality of intestinal APC and the regulatory processes that control it are paramount for maintaining health. The fact that transient food/cow’s milk protein intolerance is a common consequence of gastroenteritis is testament to the importance of intestinal immunoregulation. This report clearly shows that mucosal DC may be functionally distinct from peripheral DC, a finding with important biological implications for mucosal vaccine development. This study serves to highlight the differences between mucosal DC and peripheral DC and draws attention to the putative role of DC and expression of the DC molecule, RANK, in tolerogenic Ag presentation following soluble Ag feeding.
|
Footnotes |
|---|
2 Abbreviations used in this paper: DC, dendritic cells; CD40L, CD40 ligand; DLN, draining lymph node; DTH, delayed-type hypersensitivity; Flt3L, Flt3 ligand; GALT, gut-associated lymphoid tissues; MLN, mesenteric lymph node; PLN, peripheral lymph node; PP, Peyer’s patch; RANK, receptor activator of NF-B; RANKL, RANK ligand; SPL, spleen; Tg, transgenic; PBGD, porphobilinogen deaminase.
Received for publication December 11, 2001. Accepted for publication July 24, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. J. Exp. Med. 184:695.This article has been cited by other articles:
|
|
 |
|
  J. Lorenzo, M. Horowitz, and Y. Choi Osteoimmunology: Interactions of the Bone and Immune System Endocr. Rev., June 1, 2008; 29(4): 403 - 440. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. N. Samsom, A. P. J. van der Marel, L. A. van Berkel, J. M. L. M. van Helvoort, Y. Simons-Oosterhuis, W. Jansen, M. Greuter, R. L. H. Nelissen, C. M. L. Meeuwisse, E. E. S. Nieuwenhuis, et al. Secretory Leukoprotease Inhibitor in Mucosal Lymph Node Dendritic Cells Regulates the Threshold for Mucosal Tolerance J. Immunol., November 15, 2007; 179(10): 6588 - 6595. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. T. Taylor, S. R. Patel, E. Lin, B. R. Butler, J. G. Lake, R. D. Newberry, and I. R. Williams Lymphotoxin-Independent Expression of TNF-Related Activation-Induced Cytokine by Stromal Cells in Cryptopatches, Isolated Lymphoid Follicles, and Peyer's Patches J. Immunol., May 1, 2007; 178(9): 5659 - 5667. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Corthesy, H. R. Gaskins, and A. Mercenier Cross-Talk between Probiotic Bacteria and the Host Immune System J. Nutr., March 1, 2007; 137(3): 781S - 790S. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Corthesy Roundtrip Ticket for Secretory IgA: Role in Mucosal Homeostasis? J. Immunol., January 1, 2007; 178(1): 27 - 32. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.W. Cutler and R. Jotwani Dendritic cells at the oral mucosal interface. J. Dent. Res., August 1, 2006; 85(8): 678 - 689. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Miyahira, Y. Takashima, S. Kobayashi, Y. Matsumoto, T. Takeuchi, M. Ohyanagi-Hara, A. Yoshida, A. Ohwada, H. Akiba, H. Yagita, et al. Immune Responses against a Single CD8+-T-Cell Epitope Induced by Virus Vector Vaccination Can Successfully Control Trypanosoma cruzi Infection Infect. Immun., November 1, 2005; 73(11): 7356 - 7365. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Favre, F. Spertini, and B. Corthesy Secretory IgA Possesses Intrinsic Modulatory Properties Stimulating Mucosal and Systemic Immune Responses J. Immunol., September 1, 2005; 175(5): 2793 - 2800. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. N. Samsom, L. A. van Berkel, J. M. L. M. van Helvoort, W. W. J. Unger, W. Jansen, T. Thepen, R. E. Mebius, S. S. Verbeek, and G. Kraal Fc{gamma}RIIB Regulates Nasal and Oral Tolerance: A Role for Dendritic Cells J. Immunol., May 1, 2005; 174(9): 5279 - 5287. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A L Hart, K Lammers, P Brigidi, B Vitali, F Rizzello, P Gionchetti, M Campieri, M A Kamm, S C Knight, and A J Stagg Modulation of human dendritic cell phenotype and function by probiotic bacteria Gut, November 1, 2004; 53(11): 1602 - 1609. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Vidal, P. Serrant, B. Schlosser, P. van den Broek, F. Lorget, and A. Donnet-Hughes Osteoprotegerin production by human intestinal epithelial cells: a potential regulator of mucosal immune responses Am J Physiol Gastrointest Liver Physiol, October 1, 2004; 287(4): G836 - G844. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Epardaud, M. Bonneau, F. Payot, C. Cordier, J. Megret, C. Howard, and I. Schwartz-Cornil Enrichment for a CD26hi SIRP- subset in lymph dendritic cells from the upper aero-digestive tract J. Leukoc. Biol., September 1, 2004; 76(3): 553 - 561. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T W Spahn and T Kucharzik Modulating the intestinal immune system: the role of lymphotoxin and GALT organs Gut, March 1, 2004; 53(3): 456 - 465. [Full Text] [PDF]
|
|
|
|
|
|
W. W. J. Unger, F. Hauet-Broere, W. Jansen, L. A. van Berkel, G. Kraal, and J. N. Samsom Early Events in Peripheral Regulatory T Cell Induction via the Nasal Mucosa J. Immunol., November 1, 2003; 171(9): 4592 - 4603. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A J Stagg, A L Hart, S C Knight, and M A Kamm The dendritic cell: its role in intestinal inflammation and relationship with gut bacteria Gut, October 1, 2003; 52(10): 1522 - 1529. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
cycle threshold (
