| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Department of Dermatology, University of Texas Southwestern Medical Center, Dallas, TX 75390
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, IL-2, and IL-4; and surface expression
of CD69. Conversely, DO11.10 T cells delivered maturation signals to
DC, leading to IL-6 and IL-12 production and CD40 up-regulation. FK506
(10-10–10-8 M) and cyclosporin A
(10-9–10-7 M) each blocked efficiently and
uniformly all the changes resulting from intercellular signaling in
both DC
T cell and T cellDC directions. Dexamethasone
(10-9–10-6 M) suppressed all changes, except
for CD69 up-regulation, rather incompletely. Remarkably, RAP
(10-10–10-8 M) efficiently inhibited
DC-induced T cell proliferation and T cell-mediated CD40 up-regulation
by DC without abrogating other changes. Interestingly, T
cell-independent DC maturation triggered by LPS stimulation was
inhibited by dexamethasone, but not by other agents. Our results
demonstrate contrasting pharmacological effects of RAP vs calcineurin
inhibitors on Ag presentation, thus forming a conceptual framework for
rationale-based selection (and combination) of immunosuppressive agents
for clinical application. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CyA and FK506 bind to cyclophilin A and 12-kDa FK506 binding protein
(FKBP12), respectively. The CyA-cyclophilin A and the FK506-FKBP12
complexes bind to the same target, calcineurin, thereby inhibiting
TCR-mediated signal transduction pathways (e.g., NFAT-dependent
transcription of cytokine genes) (1, 2, 3). Although RAP and
FK506 share the same receptor FKBP12, the RAP-FKBP12 complex binds to a
distinct molecular target, known as mammalian target of RAP. The
RAP-FKBP12-mammalian target of RAP complex inhibits phosphorylation of
p70 S6 kinase and phosphorylated heat- and acid-stable
protein-1, thereby inhibiting protein synthesis at the
translational level. The same complex also blocks cytokine-mediated
signal transduction pathways (via inhibiting the dissociation of
p27kip1 from cyclin C kinases) and CD28-mediated
NF-
B activation pathways (via inhibiting IB
phosphorylation)
(3, 4, 5, 6). Glucocorticoids inhibit gene transcription
directly by competing for DNA binding sites in the promoter regions or
indirectly by cross-coupling with many transcription factors, including
AP-1 and NF-B (7, 8, 9). A synthetic glucocorticoid,
dexamethasone (DEX), has been reported recently to attenuate early
steps of TCR signaling by affecting the membrane compartmentalization
of key transducing molecules (10). Thus, the four
immunosuppressants differ from each other in their molecular mechanisms
of action.
T cells act as major effectors, causing tissue damage in immunological
diseases, and thus may serve as a relevant cellular target for
immunosuppressive agents. In fact, many studies in early 1990s
documented potent activities of CyA, FK506, and DEX to inhibit
production of IL-2 and other cytokines, IL-2R expression, and
proliferation by T cells in response to mitogenic stimuli, such as
lectins, phorbol ester plus calcium ionophore, or anti-CD3 mAb plus
anti-CD28 mAb (11, 12, 13, 14, 15, 16). By contrast, RAP inhibits
mitogen-induced proliferation of T cells without affecting cytokine
production or cytokine receptor expression, and it also suppresses T
cell proliferative responsiveness to exogenously added growth factors
(12, 13). Thus, unlike calcineurin inhibitors, which
primarily block TCR-dependent signaling pathways (signal 1), RAP
appears to inhibit costimulatory signaling pathways (signal 2) and
cytokine receptor-mediated signaling pathways (signal 3)
(17). Dendritic cells (DC), which are responsible for
initiating Ag-specific T cell responses (18), are a second
putative cellular target. FK506, CyA, and DEX have been reported to
inhibit the generation (or differentiation) of DC from their
progenitors in vitro and/or their subsequent maturation induced by CD40
ligand (CD40L), TNF-, or LPS (19, 20, 21, 22, 23). RAP has been
shown recently to trigger apoptosis of DC progenitors in vitro without
affecting their CD40L-induced maturation (24). Thus, each
immunosuppressant can alter some functions of T cells and DC.
During Ag presentation, DC deliver signals 1–3 to naive T cells, leading to their priming, differentiation, and clonal expansion. At the same time, DC appear to receive maturation signals from responding T cells. For example, coupling of CD40 (on DC) with CD40L (on T cells) triggers secretion of IL-12 and other cytokines by DC and augments their T cell stimulatory capacity (25, 26, 27, 28). We reported previously that an immature DC line, XS52, exhibited a series of maturational changes upon Ag-specific interaction with T cell clones (29, 30, 31). A key question would then concern potential impacts of immunosuppressants on such bidirectional DC-T cell communication during Ag presentation. Here we address this question using an in vitro Ag presentation system in which bone marrow-derived DC and CD4+ T cells isolated from DO11.10 TCR transgenic mice are cocultured in the presence of relevant Ag.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
BALB/c mice (6- to 8-wk-old females) and DO11.10 transgenic mice (32) (6- to 10-wk-old animals) were used in this study. DO11.10 mice were housed under specific pathogen-free conditions in the Animal Research Center facilities at University of Texas Southwestern Medical Center.
