|
|
||||||||




* Program in Gene Regulation, Institute of Molecular Medicine and Genetics, and Departments of
Biochemistry and Molecular Biology and
Medicine, Medical College of Georgia, Augusta, GA 30912
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The occurrence of autoantibodies in linked sets together with the observation that some autoantibodies tend to stabilize assembled nucleoprotein complexes (5, 6, 7, 8) suggests that the complexes themselves may play an important role in the maintenance and propagation of the autoimmunity. It may be that novel epitopes are formed at protein-nucleic acid interfaces or as the result of conformational changes that accompany complex assembly (9). Consistent with this, autoantibody-defined epitopes are often conformation dependent and coincide with active site regions (10). Such epitopes may be able to evade the normal mechanisms of tolerance induction in individuals predisposed to the development of autoimmune disease.
Another hypothesis arises from observations that environmental factors contribute to the generation of autoantibodies. Those factors include viral and other infections as well as other processes leading to cell injury. The underlying mechanism may involve the generation of novel peptide fragments as the result of protease activity. Autoantigens are much more likely than other cellular proteins to be cleaved by proteases that are activated during inflammation and cell death. Autoantigens are frequent targets of caspase cleavage (11, 12), and staining of apoptotic cells with autoimmune sera shows that autoantigens dramatically redistribute during apoptosis, becoming clustered and concentrated in surface structures on dying cells (13). Autoantigens are also frequent targets for granzyme B, a protease that is released during the cytotoxic T cell response (14). In both cases it is possible that proteolytic cleavage of target proteins alters the pattern of subsequent Ag processing and presentation (12, 13, 14).
Several well-characterized nuclear autoantigens have been shown to have functional roles in the nonhomologous end-joining (NHEJ) pathway of DNA double-strand break repair (reviewed in Ref. 8). Double-strand breaks are induced by ionizing radiation and during V(D)J recombination. The Ku protein, which carries out the initial recognition of DNA breaks, was identified as a target of autoantibodies in a population of Japanese patients with so-called overlap syndrome combining features of scleroderma and polymyositis (15). Subsequent studies using more sensitive techniques revealed the presence of anti-Ku Abs in 515% of SLE patients in U.S. populations (16, 17, 18). Abs to another enzyme in the NHEJ pathway, DNA-dependent protein kinase catalytic subunit (DNA-PKcs), have also been detected in SLE patients, and their incidence was shown to be significantly correlated with the presence of anti-Ku autoantibodies (5, 19). This suggests that the autoimmune response may be directed in part against an assembled Ku/DNA-PKcs/DNA particle. In addition, DNA-PKcs can be cleaved by caspase 3 and granzyme B, which may play a role in its selection as an autoantigen (11, 14, 20, 21, 22, 23).
Several other proteins are also part of the NHEJ pathway. Among these are DNA ligase IV (DNL IV) and XRCC4, which is the product of the x-ray cross-complementation group 4 gene. These two polypeptides form a molecular complex that carries out the actual ligation step (24, 25, 26, 27, 28). It has been shown that XRCC4 is phosphorylated by DNA-PK in vitro (29, 30) and in response to radiation exposure in vivo (31). Current models postulate that these and other proteins participate in a series of repair complexes that form at the DNA ends and guide the process toward completion.
It was of interest to investigate whether constituents of the NHEJ pathway other than Ku and DNA-PKcs might be targets of autoantibodies. We screened a panel of sera from patients with autoimmune diseases for autoantibodies to DNL IV and XRCC4 using ELISA and immunoblotting. Autoantibodies to the DNL IV/XRCC4 complex were found in 1520% of patients with SLE and other systemic rheumatic diseases. An autoimmune epitope was mapped in the C-terminal region of XRCC4. This region is not required for the core biochemical functions of the DNL IV/XRCC4 complex (30), but may play a regulatory role, as it is subject to radiation-induced post-translational modifications, including cleavage by caspases and phosphorylation by DNA-PK (31). We found that the epitope precisely coincides with an in vitro DNA-PK phosphorylation site and lies within a few residues of a caspase 3 cleavage site, suggesting that radiation-induced modifications may play a role in triggering or maintaining the autoimmune response to the DNL IV/XRCC4 complex.
