|
|
||||||||

* Department of Microbiology, National Public Health Institute, Helsinki, Finland; and
Department of Functional Cloning, ZymoGenetics, Seattle, WA 98102
| Abstract |
|---|
|
|
|---|
-chain
(
c) with the receptors for IL-2, IL-4, IL-7, IL-9, and
IL-15. Despite the same
c, these cytokines have
different effects on diverse cells. In this study, we have studied
IL-15- and IL-21-induced gene expression in human primary NK and T
cells and the NK-92 cell line. Both IL-15 and IL-21 rapidly induced
mRNA synthesis for IFN-
, T-bet, IL-2R
, IL-12R
2, IL-18R,
and myeloid differentiation factor 88 (MyD88), the genes that
are important in activating innate immunity and Th1 response. IL-15
induced STAT5 DNA binding to the IL-2R
IFN-
-activated sequence
(GAS), MyD88 GAS, and c-sis-inducible elements, whereas IL-21 induced
STAT3 DNA binding to MyD88 GAS and c-sis-inducible elements.
IL-21-induced STAT3 activation was verified by immunoprecipitation and
Western blotting with anti-phosphotyrosine Ab. In addition,
pretreatment of NK-92 cells with IL-15 or IL-21 strongly enhanced
IL-12-induced STAT4 DNA binding to IL-2R
GAS. The induction of
IFN-
, T-bet,
IL-12R
2, and IL-18R
gene expression in NK cells, along with STAT3 activation, suggests that
IL-21 is involved in the activation of innate immune responses.
Moreover, the enhanced transcription of these genes in T cells
establishes a significant role for IL-21 also in the Th1
response. | Introduction |
|---|
|
|
|---|
(3). It was recently shown that the
common
-chain
(
c),3
shared by the receptors for IL-2, IL-4, IL-7, IL-9, and IL-15, is also
the functional component of the IL-21R complex (2). Mice
lacking the IL-2/IL-15R
chain do not have NK and T cells. On the
other hand, NK and T cell development is normal in mice lacking the
IL-2 gene, suggesting that other cytokines using
IL-2/IL-15R
are important for the development of NK and T cells
(4).
NK cells have a crucial role in innate immunity, especially against
viral infections and in the control of tumor growth. NK cells exhibit
cytotoxic activities toward cells with diminished expression of MHC
class I molecules on their surface (5). Macrophage-derived
cytokines IFN-
, IL-12, and IL-18 enhance NK cell cytotoxicity and
activate NK cells to produce IFN-
and TNF-
(6, 7, 8, 9, 10).
NK cell-produced IFN-
is involved in the polarization of Th cells
toward the Th1 type. IL-12 is also required for the development of the
Th1-type immune response (11) and it enhances IFN-
production in NK and T cells, which further stimulates the capacity of
macrophages and dendritic cells to carry out Ag presentation.
In the present work, we have studied IL-15- and IL-21-induced gene
expression and signaling in human NK and T cells. We show that both
IL-15 and IL-21 induce mRNA expression of IFN-
,
T-bet, IL-2R
,
IL-12R
2, IL-18R, and myeloid
differentiation factor 88 (MyD88) genes that are involved in
innate immunity and the Th1 response. We also demonstrate that IL-21
preferentially activates STAT3, whereas IL-15 activates STAT5 both in
NK and T cells. In addition, we show that priming of NK-92 cells with
IL-15 or IL-21 enhances IL-12-induced STAT4 DNA binding, further
suggesting that IL-15 and IL-21 promote the Th1 response.
| Materials and Methods |
|---|
|
|
|---|
Leukocyte-rich buffy coats were obtained from healthy blood donors (Finnish Red Cross Blood Transfusion Service, Helsinki, Finland). Mononuclear cells were isolated from buffy coats by density gradient centrifugation using Ficoll-Paque (Amersham Pharmacia Biotech, Uppsala, Sweden). Monocytes were removed by adherence on plastic plates and nonadherent T cells were further purified through a nylon wool column. Purified T cells were activated with 0.5 µg/ml anti-CD3 and 0.5 µg/ml anti-CD28 mAbs (R&D Systems, Abingdon, U.K.) and cultured in RPMI 1640 medium supplemented with 10% FCS (Integro, Zaandam, The Netherlands), 20 mM HEPES, 2 mM L-glutamine, 0.6 µg/ml penicillin, 60 µg/ml streptomycin, and 100 IU/ml human rIL-2 (R&D Systems) for 56 days. T cells were then propagated for 56 days in RPMI 1640 supplemented with 100 IU/ml IL-2. In each experiment, T cells from two to four donors were used.