Reagents and Abs
DEX, CyA, and RAP were purchased from Sigma (St. Louis, MO) and dissolved in ethanol to prepare stock solutions at 10-2, 10-3, and 10-4 M, respectively. FK506 obtained from Calbiochem (La Jolla, CA) was dissolved in ethanol at a stock concentration of 10-4 M. These reagents were added to the culture medium at various concentrations with the constant ethanol concentration of 0.1%. The OVA323–339 peptide was synthesized at the Biopolymers Facility, University of Texas Southwestern Medical Center. None of the reagents contained detectable amounts of endotoxin as tested by the OCL-100 system (BioWhittaker, Walkersville, MD). LPS (Escherichia coli 026:B6) and Con A were obtained from Sigma and Amersham Pharmacia Biotech (Piscataway, NJ), respectively. The mAb KJ1.26, which recognizes the transgenic TCR complex expressed by DO11.10 T cells, and its isotype-matched control IgG were purchased from Caltag (Burlingame, CA). Other mAbs were purchased from BD PharMingen (San Diego, CA). Recombinant mouse GM-CSF, IL-4, and IL-12 were purchased from R&D Systems (Minneapolis, MN).
Cell preparations
CD4+ T cells were purified from spleens of DO11.10 mice using magnetic beads (Dynabeads Mouse CD4-L3T4 and DETACHaBEAD Mouse CD4, Dynal, Oslo, Norway), followed by depletion of I-A+ contaminants by anti-MHC class II (I-A) microbeads (Miltenyi Biotec, Auburn, CA). The resulting T cell preparations containing 97–99% CD4+ cells were used without further purification. Short term (7-day) Th1 or Th2 cultures were generated from DO11.10 CD4+ T cells in the presence of IL-12 plus anti-IL-4 mAb or IL-4 plus anti-IL-12 mAb, respectively (33). Bone marrow-derived DC were generated from BALB/c mice in complete RPMI 1640 medium (34) in the presence of 10 ng/ml GM-CSF as described previously (35, 36). The resulting DC preparations harvested on days 5–7 contained 72–92% CD11c+ cells and expressed a characteristic phenotype of immature DC. In some experiments CD11c+ fractions (>99% purity) were isolated from the above bone marrow-derived DC preparations using MACS CD11c microbeads (Miltenyi Biotec).
In vitro Ag presentation assays
Freshly isolated DO11.10 T cells (2.5 x 105 cells/ml) were cocultured with gamma-irradiated (1500 rad) bone marrow-derived DC (5 x 104 cells/ml) and 2 µg/ml OVA peptide. To test the secondary activation, Th1 and Th2 T cells (5 x 104 cells/ml) were cocultured with gamma-irradiated DC (5 x 103 cells/ml). Cells were pulsed for 8 h with [3H]thymidine (1µCi/well) and were harvested on day 3 for the primary response or on day 2 for the secondary response (34).
Phenotype, cell viability, and apoptosis assays
DO11.10 T cells and bone marrow-derived DC were cocultured for 20 or 24 h with OVA peptide in the presence of each immunosuppressant. The samples were then examined for CD69 expression within the KJ1.26+ T cell populations (expressing the transgenic TCR complex) and for the expression of CD40, I-Ad, CD80, and CD86 within the CD11c+ DC populations using FACSCalibur (BD Immunocytometry Systems, San Jose, CA). Viabilities of T cells and DC were assessed by measuring propidium iodine (PI) uptake by the KJ1.26+ populations and CD11c+ populations, respectively. To examine an early apoptotic change, we counted the numbers of PI-negative/annexin V-positive cells after staining with Cy5-conjugated annexin V (BD PharMingen).
Cytokine analyses
To study cytokine release by DC, supernatants from cocultures of
DC (4 x 105 cells/ml) and T cells (2
x 106 cells/ml) were examined by ELISA for IL-6,
IL-12 p40, and IL-12 p70. To study cytokine release by T cells,
supernatants from cocultures of T cells (1 x
105 cells/ml) and DC (1 x
104 cells/ml) were examined for IL-2, IL-4, and
IFN-. To assess intracellular cytokine deposition, DC (2 x
106 cells/ml) and T cells (8 x
106 cells/ml) were cocultured for 22 h in
the presence of brefeldin A added during the last 5-h period (to
inhibit intracellular transport processes). Subsequently, samples were
labeled with FITC-anti-CD11c mAb or FITC-anti-CD4 mAb, fixed
and permeabilized with the Cytofix/Cytoperm solution (BD PharMingen),
and stained with PE-conjugated mAb against IL-2, IL-4, IFN-, IL-6,
or IL-12.