| Materials and Methods |
|---|
|
|
|---|
Patient sera were obtained from the Antinuclear Antibody Laboratory of the Medical College of Georgia. Sera represented 155 individuals with diagnoses including SLE, polymyositis, dermatomyositis, Raynauds phenomenon, scleroderma, Sjögrens syndrome, and Wegeners granulomatosis. SLE and scleroderma were classified using the American College of Rheumatology criteria (32, 33), and polymyositis was classified by Bohans criteria (34). Patients with symptoms of two or more systemic rheumatic diseases were placed in the overlap syndrome category. Sera from 16 control subjects were also tested. Additional Abs used in the work include anti-hemagglutinin tag (mAb 12CA5) and anti-his tag (Tetra-His mAb, Qiagen, Valencia, CA).
Characterization of autoimmune sera by ELISA
Recombinant DNL IV/XRCC4 complex was purified as previously
described (35) from extracts of cells coinfected with DNL
IV- and XRCC4-expressing recombinant baculoviruses. Individual wells of
microtiter plates (Immunoplate MaxiSorp; Nunc, Naperville, IL) were
coated overnight at 4°C with the purified DNL IV/XRCC4 complex (10
µg/ml in 20 mM Tris-HCl, pH 8.0). The wells were washed twice and
blocked with BBS buffer (0.17 M
H3BO3 and 0.12 M NaCl, pH
8.5) containing 0.5% BSA, 1 mM EDTA, and 0.05% Tween 20. Samples of
autoimmune serum, diluted in the same buffer at 1/250, were added to
individual wells and incubated for 1.5 h at 22°C. The wells were
washed with PBS, alkaline phosphatase-conjugated goat anti-human
IgG (
-chain specific, 1/1250 dilution; Sigma-Aldrich, St. Louis,
MO) was added, and incubation was continued for 1.5 h. The wells
were washed, BluePhos Phosphatase Microwell Substrate (Kirkegaard &
Perry Laboratories, Gaithersburg, MD) was added, incubation was
continued for 3060 min, and absorbance was determined at 495
nm.
Characterization of autoimmune sera by immunoblotting
For immunoblotting, purified DNL IV/XRCC4 complex was subjected to SDS-PAGE and transferred by electroblotting to a nitrocellulose or polyvinylidene difluoride membrane. After blocking with 3% BSA in TBS/T buffer (TBS containing 0.05% Tween 20), the membrane was incubated with autoimmune serum at the dilutions indicated in the figure legends. The membrane was washed with TBS/T, incubated with alkaline phosphatase-conjugated secondary Ab, and developed using nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Sigma-Aldrich). In some experiments HRP-conjugated secondary Ab was used, and the membrane was developed using the ECL method (Amersham Pharmacia Biotech, Piscataway, NJ).
In vitro cleavage by caspase 3 and granzyme B
Recombinant DNL IV/XRCC4 complex (5 µg) was incubated with 20 U caspase 3 (Upstate Biotechnology, Lake Placid, NY) in 20 µl reaction buffer (50 mM PIPES (pH 6.5), 2 mM EDTA, and 5 mM DTT) for 1 h at 37°C (36). In some reactions caspase 3 inhibitor (DEVD-CHO; Calbiochem, San Diego, CA) was added. For granzyme B digestion, DNL IV/XRCC4 complex (5 µg) was incubated with 7 U granzyme B in 20 µl PBS for 1 h at 37°C. Cleaved products were resolved by 12% SDS-PAGE. For N-terminal peptide sequencing, cleaved peptides were transferred to a polyvinylidene difluoride membrane, excised, and analyzed at the Molecular Biology Core Facility at the Medical College of Georgia.
