HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Strengell, M. Articles by Matikainen, S. Search for Related Content PubMed PubMed Citation Articles by Strengell, M. Articles by Matikainen, S. Pubmed/NCBI databases Gene GEO Profiles HomoloGene Protein UniGene Compound via MeSH Substance via MeSH Medline Plus Health Information Dietary Proteins Genetics Home Reference Hazardous Substances DB L-TYROSINE

IL-21 Up-Regulates the Expression of Genes Associated with Innate Immunity and Th1 Response¹

Mari Strengell^2,*, Timo Sareneva^*, Don Foster, Ilkka Julkunen^* and Sampsa Matikainen^*

^* Department of Microbiology, National Public Health Institute, Helsinki, Finland; and Department of Functional Cloning, ZymoGenetics, Seattle, WA 98102

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
IL-21 is a recently characterized T cell-derived cytokine that regulates NK and T cell function. IL-21R shares the common -chain (_c) with the receptors for IL-2, IL-4, IL-7, IL-9, and IL-15. Despite the same _c, these cytokines have different effects on diverse cells. In this study, we have studied IL-15- and IL-21-induced gene expression in human primary NK and T cells and the NK-92 cell line. Both IL-15 and IL-21 rapidly induced mRNA synthesis for IFN-, T-bet, IL-2R, IL-12R2, IL-18R, and myeloid differentiation factor 88 (MyD88), the genes that are important in activating innate immunity and Th1 response. IL-15 induced STAT5 DNA binding to the IL-2R IFN--activated sequence (GAS), MyD88 GAS, and c-sis-inducible elements, whereas IL-21 induced STAT3 DNA binding to MyD88 GAS and c-sis-inducible elements. IL-21-induced STAT3 activation was verified by immunoprecipitation and Western blotting with anti-phosphotyrosine Ab. In addition, pretreatment of NK-92 cells with IL-15 or IL-21 strongly enhanced IL-12-induced STAT4 DNA binding to IL-2R GAS. The induction of IFN-, T-bet, IL-12R2, and IL-18R gene expression in NK cells, along with STAT3 activation, suggests that IL-21 is involved in the activation of innate immune responses. Moreover, the enhanced transcription of these genes in T cells establishes a significant role for IL-21 also in the Th1 response.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cytokines are a large and diverse group of molecules that mediate proliferation, differentiation, and survival in hemopoietic cells. Despite the heterogeneity of the members of the cytokine family, many of them have overlapping effects. This can be partly explained by the fact that the receptors for different cytokines often share the same receptor subunit. Recently, a novel cytokine, IL-21, was characterized (1). IL-21 is a T cell-derived cytokine that has important functions in NK and T cells. It enhances anti-CD3-induced proliferation of naive human T cells and activates STAT3 in the human T cell leukemia virus I-transformed human T cell line (1, 2). IL-21R, expressed on both NK and T cells (1), is related to IL-2R (3). It was recently shown that the common -chain (_c),³ shared by the receptors for IL-2, IL-4, IL-7, IL-9, and IL-15, is also the functional component of the IL-21R complex (2). Mice lacking the IL-2/IL-15R chain do not have NK and T cells. On the other hand, NK and T cell development is normal in mice lacking the IL-2 gene, suggesting that other cytokines using IL-2/IL-15R are important for the development of NK and T cells (4).

NK cells have a crucial role in innate immunity, especially against viral infections and in the control of tumor growth. NK cells exhibit cytotoxic activities toward cells with diminished expression of MHC class I molecules on their surface (5). Macrophage-derived cytokines IFN-, IL-12, and IL-18 enhance NK cell cytotoxicity and activate NK cells to produce IFN- and TNF- (6, 7, 8, 9, 10). NK cell-produced IFN- is involved in the polarization of Th cells toward the Th1 type. IL-12 is also required for the development of the Th1-type immune response (11) and it enhances IFN- production in NK and T cells, which further stimulates the capacity of macrophages and dendritic cells to carry out Ag presentation.

In the present work, we have studied IL-15- and IL-21-induced gene expression and signaling in human NK and T cells. We show that both IL-15 and IL-21 induce mRNA expression of IFN-, T-bet, IL-2R, IL-12R2, IL-18R, and myeloid differentiation factor 88 (MyD88) genes that are involved in innate immunity and the Th1 response. We also demonstrate that IL-21 preferentially activates STAT3, whereas IL-15 activates STAT5 both in NK and T cells. In addition, we show that priming of NK-92 cells with IL-15 or IL-21 enhances IL-12-induced STAT4 DNA binding, further suggesting that IL-15 and IL-21 promote the Th1 response.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Primary T cell culture

Leukocyte-rich buffy coats were obtained from healthy blood donors (Finnish Red Cross Blood Transfusion Service, Helsinki, Finland). Mononuclear cells were isolated from buffy coats by density gradient centrifugation using Ficoll-Paque (Amersham Pharmacia Biotech, Uppsala, Sweden). Monocytes were removed by adherence on plastic plates and nonadherent T cells were further purified through a nylon wool column. Purified T cells were activated with 0.5 µg/ml anti-CD3 and 0.5 µg/ml anti-CD28 mAbs (R&D Systems, Abingdon, U.K.) and cultured in RPMI 1640 medium supplemented with 10% FCS (Integro, Zaandam, The Netherlands), 20 mM HEPES, 2 mM L-glutamine, 0.6 µg/ml penicillin, 60 µg/ml streptomycin, and 100 IU/ml human rIL-2 (R&D Systems) for 5–6 days. T cells were then propagated for 5–6 days in RPMI 1640 supplemented with 100 IU/ml IL-2. In each experiment, T cells from two to four donors were used.

Enrichment of primary NK cells

Mononuclear cells were isolated by density gradient centrifugation as described above using Ficoll-Paque. NK cells were purified from nonadherent PBMCs through a nylon wool column and two-step density gradient centrifugation by Percoll (Amersham Pharmacia Biotech), and then followed by purification with immunomagnetic beads coated with anti-CD3, anti-CD14, and anti-CD19 Abs (Dynal, Oslo, Norway). As determined by flow cytometry with anti-CD16 or anti-CD56 Abs, NK cells were >90% pure.

NK cell line

A human NK-92 cell line (CRL-2407; American Type Culture Collection, Manassas, VA) was maintained in MEM medium (Life Technologies, Carlsbad, CA) supplemented with 12% horse serum (Life Technologies), 12% FCS, 0.2 mM i-inositol, 20 mM folic acid, 40 mM 2-ME, 2 mM L-glutamine, antibiotics, and 100 IU/ml IL-2.