CCR7 mRNA analysis
CD11c+ DC fractions sorted by magnetic
beads were examined for CCR7 mRNA expression by real-time RT-PCR
(37). Briefly, total RNA (1 µg/sample) was reverse
transcribed using Omniscript reverse transcriptase (Qiagen, Valencia,
CA), and the resulting cDNA (16 ng/sample) was subjected to real-time,
semiquantitative PCR using the iCycler (Bio-Rad, Hercules, CA) with
SYBR Green I (Qiagen). Based on the threshold cycle numbers for CCR7
and 
-actin, the relative expression levels for CCR7 were calculated
using the iCycler software. The following primers were used to amplify
CCR7 signals: CAAGAAGGATGTGCGGAACT (5' primer) and TAGGCCCAGAAGGGAAGAAT
(3' primer).
Statistical analyses
Dose-dependency data were analyzed using the nonlinear regression equation library in the SigmaPlot 2001 software (SPSS, Chicago, IL).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
An overwhelming majority of the CD4+ T cells
isolated from DO11.10 TCR transgenic mice expressed a characteristic
phenotype of naive T cells, i.e., CD25-
(>95%), CD69- (>97%),
CD62Lhigh (>84%), CD44low
(>91%), and CD45RBhigh (>98%; data not
shown). These populations were used without further purification as
responder T cells. Bone marrow-derived DC cultures generated from
BALB/c mice were used as relevant APC; these cultures propagated in the
presence of GM-CSF alone for 5–7 days contained 72–92%
CD11c+ cells. As reported previously (19, 38), these CD11c+ populations expressed
relatively low amounts of I-A molecule and costimulatory molecules
(CD40, CD80, and CD86; Fig. 1
A). To further assess the
state of maturation of these DC preparations, we examined mRNA
expression for CCR7, which is known to be up-regulated upon DC
maturation (39, 40, 41). Real-time PCR analyses revealed that
CCR7 mRNA expression was detectable in a magnetic bead-purified
CD11c+ DC population (Fig. 1B).
Importantly, the relative expression level of CCR7 mRNA in this
population was rather modest (
20%) compared with that observed
after LPS stimulation. These results indicate the relative immaturity
of the DC preparations used in the present study.
|
C). DEX (10-6
M) also down-regulated I-A and CD86 expression marginally, whereas RAP
(10-8 M) showed no significant inhibition. DC
viability, as assessed by PI uptake by the CD11c+
populations, remained unchanged after exposure to any drugs. These
observations suggest that the four immunosuppressants, when tested in
the absence of other stimuli, only modestly alter the surface phenotype
of our DC preparations.
Bone marrow-derived DC (generated from BALB/c mice) induced robust
proliferation of CD4+ T cells purified from the
DO11.10 TCR transgenic mice (on a BALB/c background) in the presence of
OVA peptide in a manner dependent upon DC numbers, Ag concentrations,
and culture periods (Fig. 2A).
Importantly, DC failed to activate DO11.10 T cells in the absence of
OVA peptide. Considering that FCS in our culture medium contains many
xenogenic proteins, we interpreted this to validate the Ag specificity
of our in vitro Ag presentation assay. The availability of relatively
large numbers of Ag-specific CD4+ T cells
exhibiting a naive phenotype (1 x 107
cells/mouse) and DC showing a relatively immature phenotype (1
x 107 cells/mouse) has allowed us to study in a
systematic fashion the pharmacological activities of different
immunosuppressants to regulate bidirectional intercellular
communication between DC and T cells during Ag presentation.
|
To study the effects of immunosuppressive agents on DC-dependent
activation of naive T cells, we first added each agent at graded
concentrations to the "complete" cocultures containing bone
marrow-derived DC, DO11.10 T cells, and OVA peptide. DC-induced T cell
proliferation was suppressed most efficiency by RAP and FK506, with
25–75% inhibition achieved at
10-10–10-8 M (Fig. 2B). The dose-response curve for CyA was almost
superimposable on that for FK506, although CyA required 50 times
higher concentrations to achieve similar inhibition. DEX inhibited T
cell proliferation only partially even at the highest concentration
(10-5 M). These results indicate a quantitative
difference among the immunosuppressants in their relative efficacies to
inhibit DC-dependent T cell proliferation.