Enrichment of primary NK cells
Mononuclear cells were isolated by density gradient centrifugation as described above using Ficoll-Paque. NK cells were purified from nonadherent PBMCs through a nylon wool column and two-step density gradient centrifugation by Percoll (Amersham Pharmacia Biotech), and then followed by purification with immunomagnetic beads coated with anti-CD3, anti-CD14, and anti-CD19 Abs (Dynal, Oslo, Norway). As determined by flow cytometry with anti-CD16 or anti-CD56 Abs, NK cells were >90% pure.
NK cell line
A human NK-92 cell line (CRL-2407; American Type Culture
Collection, Manassas, VA) was maintained in MEM
medium (Life
Technologies, Carlsbad, CA) supplemented with 12% horse serum (Life
Technologies), 12% FCS, 0.2 mM i-inositol, 20 mM folic acid, 40 mM
2-ME, 2 mM L-glutamine, antibiotics, and 100 IU/ml
IL-2.
Cell stimulation
Human rIL-21 (ZymoGenetics, Seattle, WA) was used at 10 ng/ml. Human rIL-15 (R&D Systems) was used at 5 ng/ml. Despite the fact that the cells presumably consumed all IL-2 from the media during propagation, the cells were cultured in IL-2-free RPMI 1640 for 1 h (primary T cells) or for 18 h (NK-92 cell line) before stimulation with IL-15 or IL-21.
RNA isolation and Northern blot analysis
Total cellular RNA was isolated as previously described
(12). Total cellular RNA was quantified photometrically
and the samples containing equal amounts of RNA (10 µg) were size
fractionated on a 1.0% formaldehyde-agarose gel and transferred to a
nylon membrane (Hybond; Amersham, Buckinghamshire, U. K.). The
membrane was hybridized with the cDNA probes for human IFN-
(13), T-bet, IL-2R
, IL-12R
2, IL-18R
(14), IL-18R
(15), and MyD88
(16). T-bet and IL-12R
2 probes were cloned from total
cellular RNA obtained from IL-15-, IL-18-, and IL-21-treated NK-92
cells by RT-PCR using oligonucleotides CCGCCTGGATCCAACTGTCAATTC
(sense), ATCATGGGATCCGCTCAGTTGGGA (antisense), AGGGAAAAAGGATCCCAAGGTCAT
(sense), and AGACCAACTCCCGGATCCTAAGAC (antisense), respectively.
Ethidium bromide staining of ribosomal RNA bands was used to ensure
equal RNA loading. The probes were labeled with
[
-32P]dCTP (3000 Ci/mmol; Amersham) using a
random primed DNA labeling kit (Boehringer Mannheim, Mannheim,
Germany). The membranes were hybridized (Ultrahyb; Ambion, Austin, TX)
and washed twice at 42°C and once at 60°C in 1x SSC/0.1% SDS for
30 min each time, and exposed to Kodak AR X-Omat films at -70°C
using intensifying screens.
EMSA
Nuclear extracts and nuclear protein/DNA-binding reactions were
performed as described previously (17, 18). IL-2R
IFN-
-activated sequence (GAS), GAS-c/GAS-n,
5'-GATCTTTCTTCTAGGAAGTACCAAACATTTCTGATAATAGAA-3'; MyD88 GAS,
5'-GATCGGAGCTTCTCGGAAAGCGAAAGAAGGA-3'; and c-sis-inducible element
(SIE), 5'-GATCGATCTAGGGATTTCCGGGAAATGAAGCT-3' oligonucleotides were
purchased from DNA Technology (Aarhus, Denmark). The probes were
labeled with [32P]dATP by using Klenow
polymerase. The protein/DNA-binding reaction was done at room
temperature for 30 min and the samples were analyzed by electrophoresis
on 6% nondenaturing low-ionic strength polyacrylamide gels in 0.25x
Tris-borate-EDTA buffer. The gels were dried and visualized by
autoradiography. Anti-STAT1 (sc-345X), anti-STAT3 (sc-482X),
anti-STAT4 (sc-486X), and anti-STAT5b (sc-835X; recognizes both
STAT5a and STAT5b) Abs were obtained from Santa Cruz Biotechnology
(Santa Cruz, CA).