Cell stimulation

Human rIL-21 (ZymoGenetics, Seattle, WA) was used at 10 ng/ml. Human rIL-15 (R&D Systems) was used at 5 ng/ml. Despite the fact that the cells presumably consumed all IL-2 from the media during propagation, the cells were cultured in IL-2-free RPMI 1640 for 1 h (primary T cells) or for 18 h (NK-92 cell line) before stimulation with IL-15 or IL-21.

RNA isolation and Northern blot analysis

Total cellular RNA was isolated as previously described (12). Total cellular RNA was quantified photometrically and the samples containing equal amounts of RNA (10 µg) were size fractionated on a 1.0% formaldehyde-agarose gel and transferred to a nylon membrane (Hybond; Amersham, Buckinghamshire, U. K.). The membrane was hybridized with the cDNA probes for human IFN- (13), T-bet, IL-2R, IL-12R2, IL-18R (14), IL-18R (15), and MyD88 (16). T-bet and IL-12R2 probes were cloned from total cellular RNA obtained from IL-15-, IL-18-, and IL-21-treated NK-92 cells by RT-PCR using oligonucleotides CCGCCTGGATCCAACTGTCAATTC (sense), ATCATGGGATCCGCTCAGTTGGGA (antisense), AGGGAAAAAGGATCCCAAGGTCAT (sense), and AGACCAACTCCCGGATCCTAAGAC (antisense), respectively. Ethidium bromide staining of ribosomal RNA bands was used to ensure equal RNA loading. The probes were labeled with [-³²P]dCTP (3000 Ci/mmol; Amersham) using a random primed DNA labeling kit (Boehringer Mannheim, Mannheim, Germany). The membranes were hybridized (Ultrahyb; Ambion, Austin, TX) and washed twice at 42°C and once at 60°C in 1x SSC/0.1% SDS for 30 min each time, and exposed to Kodak AR X-Omat films at -70°C using intensifying screens.

EMSA

Nuclear extracts and nuclear protein/DNA-binding reactions were performed as described previously (17, 18). IL-2R IFN--activated sequence (GAS), GAS-c/GAS-n, 5'-GATCTTTCTTCTAGGAAGTACCAAACATTTCTGATAATAGAA-3'; MyD88 GAS, 5'-GATCGGAGCTTCTCGGAAAGCGAAAGAAGGA-3'; and c-sis-inducible element (SIE), 5'-GATCGATCTAGGGATTTCCGGGAAATGAAGCT-3' oligonucleotides were purchased from DNA Technology (Aarhus, Denmark). The probes were labeled with [³²P]dATP by using Klenow polymerase. The protein/DNA-binding reaction was done at room temperature for 30 min and the samples were analyzed by electrophoresis on 6% nondenaturing low-ionic strength polyacrylamide gels in 0.25x Tris-borate-EDTA buffer. The gels were dried and visualized by autoradiography. Anti-STAT1 (sc-345X), anti-STAT3 (sc-482X), anti-STAT4 (sc-486X), and anti-STAT5b (sc-835X; recognizes both STAT5a and STAT5b) Abs were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

Antiphosphotyrosine analysis

Cytokine-stimulated cells were lysed in immunoprecipitation binding buffer (50 mM Tris (pH 7.4), containing 150 mM NaCl, 5 mM EDTA, and 1% Triton X-100) supplemented with protease inhibitors (Complete; Boehringer Mannheim) and 1 mM sodium orthovanadate. Cell lysates were immunoprecipitated on ice for 1 h with anti-Janus kinase (JAK) 1 (sc-295, Santa Cruz Biotechnology), anti-JAK3 (sc-513, Santa Cruz Biotechnology), anti-STAT3, or anti-STAT5b Abs. The proteins were separated on 8 or 10% SDS-PAGE, transferred onto Immobilon-P membranes (Millipore, Bedford, MA), and analyzed by anti-phosphotyrosine Ab (PY99; Santa Cruz Biotechnology) as described previously (12, 14).

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
IL-21 induces the expression of genes associated with activation of innate immunity and Th1 response

IL-15 and IL-21 are important NK and T cell regulatory cytokines playing a significant role in their activation and proliferation. We analyzed the effect of these cytokines on the expression of IFN-, T-bet, IL-2R, IL-12R2, IL-18R, IL-18R, and MyD88 genes. NK-92 and T cells were stimulated with IL-15 or IL-21, harvested, and the total cellular RNA was isolated. Both IL-15 and IL-21 induced the expression of the IFN- gene in NK-92 cells (Fig. 1) and T cells (Fig. 2). In NK-92 cells, IL-15-induced steady-state IFN- mRNA levels were maximum 3 h after stimulation, whereas in T cells the expression peaked at 1 h after stimulation. T-bet is a recently characterized transcription factor that regulates the activation of innate immunity and polarization of T lymphocytes toward Th1-type cells (19). Both IL-15 and IL-21 induced T-bet gene expression in NK-92 cells. The up-regulation of the T-bet gene by IL-15 was rapid, reaching a maximum at 1–3 h after stimulation, whereas the kinetics of IL-21-induced T-bet mRNA expression was somewhat slower. In T cells, IL-21 was a more potent up-regulator of T-bet mRNA levels compared with that of IL-15.

View larger version (100K): [in this window] [in a new window]   FIGURE 1. Kinetics of IFN-, T-bet, IL-2R, IL-12R2, IL-18R, and MyD88 mRNA expression in NK-92 cells stimulated with IL-15 or IL-21. Cells were stimulated with IL-15 (5 ng/ml) or IL-21 (10 ng/ml) for the times indicated and collected, and the total cellular RNA was isolated and prepared for Northern blot analysis with IFN-, T-bet, IL-2R, IL-12R2, and MyD88 probes. Ethidium bromide staining of rRNA bands was used to ensure equal RNA loading. The results are representative of three independent experiments.

View larger version (110K): [in this window] [in a new window]   FIGURE 2. Kinetics of IFN-, T-bet, IL-2R, IL-12R2, IL-18R, and MyD88 mRNA expression in T cells stimulated with IL-15 or IL-21. T cells from four individual blood donors were stimulated separately with IL-15 or IL-21 for the indicated times. The cells were collected and pooled, and total cellular RNA was isolated and prepared for Northern blot analysis with IFN-, T-bet, IL-2R, IL-12R2, and MyD88 probes. The results shown are representative of three separate experiments.