DO11.10 T cells produced IFN-, IL-2, and IL-4 upon Con A
stimulation, whereas bone marrow-derived DC secreted IL-6 and IL-12 p40
in response to LPS treatment (data not shown). These results suggested
their potential to secrete respective cytokines during Ag presentation.
In fact, all the above cytokines were detected by ELISA in the
supernatants from the complete cocultures (Fig. 3A). By contrast, none of
these cytokines was detected at significant levels in incomplete
cocultures lacking any single component. To identify the relevant cell
type responsible for the production of each cytokine, we next examined
intracellular cytokine deposition by FACS. When T cells and DC were
cocultured in the presence of OVA peptide, intracellular accumulation
of IL-2 was observed in 15.2% of the CD4+
populations, whereas no IL-2-containing CD4+
cells were detected in the absence of Ag (Table I). By contrast, only minor fractions
(1.7%) of the CD11c+ population exhibited
intracellular IL-2. Likewise, relatively small, but significant,
numbers of CD4+ cells, but not
CD11c+ cells, expressed intracellular
accumulation of IL-4 and IFN- only in the complete coculture.
Although the frequencies of those cytokine-producing T cells may appear
rather low, our findings are in complete agreement with the previous
report that only limited fractions of DO11.10 T cells express mRNA for
the above cytokines upon stimulation (44). Conversely,
intracellular deposition of IL-6 and IL-12 p40 became detectable almost
exclusively within the CD11c+ populations in the
complete coculture, but not in the incomplete coculture lacking OVA
peptide. Thus, IL-2, IL-4, and IFN- are produced primarily by T
cells in our in vitro Ag presentation system, whereas DC serve as the
main source for IL-6 and IL-12 p40. Our observations also highlight the
bidirectionality of Ag-specific DC-T cell interaction, with DC
triggering the production of selected cytokines by naive T cells, while
T cells inducing the secretion of different cytokines by DC.
|
|
,
IL-2, and IL-4 by T cells (Fig. 3B, upper
panels). All three cytokines were inhibited by FK506 uniformly at
similar concentrations
(10-10–10-8 M). DEX was
the second most potent, although it inhibited IL-2 secretion only
partially even at 10-5 M. Again, CyA required
30–50 times higher concentrations than did FK506 to inhibit each
cytokine. Importantly, RAP even at the highest concentration
(10-7 M) failed to markedly suppress the
production of any cytokine by T cells. None of the drugs at the tested
doses affected the viability of T cells, as tested by PI uptake (Fig. 3B, upper right panel).
DO11.10 T cells began to express CD69 after 20-h coculture with DC and
OVA peptide (Fig. 4A,
left panels). Conversely, CD40 expression by DC was
up-regulated after coculture with T cells and Ag (Fig. 4A,
right panels). Neither of these phenotypic changes was
observed in any incomplete coculture. These results again highlight the
bidirectionality of DC-T cell interaction, with DC triggering CD69
expression by T cells, while T cells induce CD40 up-regulation by DC.
In two independent experiments, FK506
(10-9–10-8 M) caused
significant, albeit incomplete, inhibition of DC-induced CD69
expression by T cells (Fig. 4B, left panel). CyA required
30–50 times higher concentrations to induce similar inhibition. By
contrast, no apparent inhibition of CD69 expression was achieved with
RAP (up to 10-7 M) or DEX (up to
10-5 M). Again, none of the drugs at the tested
doses affected the viability of T cells (Fig. 4C).
|
As described above, DC produce IL-6, IL-12 p40, and IL-12 p70 upon
Ag-specific interaction with T cells (Fig. 3A). In two
independent experiments FK506 was significantly more potent than any
other agent in inhibiting DC cytokine production (Fig. 3B,
lower panels). All three cytokines (IL-6, IL-12 p40, and
IL-12 p70) were inhibited by FK506 efficiently (up to 80–100%) and
uniformly at similar concentrations
(10-10–10-8 M). CyA also
inhibited all three cytokines, albeit at 30–50 times higher
concentrations. The extent of DEX-induced suppression was relatively
incomplete (50–60%) even at 10-5 M. RAP at the
tested concentrations (up to 10-7 M) caused only
marginal, if any, inhibition of cytokine production by DC. None of the
drugs at the tested concentrations significantly affected the viability
of DC as examined by PI uptake (Fig. 3B, lower right
panel).