Expression of recombinant XRCC4 fragments
Selected portions of the XRCC4 gene were amplified by PCR. To generate C-terminal deletion mutants, PCR was conducted using a common 5' primer, d(TAGGATCCACCCATATGGAGAGAAAAATA), and the following 3' primers: for 1310, d(TAGTCGACTTACTCCTTTTTCGACGTC); for 1270, d(TAGTCGACTTATCTACTTGGTGCAATAT); for 1215, d(TAGTCGACTTAAGTTTCCCCTTCTTGT); for 1180, d(TAGTCGACTTAAAACCGCTTATAAAGATC); and for 1115, d(TAGTCGACTTATTTCTCTAGGTTGAAGGA). The PCR products were inserted into the pCR 2.1-TOPO vector (Invitrogen, Carlsbad, CA). The resulting plasmid was digested with BamHI and SalI, and the XRCC4-containing fragment was inserted into corresponding sites in the pET28b bacterial expression vector (Novagen, Madison WI). This vector contributes histidine tag at the C terminus end of the expressed XRCC4 mutant proteins. Plasmids were introduced in Escherichia coli BL21(DE3) for expression (Novagen).
To generate fusion proteins containing XRCC4 sequences from residue 180 to residues 220, 240, 250, 260, and 270, separate amplification reactions were performed with a common 5' primer, d(ATTGGATCCATTCTGGTGTTGAATGAGAA), and the following 3' primers: d(AATGAATTCTTCAGAACAGATTGCAGTTT), d(AATGAATTCTTGGTTTTCACTTTCCTCAT), d(AATGAATTCTACAGCAGCTGAAGCCAA), d(AATGAATTCACTTGAAATAATGGAATCATC), and d(AATGAATTCTTTTCTACTTGGTGCAATATC). To generate a fusion protein containing XRCC4 residues 251334, amplification was performed using d(TAGGATCCACCCATATGGTAAGTAAGATGATTCCA) and d(ATAGTCGACTTAAATCTCATCAAAGAG). To generate a protein containing residues 266334, amplification was performed using d(ATTGGATCCATTGCACCAAGTAGAAAAAG) and d(AATGAATTCAATCTCATCAAAGAGGTCTT). PCR products were cloned into the pCR2.1-TOPO vector (Invitrogen). The XRCC4-encoding fragments were excised with BamHI and EcoRI or with BamHI and SalI, and inserted at corresponding sites downstream of the GST gene in pGEX2T or pGEX4T vector, respectively (Amersham Pharmacia Biotech). The resulting plasmids were introduced into E. coli strain Top10 (Invitrogen) for expression.
To generate the XRCC4 S260A point mutant, PCR was performed with complementary primers d(GATGATTCCATTATTTCAGCTCTTGATGTCACTGAT) and d(ATCAGTGACATCAAGAGCTGAAATAATGGAATCATC), which incorporate the desired mutation. After limited PCR (13 cycles), products were digested with DpnI to eliminate dam-methylated template, and the plasmids were introduced into E. coli strain Top10.
Purification of recombinant XRCC4 fragments
For protein purification, 4-ml bacterial cultures were grown to an OD600 of 0.40.6 and induced with 1 mM isopropyl thiogalactoside for 4 h at 30 or 37°C. Cells were collected by centrifugation and were resuspended in lysis buffer. For his-tagged constructs, lysis buffer contained 50 mM NaH2PO4 (pH 8.0), 500 mM NaCl, 5 mM 2-ME, and 10% glycerol. The suspension was sonicated, then centrifuged for 30 min at 6500 x g. The supernatants were mixed with 200 µl Ni+-nitriloacetic acid agarose (1/1 slurry in lysis buffer; Qiagen, Valencia, CA), and the mixture was incubated at 4°C overnight. The beads were washed three times with lysis buffer and were eluted with lysis buffer containing 0.5 mM imidazole.