IL-15 induces STAT5 DNA binding to the IL-2R GAS-c/GAS-n element in NK-92 cells

The IL-2R gene contains an upstream STAT5-binding element that is essential for IL-2-induced IL-2R transcription (21, 22). To characterize IL-15- and IL-21-induced STAT DNA binding to the GAS-c/GAS-n element (from -3778 to -3740) of the IL-2R gene, NK-92 cells were stimulated with IL-15 or IL-21 for different time periods, and nuclear extracts were prepared followed by analysis with EMSA. As shown in Fig. 3A, EMSA with the IL-2R GAS-c/GAS-n oligonucleotide revealed the induction of one major protein-DNA complex in response to IL-15 stimulation. The IL-15-induced complex was already seen at 1 h after the cytokine stimulation. The complex induced by IL-15 was identified with specific anti-STAT Abs. Both anti-STAT1 and anti-STAT5 Abs supershifted the IL-15-induced complex (Fig. 3B). IL-21 stimulation of NK-92 cells did not induce detectable STAT5 binding to IL-2R GAS-c/GAS-n.

View larger version (35K): [in this window] [in a new window]   FIGURE 3. IL-15 induces STAT5 binding to the IL-2R promoter GAS element. A, NK-92 cells were stimulated for the indicated times with IL-15 (5 ng/ml) or IL-21 (10 ng/ml), and nuclear extracts were prepared. The extracts were incubated with the IL-2R GAS probe and analyzed by EMSA. B, The nuclear extracts from IL-15-induced cells were pretreated with anti-STAT1, anti-STAT3, anti-STAT4, or anti-STAT5 Abs for 1 h followed by EMSA with the IL-2R probe. Comparable data were obtained from three independent experiments.

In addition to the IL-2R gene, both IL-15 and IL-21 up-regulated MyD88 gene expression. MyD88 is a cytoplasmic adapter protein involved in IL-18 and Toll-like receptor signal transduction and it is an essential factor in innate immunity (23, 24). To study possible STAT binding to MyD88 GAS, we stimulated NK-92 cells with IL-15 or IL-21, prepared nuclear extracts, and analyzed them by EMSA. As shown in Fig. 4A, both IL-15 and IL-21 induced STAT binding to MyD88 GAS. The differential mobility of IL-21- and IL-15-induced protein-DNA complexes in the gel suggested that these cytokines activate different STATs. To identify IL-15- and IL-21-induced complexes, we performed supershift experiments with anti-STAT Abs. Anti-STAT5 and anti-STAT1 Abs supershifted both of the IL-15-induced MyD88 GAS complexes, whereas anti-STAT3 Ab supershifted IL-21-induced MyD88 GAS binding complexes (data not shown).

View larger version (40K): [in this window] [in a new window]   FIGURE 4. IL-21 induces STAT3 binding to MyD88 GAS and SIE. NK-92 cells were stimulated with IL-15 or IL-21 for the indicated times and nuclear extracts were prepared and analyzed by EMSA with MyD88 GAS (A) and SIE probes (B). C, Nuclear protein extracts were incubated with anti-STAT Abs for 1 h, followed by binding to SIE. The experiments were repeated three times with similar results.

IL-21 induces STAT3 binding in primary NK and T cells

Next, we analyzed whether IL-21 was able to activate STAT3 also in primary human NK and T cells. NK and T cells were purified as described in Materials and Methods. The cells were stimulated with IL-15 or IL-21 and nuclear extracts were prepared followed by EMSA. Similar to NK-92 cells, IL-15 induced STAT5 and IL-21 induced STAT3 DNA binding to SIE in primary NK cells (Fig. 5A). Anti-STAT5 Ab supershifted the IL-15-induced protein-DNA complex, whereas the IL-21-induced complex was supershifted by anti-STAT3 Ab. In contrast to NK cells, stimulation of primary T cells with IL-21 induced both STAT3 and STAT5 binding to SIE (Fig. 5B).

View larger version (54K): [in this window] [in a new window]   FIGURE 5. IL-21 induces STAT3 binding to SIE in primary NK and T cells. Human primary NK cells (A) or T cells (B) from four individual donors were stimulated with IL-15 or IL-21. After a 1-h stimulation, the cells were collected, and nuclear extracts were prepared and incubated with anti-STAT1, anti-STAT3, anti-STAT4, or anti-STAT5 Abs, followed by EMSA with a SIE probe.

Since IL-21 induced STAT3 DNA binding to SIE and MyD88 GAS probes, we verified STAT3 activation with antiphosphotyrosine analysis. NK-92 and T cells were stimulated with IL-15 or IL-21 and proteins in cytokine-stimulated cell lysates were immunoprecipitated with anti-STAT3 or anti-STAT5 Abs followed by Western blot analysis with anti-phosphotyrosine Ab. As a control, cells were stimulated with IFN- which is known to activate multiple STAT proteins (13). In unstimulated NK-92 cells, STAT3 or STAT5 tyrosine phosphorylation was not detectable, whereas IFN-, IL-15, and especially IL-21 induced very efficiently STAT3 tyrosine phosphorylation (Fig. 6A). Very strong STAT5 tyrosine phosphorylation was seen in IL-15-stimulated NK-92 cells. In addition, a weak tyrosine phosphorylation of STAT5 was also detected in cells stimulated with IFN- or IL-21 (Fig. 6A). Similar to NK-92 cells, IFN- and IL-21 induced STAT3 tyrosine phosphorylation in T cells (Fig. 6B), whereas IL-15 stimulation of T cells activated STAT5 tyrosine phosphorylation (Fig. 6B).

View larger version (21K): [in this window] [in a new window]   FIGURE 6. Induction of tyrosine phosphorylation of STAT3 and STAT5 by IFN-, IL-15, and IL-21 in NK-92 and T cells. NK-92 cells (A) or T cells (B) were stimulated with IFN-, IL-15, or IL-21. The cells were collected and cell lysates were prepared and immunoprecipitated with anti-STAT3 or anti-STAT5 Abs. Immunoprecipitated proteins were separated on 10% SDS-PAGE, transferred to membranes, and stained with an anti-phosphotyrosine (P-Y) Ab. The membranes were stripped and restained with anti-STAT3 and anti-STAT5 Abs to ensure equal sample loading. A representative of three separate experiments is shown.

A recent study by Asao et al. (2) suggested that IL-21 stimulation lead to the activation of JAK1 and JAK3 in a _c-transfected T cell line. We analyzed whether JAK1 or JAK3 was activated by IL-21 also in NK and T cells. For that, NK-92 and T cells were stimulated with IL-15 or IL-21 and proteins in cell lysates were immunoprecipitated with anti-JAK1 or anti-JAK3 Abs followed by Western blot analysis with an anti-phosphotyrosine Ab. IL-15 and IL-21 induced JAK3 tyrosine phosphorylation in both cell types efficiently (Fig. 7). Instead, IL-15 and IL-21 had a weak enhancing effect on JAK1 tyrosine phosphorylation (Fig. 7).