Bone marrow-derived DC elevate CD40 expression during Ag presentation
(Fig. 4A, right panel). RAP inhibited this T
cell-induced CD40 up-regulation by DC most efficiently (at
10-10–10-9 M) and most
completely (50–100% inhibition; Fig. 4B, right
panel). Other agents required significantly higher concentrations
(10-9–10-8 M for FK506
and 10-7–10-6 M for CyA
and DEX) to suppress CD40 up-regulation. Again, none of the agents at
the tested doses affected the viability of DC (Fig. 4C). We
also observed elevated expression of I-A and CD86 by DC in the complete
coculture containing OVA peptide compared with the incomplete coculture
lacking Ag (Fig. 5). Each of the four
agents in the above concentration ranges was found to inhibit this T
cell-dependent I-A and CD86 expression by DC without causing
significant DC death. Taken together, our observations illustrate
quantitative and qualitative differences among the four
immunosuppressants in their pharmacological activities to inhibit
various aspects of T cell-dependent DC maturation.
|
). The presence of OVA peptide in the
coculture did not alter the number of such apoptotic cells in either
population, suggesting that T cell activation signals or DC maturation
signals do not directly initiate apoptotic processes in our
experimental system. Addition of RAP (10-8 M) or
CyA (10-6 M) caused a significant, albeit modest
(5%), increase in the number of apoptotic DC, but not in the number
of apoptotic T cells, corroborating the previous report that RAP at the
same concentration induced externalization of phosphatidylserine in
10% of human DC in 24 h (24). In summary,
although none of the agents caused significant death of DC or T cells
(as measured by PI uptake), RAP and CyA induced an early apoptotic
change in relatively small fractions of DC during Ag presentation.
|
To determine whether any of these immunosuppressants would inhibit
the maturational changes in DC in the absence of T cells, we next
stimulated bone marrow-derived DC with LPS. LPS treatment triggered the
secretion of IL-6 (61.6 ng/ml with LPS vs <0.1 ng/ml without LPS) and
IL-12 p40 (42.9 vs <0.1 ng/ml), and it also up-regulated CD40
expression (with mean fluorescence intensity values of 651 vs 58). As
shown in Fig. 6, DEX at
10-8–10-7 M caused
partial (50%) inhibition of LPS-induced IL-6 and IL-12 p40
production, corroborating the previous report (21). By
contrast, other drugs failed to inhibit cytokine production by
LPS-stimulated DC. Moreover, none of the agents efficiently abolished
LPS-induced CD40 expression by DC. Thus, maturational changes that
occur in DC as a consequence of Ag-specific interaction with T cells
are more susceptible to RAP and calcineurin inhibitors than are the
same changes induced by LPS in the absence of T cells.
|
To test potential effects on the secondary T cell activation, we
generated Th1 and Th2 cells from DO11.10 T cells. The resulting T cell
populations both proliferated vigorously when restimulated with bone
marrow-derived DC and OVA peptide. Proliferative responses of both Th1
and Th2 cells were inhibited most efficiently by FK506 and RAP, with
30–70% inhibition observed at
10-10–10-9 M (Fig. 7A). CyA and DEX were
significantly less potent in suppressing DC-induced proliferation of
primed T cells.
|
and IL-2, while Th2 cells secreted
IL-4 (Fig. 7B, left panels). In the absence of
Ag, neither Th1 nor Th2 cells secreted any cytokine in significant
levels, indicating their Ag specificity. Consistent with our
observations with naive T cells, FK506 (10-8 M)
and CyA (10-6 M) almost completely inhibited
DC-induced IFN- and IL-2 production by Th1 cells as well as IL-4
production by Th2 cells. By contrast, cytokine production by either Th1
or Th2 cells was inhibited only minimally by RAP
(10-8 M) or DEX
(10-7 M).
Conversely, Th1 cells, but not Th2 cells, triggered IL-12 p40 and p70
secretion by DC in an Ag-specific manner (Fig. 7B,
right panels). This IL-12 production was inhibited almost
completely by FK506 (10-8 M) or CyA
(10-6 M) and only marginally by DEX
(10-7 M). In two independent experiments RAP
(10-8 M) failed to significantly suppress
Th1-induced IL-12 production by DC, as we observed with naive T cells.
These observations illustrate contrasting effects of RAP and
calcineurin inhibitors on DC maturation during secondary T cell
activation.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, FK506 at
10-10–10-8 M inhibited
uniformly all tested aspects of DC-induced activation of naive T cells,
including proliferation and secretion of IFN-, IL-2, and IL-4.
Likewise, the second calcineurin inhibitor CyA also uniformly inhibited
all these changes, although requiring 30–50 times higher
concentrations. By marked contrast, RAP at
10-10–10-8 M inhibited
DC-induced T cell proliferation efficiently, while it failed to
abrogate cytokine production even at 10-7 M.