Antiphosphotyrosine analysis
Cytokine-stimulated cells were lysed in immunoprecipitation binding buffer (50 mM Tris (pH 7.4), containing 150 mM NaCl, 5 mM EDTA, and 1% Triton X-100) supplemented with protease inhibitors (Complete; Boehringer Mannheim) and 1 mM sodium orthovanadate. Cell lysates were immunoprecipitated on ice for 1 h with anti-Janus kinase (JAK) 1 (sc-295, Santa Cruz Biotechnology), anti-JAK3 (sc-513, Santa Cruz Biotechnology), anti-STAT3, or anti-STAT5b Abs. The proteins were separated on 8 or 10% SDS-PAGE, transferred onto Immobilon-P membranes (Millipore, Bedford, MA), and analyzed by anti-phosphotyrosine Ab (PY99; Santa Cruz Biotechnology) as described previously (12, 14).
| Results |
|---|
|
|
|---|
IL-15 and IL-21 are important NK and T cell regulatory cytokines
playing a significant role in their activation and proliferation. We
analyzed the effect of these cytokines on the expression of
IFN-
, T-bet, IL-2R
,
IL-12R
2, IL-18R
,
IL-18R
, and MyD88 genes. NK-92 and T cells
were stimulated with IL-15 or IL-21, harvested, and the total cellular
RNA was isolated. Both IL-15 and IL-21 induced the expression of the
IFN-
gene in NK-92 cells (Fig. 1
) and T cells (Fig. 2
). In NK-92 cells, IL-15-induced
steady-state IFN-
mRNA levels were maximum 3 h after
stimulation, whereas in T cells the expression peaked at 1 h after
stimulation. T-bet is a recently characterized transcription factor
that regulates the activation of innate immunity and polarization of T
lymphocytes toward Th1-type cells (19). Both IL-15 and
IL-21 induced T-bet gene expression in NK-92 cells. The
up-regulation of the T-bet gene by IL-15 was rapid, reaching
a maximum at 13 h after stimulation, whereas the kinetics of
IL-21-induced T-bet mRNA expression was somewhat slower. In T cells,
IL-21 was a more potent up-regulator of T-bet mRNA levels compared with
that of IL-15.
|
|
gene in NK-92 cells (Fig. 1
gene more
efficiently compared with that of IL-21, whereas in NK-92 cells both
cytokines induced IL-2R
mRNA synthesis equally well (Figs. 1
2 expression in NK-92 cells,
as has previously been shown in T cells (20). In T cells,
IL-15-induced IL-12R
2 mRNA expression was more efficient compared
with that of IL-21. (Figs. 1
and IL-18R
in
NK-92 and T cells.
IL-15 induces STAT5 DNA binding to the IL-2R
GAS-c/GAS-n element
in NK-92 cells
The IL-2R
gene contains an upstream STAT5-binding
element that is essential for IL-2-induced IL-2R
transcription
(21, 22). To characterize IL-15- and IL-21-induced STAT
DNA binding to the GAS-c/GAS-n element (from -3778 to -3740) of the
IL-2R
gene, NK-92 cells were stimulated with IL-15 or
IL-21 for different time periods, and nuclear extracts were prepared
followed by analysis with EMSA. As shown in Fig. 3
A, EMSA with the IL-2R
GAS-c/GAS-n oligonucleotide revealed the induction of one major
protein-DNA complex in response to IL-15 stimulation. The IL-15-induced
complex was already seen at 1 h after the cytokine stimulation.