View larger version (41K): [in this window] [in a new window]   FIGURE 7. IL-21 induces tyrosine phosphorylation of JAK1 and JAK3 in NK-92 and T cells. NK-92 (left panel) and T cells (right panel) were stimulated with IL-15 or IL-21. After a 30-min stimulation, the cells were collected and lysed, and the cell lysates were immunoprecipitated with anti-JAK1 or anti-JAK3 Abs. The immunoprecipitated proteins were separated on 8% SDS-PAGE, transferred to membranes, and blotted with an anti-phosphotyrosine (P-Y) Ab. To ensure equal protein loading, the membranes were stripped and restained with anti-JAK1 and anti-JAK3 Abs. The results shown are representative of two independent experiments.

IL-12 is a key cytokine in regulating NK and T cell activation (26). Because IL-15 and IL-21 stimulation of NK-92 cells enhanced IL-12R2 gene expression, we studied whether pretreatment of cells with IL-15 or IL-21 would result in enhanced IL-12-induced STAT4 DNA binding. For that, NK-92 cells were pretreated with IL-15 or IL-21 for 18 h and after that the cells were left untreated or stimulated with IL-12 for 1 h followed by EMSA with IL-2R GAS-c/GAS-n probe. Both IL-15 and IL-21 priming enhanced IL-12-stimulated STAT4 binding to IL-2R GAS-c/GAS-n (Fig. 8).

View larger version (34K): [in this window] [in a new window]   FIGURE 8. Pretreatment of NK-92 cells with IL-15 or IL-21 enhances IL-12-induced STAT4 DNA binding. NK-92 cells were incubated for 18 h with IL-15 (5 ng/ml) or IL-21 (10 ng/ml). The cells were washed and left untreated or stimulated with 1 or 5 ng/ml IL-12 for 1 h. Cells were collected, and nuclear extracts were prepared and analyzed by EMSA with the IL-2R GAS probe. The experiment was repeated twice with similar results.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

IFN- has a major role as a regulator of innate and adaptive immune responses. IFN- promotes innate and Th1 immune responses by activating macrophages, NK cells and T cells, as well as by enhancing Ag presentation (32). The results reported here show that IL-15 and IL-21 enhance the expression of the IFN- gene in NK and T cells. Both IL-15 and IL-21 up-regulated IFN- mRNA synthesis already at 1 h after stimulation, suggesting that these cytokines directly activate IFN- gene expression at the transcriptional level. IFN- production is induced by TCR ligation or macrophage-derived cytokines such as IFN-, IL-12, and IL-18 (33, 34, 35). IL-18 is essential for IFN- production both in bacterial and viral infections (36, 37). IL-18R consists of two subunits, IL-18R and IL-18R (37). IL-18R belongs to the IL-1R family, using the IL-1R-associated kinase-NF-B signaling pathway. Activation of these receptors requires an adapter protein, MyD88 (38, 39). We demonstrate that IL-15 and IL-21 enhance mRNA expression of IL-18R and MyD88. Moreover, our results suggest that these cytokines also indirectly enhance IFN- production and, consequently, Th1 response by inducing IL-18R expression in NK cells.

IL-12 is the major cytokine driving Th1 differentiation. Th1 differentiation also requires transcription factor T-bet that activates IFN- and IL-12R2 gene expression (19). A recent study shows that T-bet is required for IFN- production in CD4 and NK cells, but not in CD8 T cells (40). T-bet can also stimulate indirectly its own gene expression by inducing IFN-, which in turn activates T-bet gene expression (41, 42). We demonstrate here that both IL-15 and IL-21 up-regulate the mRNA synthesis for T-bet and IL-12R2 genes in NK and T cells. Furthermore, pretreatment of NK-92 cells with IL-15 or IL-21 resulted in enhanced IL-12-induced STAT4 DNA binding. These results suggest that both IL-15 and IL-21 have effects that can enhance a Th1-type immune response.

Receptors for IL-2, IL-15, and IL-21 share the same _c (2, 43). In addition, the IL-2/IL-15R subunit that is essential for the proliferation of NK and T cells is also closely related to IL-21R. IL-2 and IL-15 utilize STAT5 in their intracellular signal transduction and STAT5 is essential for IL-2-induced T cell proliferation (44). Asao et al. (2) demonstrated that IL-21 uses _c in signaling and activates STAT3 in a human T cell leukemia virus I-transformed human T cell line. They also showed that the phosphorylation of JAK1 and JAK3 was enhanced by IL-21. We show here that in primary T cells and NK-92 cells IL-21- and especially IL-15-induced JAK3 tyrosine phosphorylation was efficient. In contrast, IL-21 had a modest enhancing effect on JAK1 tyrosine phosphorylation in both cell types.

As shown in the present report, IL-15 stimulation of NK-92 cells activated STAT5 DNA binding to the IL-2R promoter element and induced IL-2R mRNA synthesis. Similar IL-15-induced STAT5 DNA binding was also detected in human primary NK and T cells. The results are consistent with an earlier report demonstrating that STAT5 and, to some extent, STAT1 and STAT3 are activated by IL-15 in NK and T cells (45). Using MyD88 GAS and SIE elements in EMSA and analysis of STAT tyrosine phosphorylation, we demonstrated that IL-21 activates STAT3 not only in human NK-92 cell line but also in human primary NK and T cells. In NK-92 cells, IL-21-induced STAT binding to the IL-2R promoter element was not detected although the mRNA synthesis for IL-2R was enhanced. Similarly, IL-21 was not able to induce STAT DNA binding to recently described IL-2R GAS elements residing in the first intron of the IL-2R gene (data not shown) (46). These results suggest that IL-21 activates other signaling pathways, leading to the activation of the IL-2R gene. In conclusion, our results demonstrate that IL-15 and IL-21 enhance the innate as well as Th1 immune response by activating different STATs, which is followed by the induction of IFN-, T-bet, IL-2R, IL-12R2, IL-18R, and MyD88 gene expression in NK and T cells.

	Acknowledgments

 
We thank Dr. John E. Sims (Immunex, Seattle, WA) for providing IL-18R and MyD88 cDNAs and Teija Westerlund and Marika Yliselä for expert technical assistance.

	Footnotes

 
¹ This work was supported by the Medical Research Council of the Academy of Finland, the Sigrid Juselius Foundation, and the Finnish Cancer Foundations.