These findings may first appear to simply mirror the previous reports
describing the effects of RAP vs calcineurin inhibitors on T cell
activation triggered by mitogenic lectins, phorbol ester plus calcium
ionophore, or anti-CD3 mAb plus anti-CD28 mAb
(11, 12, 13, 14, 15, 16). However, it should be emphasized that this is
the first report documenting their contrasting influences on
DC-dependent, Ag-specific T cell activation. We have also identified an
additional qualitative difference; FK506 and CyA, but not RAP,
suppressed DC-induced CD69 up-regulation by DO11.10 T cells during Ag
presentation. Vanasek et al. (45) reported very recently
that RAP treatment prevents OVA peptide-triggered clonal expansion of
adoptively transferred DO11.10 T cells without affecting their induced
CD69 expression in living animals (although direct roles played by DC
were not addressed). Taken together, these observations document a
unique pharmacological property of RAP to selectively inhibit T cell
proliferation without affecting other T cell activation-associated
changes.
|
). CyA and DEX also inhibited all these
changes at higher concentrations. Strikingly, RAP at
10-10–10-9 M completely
inhibited CD40 expression by DC, whereas it failed to markedly abolish
their production of any cytokine even at 10-7 M.
These observations introduce a new concept that calcineurin inhibitors
broadly block DCT cell activation and T cellDC maturation signals
being exchanged between DC and T cells during Ag presentation, whereas
RAP exhibits a highly selective inhibitory profile to block rather
limited aspects.
FK506 was indistinguishable from CyA in its overall suppressive
profiles, although FK506 was 30–50 times more potent in each parameter
(Fig. 8). These observations are in agreement with the notion that the
two drugs block the same molecular targets (i.e., calcineurin and its
substrates) and, thus, share therapeutic outcomes and adverse effects
(3, 4). The pharmacological dose ranges we have identified
for FK506 and CyA in our in vitro Ag presentation system correspond
closely to the known therapeutic trough blood levels of 5–15 ng/ml
(0.6–1.8 x 10-8 M) for FK506 and 150–300
ng/ml (1.3–2.5 x 10-7 M) for CyA
(46). Likewise, RAP inhibited DC-dependent T cell
proliferation and T cell-triggered CD40 up-regulation by DC in the dose
range corresponding to its known therapeutic blood levels of 5–15
ng/ml (0.5–1.5 x 10-8 M)
(47).
Several features that distinguish RAP from calcineurin inhibitors have
been observed in animal models of immunological diseases. For example,
Bundick et al. (48) observed that RAP inhibited the
induction of Th2-polarized chronic GVHD in the (C57BL/6 x
DBA/2)F1 recipients after repeated
administrations of parental DBA/2 spleen cells, whereas FK506 and CyA
at relatively low doses enhanced disease development. Although these
authors interpreted their in vivo observations to suggest that
calcineurin inhibitors may selectively suppress Th1-mediated immune
responses, our in vitro data failed to support this concept because
calcineurin inhibitors and RAP effectively inhibited DC-dependent
activation of both Th1 and Th2 subsets. Sehgal’s group (49, 50) reported that spontaneous progression of systemic lupus
erythematosus in MRL/1 mice was prevented by RAP, but not by CyA.
Interestingly, disease development in the above model was closely
associated with the severely impaired ability of T cells to secrete
IL-2 in response to mitogenic stimulation, and this ability was
restored only in those animals treated with RAP. It is, therefore,
tempting to speculate that the observed prophylactic activity of RAP
may be explained in part by its unique pharmacological activity to
inhibit DC-induced T cell activation without markedly affecting IL-2
production. Vogelsang and Hess (51) reported that
administration of CyA, but not RAP, induced GVHD-like autoimmune
reactions in the recipients of syngeneic bone marrow transplantation.
Although mechanisms underlying the above opposing effects remain
unclear, only those animals receiving CyA showed a marked increase in
the number of autoreactive T cells (as defined by V8 TCR
expression), consistent with other reports that calcineurin inhibitors,
but not RAP, affect negative thymic selection of autoreactive T cells
(52, 53). Thus, it will be interesting to determine
whether RAP may differ from calcineurin inhibitors in the impact on
thymic DC, as we have observed with bone marrow-derived DC. Wang et al.