The complex induced by IL-15 was identified with specific anti-STAT
Abs. Both anti-STAT1 and anti-STAT5 Abs supershifted the
IL-15-induced complex (Fig. 3
B). IL-21 stimulation of NK-92
cells did not induce detectable STAT5 binding to IL-2R
GAS-c/GAS-n.
|
In addition to the IL-2R
gene, both IL-15 and IL-21
up-regulated MyD88 gene expression. MyD88 is a cytoplasmic
adapter protein involved in IL-18 and Toll-like receptor signal
transduction and it is an essential factor in innate immunity
(23, 24). To study possible STAT binding to MyD88 GAS, we
stimulated NK-92 cells with IL-15 or IL-21, prepared nuclear extracts,
and analyzed them by EMSA. As shown in Fig. 4
A, both IL-15 and IL-21
induced STAT binding to MyD88 GAS. The differential mobility of IL-21-
and IL-15-induced protein-DNA complexes in the gel suggested that these
cytokines activate different STATs. To identify IL-15- and
IL-21-induced complexes, we performed supershift experiments with
anti-STAT Abs. Anti-STAT5 and anti-STAT1 Abs supershifted both
of the IL-15-induced MyD88 GAS complexes, whereas anti-STAT3 Ab
supershifted IL-21-induced MyD88 GAS binding complexes (data not
shown).
|
IL-21 induces STAT3 binding in primary NK and T cells
Next, we analyzed whether IL-21 was able to activate STAT3 also in
primary human NK and T cells. NK and T cells were purified as described
in Materials and Methods. The cells were stimulated with
IL-15 or IL-21 and nuclear extracts were prepared followed by EMSA.
Similar to NK-92 cells, IL-15 induced STAT5 and IL-21 induced STAT3 DNA
binding to SIE in primary NK cells (Fig. 5
A). Anti-STAT5 Ab
supershifted the IL-15-induced protein-DNA complex, whereas the
IL-21-induced complex was supershifted by anti-STAT3 Ab. In
contrast to NK cells, stimulation of primary T cells with IL-21 induced
both STAT3 and STAT5 binding to SIE (Fig. 5
B).
|
Since IL-21 induced STAT3 DNA binding to SIE and MyD88 GAS probes,
we verified STAT3 activation with antiphosphotyrosine analysis. NK-92
and T cells were stimulated with IL-15 or IL-21 and proteins in
cytokine-stimulated cell lysates were immunoprecipitated with
anti-STAT3 or anti-STAT5 Abs followed by Western blot analysis
with anti-phosphotyrosine Ab. As a control, cells were stimulated
with IFN-
which is known to activate multiple STAT proteins
(13). In unstimulated NK-92 cells, STAT3 or STAT5 tyrosine
phosphorylation was not detectable, whereas IFN-
, IL-15, and
especially IL-21 induced very efficiently STAT3 tyrosine
phosphorylation (Fig. 6
A).
Very strong STAT5 tyrosine phosphorylation was seen in IL-15-stimulated
NK-92 cells. In addition, a weak tyrosine phosphorylation of STAT5 was
also detected in cells stimulated with IFN-
or IL-21 (Fig. 6
A). Similar to NK-92 cells, IFN-
and IL-21 induced STAT3
tyrosine phosphorylation in T cells (Fig. 6
B), whereas IL-15
stimulation of T cells activated STAT5 tyrosine phosphorylation (Fig. 6
B).
|
A recent study by Asao et al. (2) suggested that
IL-21 stimulation lead to the activation of JAK1 and JAK3 in a
c-transfected T cell line. We analyzed whether
JAK1 or JAK3 was activated by IL-21 also in NK and T cells. For that,
NK-92 and T cells were stimulated with IL-15 or IL-21 and proteins in
cell lysates were immunoprecipitated with anti-JAK1 or
anti-JAK3 Abs followed by Western blot analysis with an
anti-phosphotyrosine Ab. IL-15 and IL-21 induced JAK3 tyrosine
phosphorylation in both cell types efficiently (Fig. 7
). Instead, IL-15 and IL-21 had a weak
enhancing effect on JAK1 tyrosine phosphorylation (Fig. 7
).
|
IL-12 is a key cytokine in regulating NK and T cell activation
(26). Because IL-15 and IL-21 stimulation of NK-92 cells
enhanced IL-12R
2 gene expression, we studied
whether pretreatment of cells with IL-15 or IL-21 would result in
enhanced IL-12-induced STAT4 DNA binding. For that, NK-92 cells were
pretreated with IL-15 or IL-21 for 18 h and after that the cells
were left untreated or stimulated with IL-12 for 1 h followed by
EMSA with IL-2R
GAS-c/GAS-n probe. Both IL-15 and IL-21 priming
enhanced IL-12-stimulated STAT4 binding to IL-2R
GAS-c/GAS-n (Fig. 8
).
|
| Discussion |
|---|
|
|
|---|
leads to a severe reduction or absence of NK cells (29, 30). In contrast, constitutive production of IL-15 over several
months in IL-15-transgenic mice led to the development of T-NK
lymphocytic leukemia (31). In the present study, we
investigated the effect of IL-15 and IL-21 on the expression of genes
that are important for NK and T cell function. In this report, we show
that IL-15 and IL-21 stimulation of human NK and T cells induces the
expression of IFN-
, T-bet,
IL-2R
, IL-12R
2,
IL-18R, and MyD88 genes.