² Address correspondence and reprint requests to Dr. Mari Strengell, Department of Microbiology, National Public Health Institute, Mannerheimintie 166, FIN-00300 Helsinki, Finland. E-mail address: mari.strengell{at}ktl.fi

³ Abbreviations used in this paper: _c, common -chain; GAS, IFN--activated sequence; SIE, c-sis-inducible element; JAK, Janus kinase; MyD88, myeloid differentiation factor 88.

Received for publication January 28, 2002. Accepted for publication July 24, 2002.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Parrish-Novak, J., S. R. Dillon, A. Nelson, A. Hammond, C. Sprecher, J. A. Gross, J. Johnston, K. Madden, W. Xu, J. West, et al 2000. Interleukin 21 and its receptor are involved in NK cell expansion and regulation of lymphocyte function. Nature 408:57.[Medline]
2. Asao, H., C. Okuyama, S. Kumaki, N. Ishii, S. Tsuchiya, D. Foster, K. Sugamura. 2001. The common -chain is an indispensable subunit of the IL-21 receptor complex. J. Immunol. 167:1.[Abstract/Free Full Text]
3. Ozaki, K., K. Kikly, D. Michalovich, P. R. Young, W. J. Leonard. 2000. Cloning of a type I cytokine receptor most related to the IL-2 receptor chain. Proc. Natl. Acad. Sci. USA 97:11439.[Abstract/Free Full Text]
4. Nishimura, H., M. Tagaya, H. Tsunobuchi, H. Suzuki, I. Nakashima, Y. Yoshikai. 2001. Mice lacking interleukin-2 (IL-2)/IL-15 receptor chain are susceptible to infection with avirulent Salmonella enterica subsp. enterica serovar choleraesuis but mice lacking IL-2 are resistant. Infect. Immun. 2:1226.
5. Moretta, L., M. C. Mingari, D. Pende, C. Bottino, R. Biassoni, A. Moretta. 1996. The molecular basis of natural killer (NK) cell recognition and function. J. Clin. Immunol. 16:243.[Medline]
6. Matikainen, S., A. Paananen, M. Miettinen, M. Kurimoto, T. Timonen, I. Julkunen, T. Sareneva. 2001. IFN- and IL-18 synergistically enhance IFN- production in human NK cells: differential regulation of Stat4 activation and IFN- gene expression by IFN- and IL-12. Eur. J. Immunol. 31:2236.[Medline]
7. Kalina, U., D. Kauschat, N. Koyama, H. Nuernberger, K. Ballas, S. Koschmieder, G. Bug, W. Hofmann, D. Hoelzer, O. G. Ottmann. 2000. IL-18 activates STAT3 in the natural killer cell line 92, augments cytotoxic activity, and mediates IFN- production by the stress kinase p38 and by the extracellular regulated kinases p44^erk-1 and p42^erk-21. J. Immunol. 165:1307.[Abstract/Free Full Text]
8. Biron, C. A., K. B. Nguyen, G. C. Pien, L. P. Cousens, T. P. Salazar-Mather. 1999. Natural killer cells in antiviral defence: function and regulation by innate cytokines. Annu. Rev. Immunol. 17:189.[Medline]
9. Le Page, C., P. Genin, M. G. Baines, J. Hiscott. 2000. Interferon activation and innate immunity. Rev. Immunogenet. 2:374.[Medline]
10. Guidotti, L. G., F. V. Chisari. 2001. Noncytolytic control of viral infections by the innate and adaptive immune response. Annu. Rev. Immunol. 19:65.[Medline]
11. Trinchieri, G.. 1998. Interleukin-12: a cytokine at the interface of inflammation and immunity. Adv. Immunol. 70:83.[Medline]
12. Matikainen, S., T. Sareneva, T. Ronni, A. Lehtonen, P. Koskinen, I. Julkunen. 1999. Interferon- activates multiple STAT proteins and up-regulates proliferation-associated IL-2R, c-myc, and pim-1 genes in human T cells. Blood 93:1980.[Abstract/Free Full Text]
13. Sareneva, T., J. Pirhonen, K. Cantell, N. Kalkkinen, I. Julkunen. 1994. Role of N-glycosylation in the synthesis, dimerization and secretion of human interferon-. Biochem. J. 303:831.
14. Sareneva, T., I. Julkunen, S. Matikainen. 2000. IFN- and IL-12 induce IL-18 receptor gene expression in human NK and T cells. J. Immunol. 165:1933.[Abstract/Free Full Text]
15. Born, T. L., E. Thomassen, T. A. Bird, J. E. Sims. 1998. Cloning of a novel receptor subunit, AcPL, required for interleukin-18 signaling. J. Biol. Chem. 273:29445.[Abstract/Free Full Text]
16. Bonnert, T. P., K. E. Garka, P. Parnet, G. Sonoda, J. R. Testa, J. E. Sims. 1997. The cloning and characterization of human MyD88: a member of an IL-1 receptor related family. FEBS Lett. 402:81.[Medline]
17. Andrews, N. C., D. V. Faller. 1991. A rapid micropreparation techniques for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res. 19:2499.[Free Full Text]
18. Matikainen, S., T. Ronni, M. Hurme, R. Pine, I. Julkunen. 1996. Retinoic acid activates interferon regulatory factor-1 gene expression in myeloid cells. Blood 88:114.[Abstract/Free Full Text]
19. Szabo, S., S. T. Kim, X. Zhang, C. G. Fathman, L. H. Glimcher. 2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 17:655.
20. Rogge, L., L. Barberis-Maino, M. Biffi. N. Passini. D. H. Presky, U. Gubler, F. Sinigaglia. 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185:825.[Abstract/Free Full Text]
21. John, S., C. M. Robbins, W. J. Leonard. 1996. An IL-2 response element in the human IL-2 receptor chain promoter is a composite element that binds Stat5, Elf-1, HMG-I(Y) and GATA family protein. EMBO J. 15:5627.[Medline]
22. Lécine, P., M. Algarté, P. Rameil, C. Beadling, P. Bucher, M. Nabholz, J. Imbert. 1996. Elf-1 and Stat5 bind to a critical element in a new enhancer of the human interleukin-2 receptor gene. Mol. Cell. Biol. 16:6829.[Abstract]