GST fusion proteins were purified by a modification of a previously described method (37). Lysis buffer contained 50 mM Tris-HCl (pH 7.9), 12.5 mM MgCl2, 1 mM EDTA, 100 mM KCl, 20 µg/ml PMSF, 1 µg/ml pepstatin A, 1 µg/ml leupeptin, 1 µg/ml soybean trypsin inhibitor, and 15 mM 2-ME. After incubation on ice for 30 min, Triton X-100 was added to a final concentration of 1%, and incubation was continued for 10 min. The cell lysate was sonicated, then centrifuged for 15 min at 6500 x g. The supernatants were mixed with 100 µl glutathione-agarose (1/1 slurry in lysis buffer containing 1% Triton X-100; Sigma-Aldrich), and the mixture was incubated at 4°C overnight. Beads were collected and subjected to three cycles of washing alternately with wash buffer 1 (50 mM Tris-HCl (pH 7.9), 1 M NaCl, 15 mM 2-ME, and protease inhibitors) and wash buffer 2 (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.4 mM KH2PO4, 1% Triton X-100, 15 mM 2-ME, and protease inhibitors). The GST-XRCC4 fusion proteins were eluted with lysis buffer containing 15 mM glutathione.
Synthetic peptides and peptide ELISA
All peptides were synthesized with a biotin group at the N terminus, followed by three aminocaproic acid spacer moieties and the following amino acid sequences: peptide 1 (aa 211235), QEGETAICSEMTADRDPVYDESTDE; peptide 2 (aa 221245), MTADRDPVYDESTDEESENQTDLSG; peptide 3 (aa 231255), ESTDEESENQTDLSGLASAAVSKDD; and peptide 4 (aa 251265), VSKDDSIISSLDVTD. Some experiments used variants of peptide 4 where individual serine and threonine residues were substituted with alanine or where a serine residue was substituted with phosphoserine. Peptide quality was monitored by reverse phase HPLC and mass spectrometry. Solutions were prepared based on peptide weight, and concentrations were verified by the bicinchoninic acid method.
For ELISA, autoimmune serum was diluted as indicated in the figure
legends, using PBS containing 0.05% Tween 20, 1% BSA, and 1% bovine
-globulin. NeutrAvidin-coated polystyrene plates (Pierce, Rockford,
IL) were washed three times with PBS containing 0.05% Tween 20.
Biotinylated peptide (10 nmol) was added and was allowed to adsorb for
2 h at 20°C. Plates were blocked by incubation with 3% BSA in
PBS for 1 h at 20°C and were washed with PBS containing 0.05%
Tween 20. Diluted human autoimmune serum was added, and incubation was
continued for 30 min. The plate was incubated with secondary Ab and
developed as described in a preceding section.
In vitro phosphorylation
DNA-PKcs was purified from HeLa cell nuclear extracts as
previously described (38). Recombinant Ku protein was
purified as described from extracts of Sf 9 cells coinfected with Ku
70- and Ku 80-expressing recombinant baculoviruses (39).
In vitro phosphorylation reactions contained 25 mM Tris-HCl (pH 7.9),
25 mM MgCl2, 1.5 mM DTT, 50 mM KCl, 10%
glycerol, 20 nM pGEM 3Z plasmid digested with BamHI, 0.16
µM [
-32P]ATP (6000 Ci/mmol), 8 nM
DNA-PKcs, 20 nM Ku, and protein or peptide substrate as indicated in
the figure legends. The final volume was 10 µl. Reactions were
incubated for 30 min at 30°C. Protein phosphorylation reactions were
terminated by addition of SDS-PAGE sample buffer. Products were
analyzed by 12% SDS-PAGE and were detected by phosphorimager analysis.
Peptide phosphorylation reactions were terminated by addition of an
equal volume of 7.5 M guanidine hydrochloride and were spotted on
SAM2 biotin capture membrane (Promega, Madison, WI).
The membrane was washed three times with 2 M NaCl, four times with 2 M
NaCl in 1% phosphoric acid, and twice with water. Relative
incorporation of radiolabel was measured by phosphorimager
analysis.
| Results |
|---|
|
|
|---|
Sera from 155 patients with diagnoses of SLE or other systemic
rheumatic diseases were screened by ELISA using purified, recombinant,
DNL IV/XRCC4 complex as the Ag (Fig. 1
A). Sera were considered
positive for anti-DNL IV/XRCC4 Abs if they gave an absorbance value
above a threshold, denoted by the dashed line, that was 3 SD above the
mean value obtained with 16 control sera. By this criterion, 24
positive sera were identified (15.5%).