IFN-
has a major role as a regulator of innate and adaptive immune
responses. IFN-
promotes innate and Th1 immune responses by
activating macrophages, NK cells and T cells, as well as by enhancing
Ag presentation (32). The results reported here show that
IL-15 and IL-21 enhance the expression of the IFN-
gene
in NK and T cells. Both IL-15 and IL-21 up-regulated IFN-
mRNA
synthesis already at 1 h after stimulation, suggesting that these
cytokines directly activate IFN-
gene expression at the
transcriptional level. IFN-
production is induced by TCR ligation or
macrophage-derived cytokines such as IFN-
, IL-12, and IL-18
(33, 34, 35). IL-18 is essential for IFN-
production both
in bacterial and viral infections (36, 37). IL-18R
consists of two subunits, IL-18R
and IL-18R
(37).
IL-18R
belongs to the IL-1R family, using the IL-1R-associated
kinase-NF-
B signaling pathway. Activation of these receptors
requires an adapter protein, MyD88 (38, 39). We
demonstrate that IL-15 and IL-21 enhance mRNA expression of IL-18R and
MyD88. Moreover, our results suggest that these cytokines also
indirectly enhance IFN-
production and, consequently, Th1 response
by inducing IL-18R expression in NK cells.
IL-12 is the major cytokine driving Th1 differentiation. Th1
differentiation also requires transcription factor T-bet that activates
IFN-
and IL-12R
2 gene expression
(19). A recent study shows that T-bet is required for
IFN-
production in CD4 and NK cells, but not in CD8 T cells
(40). T-bet can also stimulate indirectly its own gene
expression by inducing IFN-
, which in turn activates
T-bet gene expression (41, 42). We demonstrate
here that both IL-15 and IL-21 up-regulate the mRNA synthesis for
T-bet and IL-12R
2 genes in NK and T
cells. Furthermore, pretreatment of NK-92 cells with IL-15 or IL-21
resulted in enhanced IL-12-induced STAT4 DNA binding. These results
suggest that both IL-15 and IL-21 have effects that can enhance a
Th1-type immune response.
Receptors for IL-2, IL-15, and IL-21 share the same
c (2, 43). In addition, the
IL-2/IL-15R
subunit that is essential for the proliferation of NK
and T cells is also closely related to IL-21R. IL-2 and IL-15 utilize
STAT5 in their intracellular signal transduction and STAT5 is essential
for IL-2-induced T cell proliferation (44). Asao et al.
(2) demonstrated that IL-21 uses
c in signaling and activates STAT3 in a human
T cell leukemia virus I-transformed human T cell line. They also showed
that the phosphorylation of JAK1 and JAK3 was enhanced by IL-21. We
show here that in primary T cells and NK-92 cells IL-21- and especially
IL-15-induced JAK3 tyrosine phosphorylation was efficient. In contrast,
IL-21 had a modest enhancing effect on JAK1 tyrosine phosphorylation in
both cell types.
As shown in the present report, IL-15 stimulation of NK-92 cells
activated STAT5 DNA binding to the IL-2R
promoter element and
induced IL-2R
mRNA synthesis. Similar IL-15-induced STAT5 DNA
binding was also detected in human primary NK and T cells. The results
are consistent with an earlier report demonstrating that STAT5 and, to
some extent, STAT1 and STAT3 are activated by IL-15 in NK and T cells
(45). Using MyD88 GAS and SIE elements in EMSA and
analysis of STAT tyrosine phosphorylation, we demonstrated that IL-21
activates STAT3 not only in human NK-92 cell line but also in human
primary NK and T cells. In NK-92 cells, IL-21-induced STAT binding to
the IL-2R
promoter element was not detected although the mRNA
synthesis for IL-2R
was enhanced. Similarly, IL-21 was not able to
induce STAT DNA binding to recently described IL-2R
GAS elements
residing in the first intron of the IL-2R
gene (data not
shown) (46). These results suggest that IL-21 activates
other signaling pathways, leading to the activation of the
IL-2R
gene. In conclusion, our results demonstrate that
IL-15 and IL-21 enhance the innate as well as Th1 immune response by
activating different STATs, which is followed by the induction of
IFN-
, T-bet, IL-2R
,
IL-12R
2, IL-18R, and
MyD88 gene expression in NK and T cells.
| Acknowledgments |
|---|
and MyD88 cDNAs and Teija Westerlund and Marika Yliselä
for expert technical assistance. | Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Mari Strengell, Department of Microbiology, National Public Health Institute, Mannerheimintie 166, FIN-00300 Helsinki, Finland. E-mail address: mari.strengell{at}ktl.fi ![]()
3 Abbreviations used in this paper:
c, common
-chain; GAS, IFN-
-activated sequence; SIE, c-sis-inducible element; JAK, Janus kinase; MyD88, myeloid differentiation factor 88. ![]()
Received for publication January 28, 2002. Accepted for publication July 24, 2002.
| References |
|---|
|
|
|---|
-chain is an indispensable subunit of the IL-21 receptor complex. J. Immunol. 167:1.
chain. Proc. Natl. Acad. Sci. USA 97:11439.
chain are susceptible to infection with avirulent Salmonella enterica subsp. enterica serovar choleraesuis but mice lacking IL-2 are resistant. Infect. Immun. 2:1226.
and IL-18 synergistically enhance IFN-
production in human NK cells: differential regulation of Stat4 activation and IFN-
gene expression by IFN-
and IL-12. Eur. J. Immunol. 31:2236.[Medline]
production by the stress kinase p38 and by the extracellular regulated kinases p44erk-1 and p42erk-21. J. Immunol. 165:1307.
activates multiple STAT proteins and up-regulates proliferation-associated IL-2R
, c-myc, and pim-1 genes in human T cells. Blood 93:1980.
. Biochem. J. 303:831.
and IL-12 induce IL-18 receptor gene expression in human NK and T cells. J. Immunol. 165:1933.
chain promoter is a composite element that binds Stat5, Elf-1, HMG-I(Y) and GATA family protein. EMBO J. 15:5627.[Medline]
gene. Mol. Cell. Biol. 16:6829.[Abstract]
2 subunit. J. Immunol. 165:4985.
and its receptor. Annu. Rev. Immunol. 11:571.[Medline]
by IL-12/IL-18-activated macrophages requires STAT4 signaling and is inhibited by IL-4. J. Immunol. 166:3075.
/
and IL-18 synergistically enhance IFN-
gene expression in human T cells. J. Immunol. 160:6032.
promoter in primary CD4+ T lymphocytes. J. Immunol. 160:3642.
responses during viral infection. J. Immunol. 165:4787.
production in CD4 and CD8 T cell. Science 295:338.
in lymphoid and myeloid cells. Proc. Natl. Acad. Sci. USA 26:15137.