(54) reported that CyA prevented allogeneic heart graft
rejection only when administered from the day of transplantation,
whereas RAP treatment was effective even when started 4 days after
transplantation. Likewise, RAP and CyA both showed significant
prophylactic and therapeutic efficacies to suppress the progression of
adjuvant arthritis, whereas rebound of the disease state was observed
after discontinuation of CyA, but not RAP (50, 55). These
differences may be explained at least partially by the current idea
that CyA efficiently inhibits early events (e.g., cytokine production
and cytokine receptor expression) in DC-induced activation of naive T
cells, whereas RAP inhibits subsequent events, including
cytokine-mediated expansion of activated T cells. Alternatively, the
unique inhibitory impact of RAP on T cell-dependent DC maturation
(i.e., blocking CD40 expression without abrogating their cytokine
production) may explain a causative mechanism by which RAP induces
long-lasting tolerance. In this regard, Li et al. (56)
reported recently that stable acceptance of allogeneic skin grafts is
achievable by a combination of RAP and costimulation blockers (CTLA4-Ig
plus anti-CD40L mAb), but not by a combination of CyA and the same
blockers. They postulated that costimulation blockers alone reduce the
frequency of proliferating allo-reactive T cells, while added RAP
promotes apoptosis of such proliferating T cells via activation-induced
cell death. By contrast, the combination of the costimulation blockers
and CyA inhibits both signal 1 and signal 2, leading to complete
inhibition of proliferation and apoptosis of allo-reactive T cells.
Although neither RAP nor CyA showed a significant effect on DC-induced
T cell apoptosis in our system, it will be interesting to determine
whether contrasting effects on T cell apoptosis may be revealed by
addition of the costimulation blockers in the cocultures of DC and T
cells. In summary, RAP clearly differs from calcineurin inhibitors in
their in vivo immunoregulatory profiles, which may be explained by our
observation that RAP differs from CyA and FK506 in their in vitro
pharmacological profiles to inhibit bidirectional DC-T cell
communication in Ag presentation.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Hiroyuki Matsue, Department of Dermatology, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, TX 75390-9069. E-mail address: hiroyuki.matsue{at}utsouthwestern.edu
3 Abbreviations used in this paper: GVHD, graft-vs-host disease; CD40L, CD40 ligand; CyA, cyclosporin A; DC, dendritic cells; DEX, dexamethasone; FK506, tacrolimus; FKBP12, 12-kDa FK506 binding protein; PI, propidium iodine; RAP, rapamycin.
Received for publication April 4, 2002. Accepted for publication July 29, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B activity through induction of IB synthesis. Science 270:286.B by activated glucocorticoid receptors. Mol. Cell Biol. 15:943.[Abstract]
-interferon messenger RNA. J. Immunol. 133:273.[Abstract]
B. Transplantation 68:1255.[Medline]
by a dendritic cell line (XS52) derived from murine epidermis. J. Immunol. 155:3794.[Abstract]
1 and TNF- on the development of dendritic cells from progenitors in mouse bone marrow. Stem Cells 15:144.[Medline]
This article has been cited by other articles:
|
|
 |
|
  H. Tanaka, H. Matsushima, N. Mizumoto, and A. Takashima Classification of Chemotherapeutic Agents Based on Their Differential In vitro Effects on Dendritic Cells Cancer Res., September 1, 2009; 69(17): 6978 - 6986. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Matsushima, H. Tanaka, N. Mizumoto, and A. Takashima Identification of crassin acetate as a new immunosuppressant triggering heme oxygenase-1 expression in dendritic cells Blood, July 2, 2009; 114(1): 64 - 73. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A W Thomson and P D Robbins Tolerogenic dendritic cells for autoimmune disease and transplantation Ann Rheum Dis, December 1, 2008; 67(Suppl_3): iii90 - iii96. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. E. Tschoep and E. Noessner Understand tolerogenic dendritic cells Blood, May 1, 2007; 109(9): 3616 - 3616. [Full Text] [PDF]
|
|
|
|
 |
|