|
A breakdown of the results by diagnosis is shown in Table I
. Except for two patients for whom a
definitive diagnosis was not available, all positive sera were derived
from patients with SLE or overlap syndrome. The frequency of
autoantibodies in these groups together was
20%. Autoantibodies
against the DNL IV/XRCC4 complex were not found among the limited
number of patients with scleroderma, polymyositis, Raynauds
phenomenon, or other diagnoses.
|
Rescreening and determination of subunit specificity by immunoblotting
Selected sera were rescreened by immunoblotting against purified
DNL IV and XRCC4. Representative results are shown in Fig. 2
. Among the 24 ELISA-positive sera, 8
were positive by immunoblotting (Fig. 2
, lanes 18).
The remaining 16 were very weak or negative (data not shown),
presumably because they contained Abs at levels below the threshold for
detection by immunoblotting or that were directed against
conformational epitopes, which were lost when the Ag was subjected to
SDS-PAGE. The presence of Abs directed against conformational epitopes
is common in other autoantigen systems (40, 41).
ELISA-negative sera were very weak or negative when rescreened by
immunoblotting (Fig. 2
, lanes 916, and data not
shown).
|
Mapping of an autoimmune epitope in XRCC4
It was of interest to map the autoimmune epitopes with respect to
the primary sequence and functional sites in the DNL IV and XRCC4
polypeptides. Initial mapping studies were performed with serum M124,
which had the strongest reactivity in an immunoblot among the sera
tested. Our experiments took advantage of several unique, naturally
occurring protease cleavage sites in XRCC4. It has previously been
reported that XRCC4 is an in vivo substrate of caspase 3, which cleaves
during radiation-induced apoptosis (31). To identify the
exact site of cleavage, we analyzed the products formed when the DNL
IV/XRCC4 complex was digested with caspase 3 in vitro. SDS-PAGE showed
two products (Fig. 3
A). These
were transferred to a membrane and subjected to N-terminal sequencing
as described in Materials and Methods. The
results, summarized in Fig. 3
E, showed that cleavage
occurred between residues 265 and 266. We also tested cleavage by
granzyme B, an inflammatory protease, in similar experiments. This
enzyme also cut at a single site, between XRCC4 residues 254 and 255
(Fig. 3
, A and E). DNL IV was not cleaved by
either protease under the conditions used.
|
To better identify the boundaries of the XRCC4 epitope, mapping
was performed using recombinant XRCC4 fragments expressed in bacteria.
Fig. 3
B shows a series of C-terminal deletion mutants.
Proteins were purified as described in Materials and
Methods, and equal amounts were loaded, as shown by Coomassie
staining of replicate gels (data not shown). The immunoreactivity of
XRCC41310 and XRCC41270
fragments was comparable to that of full-length XRCC4 (Fig. 3
B, compare lanes 1, 5, and
6). By contrast, little or no immunoreactivity was seen when
additional sequences were deleted in XRCC41115,
XRCC41180, and
XRCC41215 (Fig. 3
B,
lanes 24). Taken together with results from Fig. 3
A, these data indicate that sequences between residues 215
and 265 form an essential part of the autoimmune epitope.
Further mapping studies were performed using smaller fragments of XRCC4
expressed as GST fusion proteins (Fig. 3
C). Immunoreactivity
was seen with GST-X4180270 (Fig. 3
C,
lanes 7 and 12), but not with
GST-X4180260 (lane 6) or any
of a series of shorter constructs (lanes 35).
Immunoreactivity was also seen with
GST-X4251334 (lane 10), but
not with GST-X4266334. Thus, immunoreactivity
correlated with the presence of a sequence between 251265, which
appears to form the major epitope recognized under these
conditions.
To confirm this finding, four overlapping peptides were synthesized
covering the predicted epitope region and adjacent sequences. The
results of an ELISA are shown in Fig. 3
D, and the relative
location of each peptide is diagrammed in Fig. 3
E. Only
peptide 4, spanning residues 251265, showed immunoreactivity. These
data confirm the epitope mapping results obtained by immunoblotting in
Fig. 3
, AC. They establish that sequences between residues
251 and 265 are both necessary and sufficient for autoantibody
recognition.