henrich, C. A. J., J. P. Di Santo. 2001. Cytokines: IL-21 joins the
c-dependent network?. Curr. Biol. 11:R175.[Medline]
chain gene regulation: importance of two widely separated IL-2 response elements. Immunity 15:159.[Medline]This article has been cited by other articles:
![]() |
D. T. Avery, C. S. Ma, V. L. Bryant, B. Santner-Nanan, R. Nanan, M. Wong, D. A. Fulcher, M. C. Cook, and S. G. Tangye STAT3 is required for IL-21-induced secretion of IgE from human naive B cells Blood, September 1, 2008; 112(5): 1784 - 1793. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Leonard, R. Zeng, and R. Spolski Interleukin 21: a cytokine/cytokine receptor system that has come of age J. Leukoc. Biol., August 1, 2008; 84(2): 348 - 356. [Abstract] [Full Text] [PDF] |
||||
![]() |
D Fina, M Sarra, R Caruso, G Del Vecchio Blanco, F Pallone, T T MacDonald, and G Monteleone Interleukin 21 contributes to the mucosal T helper cell type 1 response in coeliac disease Gut, July 1, 2008; 57(7): 887 - 892. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Xing, C. J. Cardona, J. Li, N. Dao, T. Tran, and J. Andrada Modulation of the immune responses in chickens by low-pathogenicity avian influenza virus H9N2 J. Gen. Virol., May 1, 2008; 89(5): 1288 - 1299. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Smyth, M. W.L. Teng, J. Sharkey, J. A. Westwood, N. M. Haynes, H. Yagita, K. Takeda, P. V. Sivakumar, and M. H. Kershaw Interleukin 21 Enhances Antibody-Mediated Tumor Rejection Cancer Res., April 15, 2008; 68(8): 3019 - 3025. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. S. Phoon, A. R. Kitching, D. Odobasic, L. K. Jones, T. J. Semple, and S. R. Holdsworth T-bet Deficiency Attenuates Renal Injury in Experimental Crescentic Glomerulonephritis J. Am. Soc. Nephrol., March 1, 2008; 19(3): 477 - 485. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Caprioli, M. Sarra, R. Caruso, C. Stolfi, D. Fina, G. Sica, T. T. MacDonald, F. Pallone, and G. Monteleone Autocrine Regulation of IL-21 Production in Human T Lymphocytes J. Immunol., February 1, 2008; 180(3): 1800 - 1807. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. D. Davis, K. Skak, M. J. Smyth, P. E.G. Kristjansen, D. M. Miller, and P. V. Sivakumar Interleukin-21 Signaling: Functions in Cancer and Autoimmunity Clin. Cancer Res., December 1, 2007; 13(23): 6926 - 6932. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hiromura, T. Kishida, H. Nakano, T. Hama, J. Imanishi, Y. Hisa, and O. Mazda IL-21 Administration into the Nostril Alleviates Murine Allergic Rhinitis J. Immunol., November 15, 2007; 179(10): 7157 - 7165. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Liu, G. Lizee, Y. Lou, C. Liu, W. W. Overwijk, G. Wang, and P. Hwu IL-21 synergizes with IL-7 to augment expansion and anti-tumor function of cytotoxic T cells Int. Immunol., October 1, 2007; 19(10): 1213 - 1221. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Onoda, M. Rahman, H. Nara, A. Araki, K. Makabe, K. Tsumoto, I. Kumagai, T. Kudo, N. Ishii, N. Tanaka, et al. Human CD4+ central and effector memory T cells produce IL-21: effect on cytokine-driven proliferation of CD4+ T cell subsets Int. Immunol., October 1, 2007; 19(10): 1191 - 1199. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Casey and M. F. Mescher IL-21 Promotes Differentiation of Naive CD8 T Cells to a Unique Effector Phenotype J. Immunol., June 15, 2007; 178(12): 7640 - 7648. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Zeng, R. Spolski, E. Casas, W. Zhu, D. E. Levy, and W. J. Leonard The molecular basis of IL-21-mediated proliferation Blood, May 15, 2007; 109(10): 4135 - 4142. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. White, S. Krishnan, N. Strbo, H. Liu, M. A. Kolber, M. G. Lichtenheld, R. N. Pahwa, and S. Pahwa Differential effects of IL-21 and IL-15 on perforin expression, lysosomal degranulation, and proliferation in CD8 T cells of patients with human immunodeficiency virus-1 (HIV) Blood, May 1, 2007; 109(9): 3873 - 3880. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zamai, C. Ponti, P. Mirandola, G. Gobbi, S. Papa, L. Galeotti, L. Cocco, and M. Vitale NK Cells and Cancer J. Immunol., April 1, 2007; 178(7): 4011 - 4016. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Frohlich, B. J. Marsland, I. Sonderegger, M. Kurrer, M. R. Hodge, N. L. Harris, and M. Kopf IL-21 receptor signaling is integral to the development of Th2 effector responses in vivo Blood, March 1, 2007; 109(5): 2023 - 2031. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pene, L. Guglielmi, J.-F. Gauchat, N. Harrer, M. Woisetschlager, V. Boulay, J.-M. Fabre, P. Demoly, and H. Yssel IFN-{gamma}-Mediated Inhibition of Human IgE Synthesis by IL-21 Is Associated with a Polymorphism in the IL-21R Gene J. Immunol., October 15, 2006; 177(8): 5006 - 5013. [Abstract] [Full Text] [PDF] |
||||
![]() |
|