23. Schnare, M., A. C. Holt, K. Takeda, S. Akira, R. Medzhitov. 2000. Recognition of CpG DNA is mediated by signaling pathways dependent of the adaptor protein MyD88. Curr. Biol. 21:1139.
24. Kawai, T., O. Adachi, T. Ogawa, K. Takeda, S. Akira. 1999. Unresponsiveness of MyD88-deficient mice to endotoxin. Immunity 11:115.[Medline]
25. Ehret, G. B., P. Reichenbach, U. Schindler, C. M. Horvath, S. Fritz, M. Nabholz, P. Bucher. 2001. DNA binding specificity of different STAT proteins. J. Biol. Chem. 276:6675.[Abstract/Free Full Text]
26. Chakir, H., A. A. Camilucci, L. G. Filion, J. R. Webb. 2000. Differentiation of murine NK cells into distinct subsets based on variable expression of the IL-12R 2 subunit. J. Immunol. 165:4985.[Abstract/Free Full Text]
27. Dunne, J., S. Synch, C. O’Farrelly, S. Todryk, J. E. Hegarty, C. Feighery, D. G. Doherty. 2001. Selective expansion and partial activation of human NK cells and NK receptor-positive T cells by IL-2 and IL-15. J. Immunol. 167:3129.[Abstract/Free Full Text]
28. Waldmann, T. A., S. Dubois, Y. Tagaya. 2001. Contrasting roles of IL-2 and IL-15 in the life and death of lymphocytes: implications for immunotherapy. Immunity 14:105.[Medline]
29. Kennedy, M. K., M. Glaccum, S. N. Brown. 2000. Reversible defects in natural killer and memory CD8 T cell lineages in interleukin 15-deficient mice. J. Exp. Med. 191:771.[Abstract/Free Full Text]
30. Lodolce, J. P., D. L. Boone, S. Chai, R. E. Swain, T. Dassopoulos, S. Trettin, A. Ma. 1998. IL-15 receptor maintains lymphoid homeostasis by supporting lymphocyte homing and proliferation. Immunity 9:669.[Medline]
31. Fehniger, T. A., K. Suzuki, A. Ponnappan, J. B. VanDeusen, M. A. Cooper, S. M. Florea, A. G. Freud, M. L. Robinson, J. Durbin, M. A. Caligiuri. 2001. Fatal leukemia in interleukin 15 transgenic mice follows early expansions in natural killer and memory phenotype CD8⁺ T cells. J. Exp. Med. 193:219.[Abstract/Free Full Text]
32. Farrar, M. A., R. D. Schreiber. 1993. The molecular cell biology of interferon- and its receptor. Annu. Rev. Immunol. 11:571.[Medline]
33. Schindler, H., M. B. Lutz, M. Röllinghoff, C. Bogdan. 2001. The production of IFN- by IL-12/IL-18-activated macrophages requires STAT4 signaling and is inhibited by IL-4. J. Immunol. 166:3075.[Abstract/Free Full Text]
34. Sareneva, T., S. Matikainen, M. Kurimoto, I. Julkunen. 1998. Influenza A virus-induced IFN-/ and IL-18 synergistically enhance IFN- gene expression in human T cells. J. Immunol. 160:6032.[Abstract/Free Full Text]
35. Barbulescu, K., C. Becker, J. F. Schlaak, E. Schmitt, K. Meyer zum Buschenfelde, M. F. Neurath. 1998. IL-12 and IL-18 differentially regulate the transcriptional activity of the human IFN- promoter in primary CD4⁺ T lymphocytes. J. Immunol. 160:3642.[Abstract/Free Full Text]
36. Pien, G. C., A. R. Satoskar, K. Takeda, S. Akira, C. A. Biron. 2000. Selective IL-18 requirements for induction of compartmental IFN- responses during viral infection. J. Immunol. 165:4787.[Abstract/Free Full Text]
37. Nakanishi, K., T. Yoshimoto, H. Tsutsui, H. Okamura. 2001. Interleukin-18 regulates both Th1 and Th2 responses. Annu. Rev. Immunol. 19:423.[Medline]
38. Medzhitov, R., P. Preston-Hurlburt, E. Kopp, A. Stadlen, C. Chen, S. Ghosh, Jr C. A. Janeway. 1998. MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways. Mol. Cell 2:253.[Medline]
39. Adachi, O., T. Kawai, K. Takeda, M. Matsumoto, H. Tsutsui, M. Sakagami, K. Nakanishi, S. Akira. 1998. Targeted disruption of the MyD88 gene results in loss of IL-1- and IL-18-mediated function. Immunity 9:143.[Medline]
40. Szabo, S. J., B. M. Sullivan, C. Stemmann, A. R. Satoskar, B. P. Sleckman, L. H. Glimcher. 2002. Distinct effects of T-bet in T_H1 lineage commitment and IFN- production in CD4 and CD8 T cell. Science 295:338.[Abstract/Free Full Text]
41. Mullen, A. C., F. A. High, A. S. Hutchins, H. W. Lee, A. V. Villarino, D. M. Livingston, A. L. Kung, N. Cereb, T. P. Yao, S. Y. Yang, S. L. Reiner. 2001. Role of T-bet in commitment of Th1 cells before IL-12-dependent selection. Science 8:1907.
42. Lighvani, A. A., D. M. Frucht, D. Jankovic, H. Yamane, J. Aliberti, B. D. Hissong, B. V. Nguyen, M. Gadina, A. Sher, W. E. Paul, J. J. O’Shea. 2001. T-bet is rapidly induced by interferon- in lymphoid and myeloid cells. Proc. Natl. Acad. Sci. USA 26:15137.
43. Wohenrich, C. A. J., J. P. Di Santo. 2001. Cytokines: IL-21 joins the _c-dependent network?. Curr. Biol. 11:R175.[Medline]
44. Johnston, J. A., C. M. Bacon, D. S. Finbloom, R. C. Rees, D. Kaplan, K. Shibuya, J. R. Ortaldo, S. Gupta, Y. Q. Chen, J. D. Giri, J. J. O’Shea. 1995. Tyrosine phosphorylation and activation of STAT5, STAT3, and Janus kinases by interleukins 2 and 15. Proc. Natl. Acad. Sci. USA 92:8705.[Abstract/Free Full Text]
45. Yu, C. R., H. A. Young, J. R. Ortaldo. 1998. Characterization of cytokine differential induction of STAT complexes in primary human T and NK cells. J. Leukocyte Biol. 64:245.[Abstract]
46. Kim, H., J. Kelly, W. J. Leonard. 2001. The basis for IL-2-induced IL-2 receptor chain gene regulation: importance of two widely separated IL-2 response elements. Immunity 15:159.[Medline]