Recognition of the XRCC4251265 epitope by other sera
It was of interest to determine whether the same epitope was
recognized by autoantibodies in other sera. Peptide ELISA were
performed, with results shown in Fig. 4
.
Serum M109 showed a level of immunoreactivity that was distinctly above
background with peptide 4 (Fig. 4
A). There was no reactivity
above background with the other peptides. The specificity of serum M109
was confirmed by immunoblotting, where it reacted with
GST-X4180270 and
GST-X4251334, but not with several other
constructs in which the epitope region had been deleted (Fig. 4
C). Serum M162 also showed immunoreactivity with peptide 4
in an ELISA (Fig. 4
B). Eleven other autoimmune sera were
negative, indicating that they recognize conformational epitopes or
epitopes elsewhere in the protein.
|
It was also of interest to determine whether the
XRCC4251265 epitope was immunodominant in any
of the sera containing this specificity. Competitive ELISA was
performed, in which purified DNL IV/XRCC4 complex was adsorbed to a
multiwell plate, and the immunoreactivity of different sera was
measured in the presence of varying amounts of free competitor peptide.
The results are shown in Fig. 5
. Serum
M124 was strikingly susceptible to competition with peptide 4, but not
with a control peptide, indicating that the
XRCC4251265 epitope is immunodominant. Although
less immunoreactive under these conditions, sera M109 and M162 did not
appear to be susceptible to competition by peptide 4, suggesting that
they contain additional specificities.
|
Ku and DNA-PKcs bind to broken DNA ends to form an active DNA-PK
complex. XRCC4 is a substrate for this kinase in vitro and in vivo
(29, 30, 31), and it is believed that this phosphorylation may
be important for regulation of the NHEJ pathway. Phosphorylation occurs
at multiple sites within the XRCC4 C-terminal region, the exact
locations of which have not been reported (29, 30). To
determine the relationship between the phosphorylation sites and the
epitope region, we conducted an in vitro kinase reaction using native
DNL IV/XRCC4 complex and purified Ku and DNA-PKcs. As shown in Fig. 6
, [
-32P]ATP
radiolabel was incorporated preferentially into XRCC4, rather than DNL
IV, although both polypeptides were present in stoichiometric amounts
(Fig. 6
, A and B, lane 1). Caspase 3
digestion, performed subsequent to radiolabeling, revealed that
phosphorylation occurred in both the N-terminal 1265 and C-terminal
266334 fragments (Fig. 6
A). We designated the sites in
these two fragments as N-X4 and C-X4, respectively. Under the
conditions tested, the N-X4 site was used
3-fold less efficiently
than the C-X4 site.
|
Interestingly, when the DNL IV/XRCC4 substrate was cleaved with caspase
3 before radiolabeling, only the N-X4 site was used (Fig. 6
A, lane 4). Thus, sequences N-terminal to the
caspase 3 site control phosphorylation of the C-X4 site. Stimulation of
phosphorylation occurs only in cis, and not when the two
parts of XRCC4 are severed by protease cleavage.
Phosphorylation results were confirmed using GST fusion proteins
as substrates. The results are shown in Fig. 6
C.
GST-X4251334 contains both the N-X4 and C-X4
sites. It was phosphorylated relatively efficiently, and caspase 3
cleavage showed that both the N-X4 and C-X4 sites were used (Fig. 6
C, lanes 1 and 2).
GST-X4266334, which contains the C-X4 site only
and is analogous to the natural C-terminal caspase 3 cleavage fragment,
was used much less efficiently (lane 3). In control
experiments GST alone showed no specific phosphorylation (data not
shown). These results confirm that in addition to serving as a
substrate for DNA-PK, sequences in the N-X4 region are required for
efficient phosphorylation elsewhere in the protein.