 V. Duplan, G. Beriou, J.-M. Heslan, C. Bruand, P. Dutartre, L. T. Mars, R. S. Liblau, M.-C. Cuturi, and A. Saoudi LF 15-0195 Treatment Protects against Central Nervous System Autoimmunity by Favoring the Development of Foxp3-Expressing Regulatory CD4 T Cells J. Immunol., January 15, 2006; 176(2): 839 - 847. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Matsue, J. Yao, K. Matsue, A. Nagasaka, H. Sugiyama, R. Aoki, M. Kitamura, and S. Shimada Gap Junction-Mediated Intercellular Communication between Dendritic Cells (DCs) Is Required for Effective Activation of DCs J. Immunol., January 1, 2006; 176(1): 181 - 190. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Giaccone, J. S. McCune, M. B. Maris, T. A. Gooley, B. M. Sandmaier, J. T. Slattery, S. Cole, R. A. Nash, R. F. Storb, and G. E. Georges Pharmacodynamics of mycophenolate mofetil after nonmyeloablative conditioning and unrelated donor hematopoietic cell transplantation Blood, December 15, 2005; 106(13): 4381 - 4388. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. N. Georas, J. Guo, U. De Fanis, and V. Casolaro T-helper cell type-2 regulation in allergic disease Eur. Respir. J., December 1, 2005; 26(6): 1119 - 1137. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Mizumoto, J. Gao, H. Matsushima, Y. Ogawa, H. Tanaka, and A. Takashima Discovery of novel immunostimulants by dendritic-cell-based functional screening Blood, November 1, 2005; 106(9): 3082 - 3089. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Lu, K. Fukuda, Y. Nakamura, K. Kimura, N. Kumagai, and T. Nishida Inhibitory Effect of Triptolide on Chemokine Expression Induced by Proinflammatory Cytokines in Human Corneal Fibroblasts Invest. Ophthalmol. Vis. Sci., July 1, 2005; 46(7): 2346 - 2352. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Nakamura, Y. Makino, K. Okamoto, L. Poellinger, K. Ohnuma, C. Morimoto, and H. Tanaka TCR Engagement Increases Hypoxia-Inducible Factor-1{alpha} Protein Synthesis via Rapamycin-Sensitive Pathway under Hypoxic Conditions in Human Peripheral T Cells J. Immunol., June 15, 2005; 174(12): 7592 - 7599. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. E. Brown Morphoproteomic Analysis of Osteolytic Langerhans Cell Histiocytosis with Therapeutic Implications Ann. Clin. Lab. Sci., April 1, 2005; 35(2): 131 - 136. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Harada, M. Shimada, S. Okano, T. Suehiro, Y. Soejima, Y. Tomita, and Y. Maehara IL-12 Gene Therapy Is an Effective Therapeutic Strategy for Hepatocellular Carcinoma in Immunosuppressed Mice J. Immunol., December 1, 2004; 173(11): 6635 - 6644. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. N. Georas Inhaled Glucocorticoids, Lymphocytes, and Dendritic Cells in Asthma and Obstructive Lung Diseases Proceedings of the ATS, November 1, 2004; 1(3): 215 - 221. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Tiefenthaler, S. Hofer, S. Ebner, L. Ivarsson, S. Neyer, M. Herold, G. Mayer, P. Fritsch, and C. Heufler In vitro treatment of dendritic cells with tacrolimus: impaired T-cell activation and IP-10 expression Nephrol. Dial. Transplant., March 1, 2004; 19(3): 553 - 560. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P.-H. Chiang, L. Wang, C. A. Bonham, X. Liang, J. J. Fung, L. Lu, and S. Qian Mechanistic Insights into Impaired Dendritic Cell Function by Rapamycin: Inhibition of Jak2/Stat4 Signaling Pathway J. Immunol., February 1, 2004; 172(3): 1355 - 1363. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Chen, J. Guo, M. Yang, C. Han, M. Zhang, W. Chen, Q. Liu, J. Wang, and X. Cao Cyclosporin A impairs dendritic cell migration by regulating chemokine receptor expression and inhibiting cyclooxygenase-2 expression Blood, January 15, 2004; 103(2): 413 - 421. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Saint-Mezard, C. Chavagnac, S. Bosset, M. Ionescu, E. Peyron, D. Kaiserlian, J.-F. Nicolas, and F. Berard Psychological Stress Exerts an Adjuvant Effect on Skin Dendritic Cell Functions In Vivo J. Immunol., October 15, 2003; 171(8): 4073 - 4080. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Uthaisangsook, N. K. Day, R. Hitchcock, A. Lerner, M. James-Yarish, R. A. Good, and S. Haraguchi Negative Regulation of Interleukin-12 Production by a Rapamycin-Sensitive Signaling Pathway: A Brief Communication Experimental Biology and Medicine, October 1, 2003; 228(9): 1023 - 1027. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Matsue, D. Edelbaum, D. Shalhevet, N. Mizumoto, C. Yang, M. E. Mummert, J. Oeda, H. Masayasu, and A. Takashima Generation and Function of Reactive Oxygen Species in Dendritic Cells During Antigen Presentation J. Immunol., September 15, 2003; 171(6): 3010 - 3018. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Antin, H. T. Kim, C. Cutler, V. T. Ho, S. J. Lee, D. B. Miklos, E. P. Hochberg, C. J. Wu, E. P. Alyea, and R. J. Soiffer Sirolimus, tacrolimus, and low-dose methotrexate for graft-versus-host disease prophylaxis in mismatched related donor or unrelated donor transplantation Blood, September 1, 2003; 102(5): 1601 - 1605. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kumamoto, D. Shalhevet, H. Matsue, M. E. Mummert, B. R. Ward, J. V. Jester, and A. Takashima Hair follicles serve as local reservoirs of skin mast cell precursors Blood, September 1, 2003; 102(5): 1654 - 1660. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
). RNAs isolated from these cells were
then subjected to real-time RT-PCR analyses for 
, Baseline cell
viabilities in the absence of added drugs. The data shown in this
figure are representative of three independent experiments.