This article has been cited by other articles:

				C. K. Holm, C. C. Petersen, M. Hvid, L. Petersen, S. R. Paludan, B. Deleuran, and M. Hokland TLR3 Ligand Polyinosinic:Polycytidylic Acid Induces IL-17A and IL-21 Synthesis in Human Th Cells J. Immunol., October 1, 2009; 183(7): 4422 - 4431. [Abstract] [Full Text] [PDF]

				J. Dien Bard, P. Gelebart, M. Anand, Z. Zak, S. A. Hegazy, H. M. Amin, and R. Lai IL-21 Contributes to JAK3/STAT3 Activation and Promotes Cell Growth in ALK-Positive Anaplastic Large Cell Lymphoma Am. J. Pathol., August 1, 2009; 175(2): 825 - 834. [Abstract] [Full Text] [PDF]

				I. D. Davis, B. Brady, R. F. Kefford, M. Millward, J. Cebon, B. K. Skrumsager, U. Mouritzen, L. T. Hansen, K. Skak, D. Lundsgaard, et al. Clinical and Biological Efficacy of Recombinant Human Interleukin-21 in Patients with Stage IV Malignant Melanoma without Prior Treatment: A Phase IIa Trial Clin. Cancer Res., March 15, 2009; 15(6): 2123 - 2129. [Abstract] [Full Text] [PDF]

				D. T. Avery, C. S. Ma, V. L. Bryant, B. Santner-Nanan, R. Nanan, M. Wong, D. A. Fulcher, M. C. Cook, and S. G. Tangye STAT3 is required for IL-21-induced secretion of IgE from human naive B cells Blood, September 1, 2008; 112(5): 1784 - 1793. [Abstract] [Full Text] [PDF]

				W. J. Leonard, R. Zeng, and R. Spolski Interleukin 21: a cytokine/cytokine receptor system that has come of age J. Leukoc. Biol., August 1, 2008; 84(2): 348 - 356. [Abstract] [Full Text] [PDF]

				D Fina, M Sarra, R Caruso, G Del Vecchio Blanco, F Pallone, T T MacDonald, and G Monteleone Interleukin 21 contributes to the mucosal T helper cell type 1 response in coeliac disease Gut, July 1, 2008; 57(7): 887 - 892. [Abstract] [Full Text] [PDF]

				Z. Xing, C. J. Cardona, J. Li, N. Dao, T. Tran, and J. Andrada Modulation of the immune responses in chickens by low-pathogenicity avian influenza virus H9N2 J. Gen. Virol., May 1, 2008; 89(5): 1288 - 1299. [Abstract] [Full Text] [PDF]

				M. J. Smyth, M. W.L. Teng, J. Sharkey, J. A. Westwood, N. M. Haynes, H. Yagita, K. Takeda, P. V. Sivakumar, and M. H. Kershaw Interleukin 21 Enhances Antibody-Mediated Tumor Rejection Cancer Res., April 15, 2008; 68(8): 3019 - 3025. [Abstract] [Full Text] [PDF]

				R. K. S. Phoon, A. R. Kitching, D. Odobasic, L. K. Jones, T. J. Semple, and S. R. Holdsworth T-bet Deficiency Attenuates Renal Injury in Experimental Crescentic Glomerulonephritis J. Am. Soc. Nephrol., March 1, 2008; 19(3): 477 - 485. [Abstract] [Full Text] [PDF]

				F. Caprioli, M. Sarra, R. Caruso, C. Stolfi, D. Fina, G. Sica, T. T. MacDonald, F. Pallone, and G. Monteleone Autocrine Regulation of IL-21 Production in Human T Lymphocytes J. Immunol., February 1, 2008; 180(3): 1800 - 1807. [Abstract] [Full Text] [PDF]

				I. D. Davis, K. Skak, M. J. Smyth, P. E.G. Kristjansen, D. M. Miller, and P. V. Sivakumar Interleukin-21 Signaling: Functions in Cancer and Autoimmunity Clin. Cancer Res., December 1, 2007; 13(23): 6926 - 6932. [Abstract] [Full Text] [PDF]

				Y. Hiromura, T. Kishida, H. Nakano, T. Hama, J. Imanishi, Y. Hisa, and O. Mazda IL-21 Administration into the Nostril Alleviates Murine Allergic Rhinitis J. Immunol., November 15, 2007; 179(10): 7157 - 7165. [Abstract] [Full Text] [PDF]

				S. Liu, G. Lizee, Y. Lou, C. Liu, W. W. Overwijk, G. Wang, and P. Hwu IL-21 synergizes with IL-7 to augment expansion and anti-tumor function of cytotoxic T cells Int. Immunol., October 1, 2007; 19(10): 1213 - 1221. [Abstract] [Full Text] [PDF]

				T. Onoda, M. Rahman, H. Nara, A. Araki, K. Makabe, K. Tsumoto, I. Kumagai, T. Kudo, N. Ishii, N. Tanaka, et al. Human CD4+ central and effector memory T cells produce IL-21: effect on cytokine-driven proliferation of CD4+ T cell subsets Int. Immunol., October 1, 2007; 19(10): 1191 - 1199. [Abstract] [Full Text] [PDF]

				K. A. Casey and M. F. Mescher IL-21 Promotes Differentiation of Naive CD8 T Cells to a Unique Effector Phenotype J. Immunol., June 15, 2007; 178(12): 7640 - 7648. [Abstract] [Full Text] [PDF]

				R. Zeng, R. Spolski, E. Casas, W. Zhu, D. E. Levy, and W. J. Leonard The molecular basis of IL-21-mediated proliferation Blood, May 15, 2007; 109(10): 4135 - 4142. [Abstract] [Full Text] [PDF]

				L. White, S. Krishnan, N. Strbo, H. Liu, M. A. Kolber, M. G. Lichtenheld, R. N. Pahwa, and S. Pahwa Differential effects of IL-21 and IL-15 on perforin expression, lysosomal degranulation, and proliferation in CD8 T cells of patients with human immunodeficiency virus-1 (HIV) Blood, May 1, 2007; 109(9): 3873 - 3880. [Abstract] [Full Text] [PDF]

				L. Zamai, C. Ponti, P. Mirandola, G. Gobbi, S. Papa, L. Galeotti, L. Cocco, and M. Vitale NK Cells and Cancer J. Immunol., April 1, 2007; 178(7): 4011 - 4016. [Abstract] [Full Text] [PDF]

				A. Frohlich, B. J. Marsland, I. Sonderegger, M. Kurrer, M. R. Hodge, N. L. Harris, and M. Kopf IL-21 receptor signaling is integral to the development of Th2 effector responses in vivo Blood, March 1, 2007; 109(5): 2023 - 2031. [Abstract] [Full Text] [PDF]

				J. Pene, L. Guglielmi, J.-F. Gauchat, N. Harrer, M. Woisetschlager, V. Boulay, J.-M. Fabre, P. Demoly, and H. Yssel IFN-{gamma}-Mediated Inhibition of Human IgE Synthesis by IL-21 Is Associated with a Polymorphism in the IL-21R Gene J. Immunol., October 15, 2006; 177(8): 5006 - 5013. [Abstract] [Full Text] [PDF]

				A. Cappuccio, M. Elishmereni, and Z. Agur Cancer immunotherapy by interleukin-21: potential treatment strategies evaluated in a mathematical model. Cancer Res., July 15, 2006; 66(14): 7293 - 7300. [Abstract] [Full Text] [PDF]

				M. Strengell, A. Lehtonen, S. Matikainen, and I. Julkunen IL-21 enhances SOCS gene expression and inhibits LPS-induced cytokine production in human monocyte-derived dendritic cells J. Leukoc. Biol., June 1, 2006; 79(6): 1279 - 1285. [Abstract] [Full Text] [PDF]

				S. A. Perez, L. G. Mahaira, P. A. Sotiropoulou, A. D. Gritzapis, E. G. Iliopoulou, D. K. Niarchos, N. T. Cacoullos, Y. G. Kavalakis, A. I. Antsaklis, N. N. Sotiriadou, et al. Effect of IL-21 on NK cells derived from different umbilical cord blood populations Int. Immunol., January 1, 2006; 18(1): 49 - 58. [Abstract] [Full Text] [PDF]

				A. M. Marleau and N. Sarvetnick T cell homeostasis in tolerance and immunity J. Leukoc. Biol., September 1, 2005; 78(3): 575 - 584. [Abstract] [Full Text] [PDF]

				R. Takaki, Y. Hayakawa, A. Nelson, P. V. Sivakumar, S. Hughes, M. J. Smyth, and L. L. Lanier IL-21 Enhances Tumor Rejection through a NKG2D-Dependent Mechanism J. Immunol., August 15, 2005; 175(4): 2167 - 2173. [Abstract] [Full Text] [PDF]

				K. Kawana, Y. Kawana, and D. J. Schust Female Steroid Hormones Use Signal Transducers and Activators of Transcription Protein-Mediated Pathways to Modulate the Expression of T-bet in Epithelial Cells: A Mechanism for Local Immune Regulation in the Human Reproductive Tract Mol. Endocrinol., August 1, 2005; 19(8): 2047 - 2059. [Abstract] [Full Text] [PDF]

				N. L. Alves, F. A. Arosa, and R. A. W. van Lier IL-21 Sustains CD28 Expression on IL-15-Activated Human Naive CD8+ T Cells J. Immunol., July 15, 2005; 175(2): 755 - 762. [Abstract] [Full Text] [PDF]

				T. L. Vollmer, R. Liu, M. Price, S. Rhodes, A. La Cava, and F.-D. Shi Differential Effects of IL-21 during Initiation and Progression of Autoimmunity against Neuroantigen J. Immunol., March 1, 2005; 174(5): 2696 - 2701. [Abstract] [Full Text] [PDF]

				C. A. J. Vosshenrich, T. Ranson, S. I. Samson, E. Corcuff, F. Colucci, E. E. Rosmaraki, and J. P. Di Santo Roles for Common Cytokine Receptor {gamma}-Chain-Dependent Cytokines in the Generation, Differentiation, and Maturation of NK Cell Precursors and Peripheral NK Cells in Vivo J. Immunol., February 1, 2005; 174(3): 1213 - 1221. [Abstract] [Full Text] [PDF]

				J. Siren, T. Sareneva, J. Pirhonen, M. Strengell, V. Veckman, I. Julkunen, and S. Matikainen Cytokine and contact-dependent activation of natural killer cells by influenza A or Sendai virus-infected macrophages J. Gen. Virol., August 1, 2004; 85(8): 2357 - 2364. [Abstract] [Full Text] [PDF]

				M. Strengell, I. Julkunen, and S. Matikainen IFN-{alpha} regulates IL-21 and IL-21R expression in human NK and T cells J. Leukoc. Biol., August 1, 2004; 76(2): 416 - 422. [Abstract] [Full Text] [PDF]

				A. Moroz, C. Eppolito, Q. Li, J. Tao, C. H. Clegg, and P. A. Shrikant IL-21 Enhances and Sustains CD8+ T Cell Responses to Achieve Durable Tumor Immunity: Comparative Evaluation of IL-2, IL-15, and IL-21 J. Immunol., July 15, 2004; 173(2): 900 - 909. [Abstract] [Full Text] [PDF]

				E. Di Carlo, A. Comes, A. M. Orengo, O. Rosso, R. Meazza, P. Musiani, M. P. Colombo, and S. Ferrini IL-21 Induces Tumor Rejection by Specific CTL and IFN-{gamma}-Dependent CXC Chemokines in Syngeneic Mice J. Immunol., February 1, 2004; 172(3): 1540 - 1547. [Abstract] [Full Text] [PDF]

				S. Lucas, N. Ghilardi, J. Li, and F. J. de Sauvage IL-27 regulates IL-12 responsiveness of naive CD4+ T cells through Stat1-dependent and -independent mechanisms PNAS, December 9, 2003; 100(25): 15047 - 15052. [Abstract] [Full Text] [PDF]

				H.-L. Ma, M. J. Whitters, R. F. Konz, M. Senices, D. A. Young, M. J. Grusby, M. Collins, and K. Dunussi-Joannopoulos IL-21 Activates Both Innate and Adaptive Immunity to Generate Potent Antitumor Responses that Require Perforin but Are Independent of IFN-{gamma} J. Immunol., July 15, 2003; 171(2): 608 - 615. [Abstract] [Full Text] [PDF]

				G. Lugo-Villarino, R. Maldonado-Lopez, R. Possemato, C. Penaranda, and L. H. Glimcher T-bet is required for optimal production of IFN-{gamma} and antigen-specific T cell activation by dendritic cells PNAS, June 24, 2003; 100(13): 7749 - 7754. [Abstract] [Full Text] [PDF]

				M. Strengell, S. Matikainen, J. Siren, A. Lehtonen, D. Foster, I. Julkunen, and T. Sareneva IL-21 in Synergy with IL-15 or IL-18 Enhances IFN-{gamma} Production in Human NK and T Cells J. Immunol., June 1, 2003; 170(11): 5464 - 5469. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Strengell, M. Articles by Matikainen, S. Search for Related Content PubMed PubMed Citation Articles by Strengell, M. Articles by Matikainen, S. Pubmed/NCBI databases Gene GEO Profiles HomoloGene Protein UniGene Compound via MeSH Substance via MeSH Medline Plus Health Information Dietary Proteins Genetics Home Reference Hazardous Substances DB L-TYROSINE