The N-X4 site maps to an 11-residue interval that coincides with the
autoimmune epitope. There are four potential phosphoacceptor residues
within the sequence of interest (Fig. 6
F). Peptide
substrates were synthesized in which each of these residues was
substituted by alanine. Peptide quality was verified and concentrations
were standardized as described in Materials and Methods. The
results of a peptide phosphorylation assay are shown in Fig. 6
D. The S260A substitution completely eliminated the ability
to serve as substrate and was the only substitution to have this
effect. This indicates that serine 260 is the sole phosphorylation site
in the region. The S256A and S259A substitutions increased the apparent
km for substrate utilization, but did not
affect the apparent maximum velocity, indicating that these contribute
to substrate recognition, but do not correspond to actual sites of
phosphorylation. The T264A substitution had no effect. These results
are summarized in Fig. 6
F.
To confirm these results in the context of a larger protein
fragment, the S260A substitution was introduced into the
GST-X4251334 construct. This substitution
reduced use of the N-X4 site to almost undetectable levels and reduced
use of the C-X4 site by
2-fold. The reduction in C-X4
phosphorylation is consistent with the requirement for N-X4 sequences
for full use of the C-X4 site, shown originally in Fig. 6
A.
Precise coincidence between structural determinants required for DNA-PK phosphorylation and immunoreactivity
To examine the correlation between structural determinants
required for DNA-PK phosphorylation and recognition by autoantibodies,
we performed peptide ELISA using different sequence variants. The
results are shown in Fig. 7
. The S260A
substitution eliminated immunoreactivity with serum M124. The S256A and
S259A substitutions partially reduced immunoreactivity, and the T264A
substitution had no effect. Thus, relative immunoreactivity closely
paralleled the ability to be used as a DNA-PK substrate.
|
| Discussion |
|---|
|
|
|---|
15% of the panel, showed
significant levels of immunoreactivity against purified complex in an
ELISA. Further characterization of the positive sera showed that
multiple epitopes were recognized. In some cases these were
conformational, but in others they could be mapped to individual DNL IV
and XRCC4 polypeptides by immunoblotting. The major linear epitope in
XRCC4 was shown to correspond to a short sequence that overlapped with
recognition sites for inflammatory and apoptotic proteases and
coincided with a site of DNA-PK phosphorylation. Abs to this epitope
were detected in three sera. In one serum, which had a relatively high
level of immunoreactivity, a competition ELISA showed that this single
epitope was immunodominant. The majority of the positive sera were from patients with SLE. However, only a limited number of sera were available from patients with other diagnoses, and we cannot exclude the possibility that anti-DNL IV and anti-XRCC4 Abs may occur in association with other systemic rheumatic diseases. Although the panel of sera used in the present study was sufficient to demonstrate the existence of this new autoantibody system, sera from a larger and more defined population will be needed to determine the association of these autoantibodies with specific disease states.
The present findings increase to five the number of polypeptides in the NHEJ pathway that have been shown to be targets of autoantibodies in patients with SLE or other systemic rheumatic diseases. These include the two subunits of Ku and the catalytic subunit of DNA-PK as well as the DNL IV and XRCC4 characterized in the present study. These findings raise an obvious question whether exposure to radiation or other agents that induce DNA double-strand breaks may influence the development of an autoimmune response in susceptible individuals. Previous studies in animals and humans have suggested that radiation exposure can be correlated with the production of autoantibodies or the manifestation of autoimmune disease (42, 43, 44, 45, 46). More specific measurements of autoantibodies to NHEJ proteins in exposed populations may help clarify whether radiation contributes to autoantibody production in this context.
NHEJ proteins are latent in the normal cell and form complexes with damaged DNA fragments in the context of genotoxic injury and cell death. In some cases exposure to double-strand break-inducing agents also involves introduction of specific post-translational modifications, including phosphorylation and protease cleavage. In the present study we used a combination of biochemical approaches to map the sites of two of these modifications, a caspase 3 cleavage site and a DNA-PKcs phosphorylation site, with greater precision than had been previously reported (29, 30, 31). We also mapped a novel granzyme B site of as yet unknown significance. All these sites fall within or near the short linear epitope recognized by three of the autoimmune sera. This remarkable juxtaposition provides further support for the idea that the conversion from latent to active form or the introduction of radiation-induced post-translational modifications is connected with initiation of the autoimmune response.
Although many autoantigens are susceptible to cleavage with caspase 3, granzyme B, or both, the present results provide one of the few examples of an autoimmune epitope that has been mapped with sufficient precision to show that it lies in immediate physical proximity to the protease cleavage sites. It will be of interest to learn whether close physical proximity of autoimmune epitopes and protease cleavage sites is a general feature in other autoantigen systems. Closely spaced caspase 3 and granzyme B sites occur in DNA-PKcs (14), but their relationship to the autoimmune epitopes is unknown. In another DNA repair protein, poly(ADP)-ribose polymerase, autoantibodies were shown to recognize conformational epitopes in the two zinc finger motifs, one of which lies only 10 residues upstream from the major caspase site (47). Thus, poly(ADP)-ribose polymerase may afford another example of an epitope that maps immediately adjacent to a site of proteolytic cleavage.
One of the interesting characteristics of the autoantisera in the present study is that, although strongly reactive in the initial screening assays, interaction with the DNL IV/XRCC4 complex in solution was relatively inefficient. Only weak immunoreactivity was seen in immunoprecipitation assays, and in preliminary experiments antisera failed to give functional inhibition in cell-free, end-joining assays (data not shown). Preliminary attempts to increase the immunoprecipitation efficiency by digestion of the complex with caspase 3, in vitro phosphorylation, or incubation with Ku, DNA-PKcs, and DNA did not result in persuasive differences. It is thus possible that there are additional, unknown modifications or conformational changes that accompany the assembly of a functional repair complex in vivo that enhance the accessibility of the epitope in the native protein.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 K.-J.L. and X.D. made equal contributions to this work. ![]()
3 Current address: Department of Molecular Biology, Massachusetts General Hospital, 38 Sidney Street, Suite 100, Cambridge, MA 02139. ![]()
4 Current address: Division of Rheumatology, Immunology, and Allergy, Brigham and Womens Hospital, Harvard Medical School, Department of Immunology and Infectious Diseases, Harvard School of Public Health, Boston, MA 02115. ![]()
5 Address correspondence and reprint requests to Dr. William S. Dynan, Institute of Molecular Medicine and Genetics, Room CB-2803, Medical College of Georgia, Augusta, GA 30912. Email address: wdynan{at}mail.mcg.edu ![]()
6 Abbreviations used in this paper: SLE, systemic lupus erythematosus; DNA-PKcs, DNA-dependent protein kinase catalytic subunit; DNL IV, DNA ligase IV; NHEJ, nonhomologous end joining. ![]()
Received for publication March 7, 2002. Accepted for publication July 11, 2002.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. Schild-Poulter, A. Su, A. Shih, O. P. Kelly, M. J. Fritzler, R. Goldstein, and R. J. G. Hache Association of autoantibodies with Ku and DNA repair proteins in connective tissue diseases Rheumatology, February 1, 2008; 47(2): 165 - 171. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yajima, K.-J. Lee, and B. P. C. Chen ATR-Dependent Phosphorylation of DNA-Dependent Protein Kinase Catalytic Subunit in Response to UV-Induced Replication Stress Mol. Cell. Biol., October 15, 2006; 26(20): 7520 - 7528. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sebbagh, J. Hamelin, J. Bertoglio, E. Solary, and J. Breard Direct cleavage of ROCK II by granzyme B induces target cell membrane blebbing in a caspase-independent manner J. Exp. Med., February 7, 2005; 201(3): 465 - 471. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-G. Wang, C. Nnakwe, W. S. Lane, M. Modesti, and K. M. Frank Phosphorylation and Regulation of DNA Ligase IV Stability by DNA-dependent Protein Kinase J. Biol. Chem., September 3, 2004; 279(36): 37282 - 37290. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Ulanet, M. Torbenson, C. V. Dang, L. Casciola-Rosen, and A. Rosen Unique conformation of cancer autoantigen B23 in hepatoma: A mechanism for specificity in the autoimmune response PNAS, October 14, 2003; 100(21): 12361 - 12366. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |