The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, K.-J.
Right arrow Articles by Dynan, W. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, K.-J.
Right arrow Articles by Dynan, W. S.
The Journal of Immunology, 2002, 169: 3413-3421.
Copyright © 2002 by The American Association of Immunologists

Identification of Human Autoantibodies to the DNA Ligase IV/XRCC4 Complex and Mapping of an Autoimmune Epitope to a Potential Regulatory Region1

Kyung-Jong Lee2,*,{dagger}, Xingwen Dong2,3,*, Jingsong Wang4,{ddagger}, Yoshihiko Takeda*,{ddagger} and William S. Dynan5,*,{ddagger}

* Program in Gene Regulation, Institute of Molecular Medicine and Genetics, and Departments of {dagger} Biochemistry and Molecular Biology and {ddagger} Medicine, Medical College of Georgia, Augusta, GA 30912


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The nonhomologous end-joining pathway is the principal mechanism for repair of ionizing radiation-induced, double-strand breaks in mammalian cells. Three polypeptides in this pathway, including the two subunits of Ku protein and the catalytic subunit of the DNA-dependent protein kinase, are known targets of autoantibodies in systemic rheumatic diseases. Here we show that two additional polypeptides in the pathway, DNA ligase IV and XRCC4, are also targets of autoantibodies. These Abs were present in 20% of patients with systemic lupus erythematosus and overlap syndrome. Previous work has shown that XRCC4 is subject to radiation-induced post-translational modification, including phosphorylation by DNA-dependent protein kinase and cleavage by caspase 3. We mapped a major autoimmune epitope in XRCC4 and found that it encompassed a DNA-dependent protein kinase phosphorylation site, which is located at serine 260; that it was adjacent to a site for caspase 3, which cleaves after residue 265; and that it also spanned a site for the inflammatory protease, granzyme B, which cleaves after residue 254. The finding that five different polypeptides in the nonhomologous end-joining pathway are potential targets of autoantibodies together with the observation that one of the autoimmune epitopes in XRCC4 coincides with a sequence that is a nexus for radiation-induced regulatory events suggest that exposure to agents that introduce DNA double-strand breaks may be one of the factors that influences the development of an autoimmune response in susceptible individuals.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The production of autoantibodies to intracellular proteins, nucleic acids, and nucleoprotein complexes is characteristic of systemic lupus erythematosus (SLE)6 and other systemic rheumatic diseases (1, 2). Certain autoantibodies, such as anti-double-strand DNA Abs, are useful indicators of disease activity. Other antinuclear Abs are associated with particular clinical syndromes and serve as markers for disease subsets. The production of autoantibodies is believed to be Ag driven. Within an individual patient, autoantibodies are directed against only a limited number of targets (3). Frequently, autoantibodies occur as linked sets directed against different constituents of the same nucleoprotein particle, such as small nuclear ribonucleoproteins or the nucleosome (3, 4).

The occurrence of autoantibodies in linked sets together with the observation that some autoantibodies tend to stabilize assembled nucleoprotein complexes (5, 6, 7, 8) suggests that the complexes themselves may play an important role in the maintenance and propagation of the autoimmunity. It may be that novel epitopes are formed at protein-nucleic acid interfaces or as the result of conformational changes that accompany complex assembly (9). Consistent with this, autoantibody-defined epitopes are often conformation dependent and coincide with active site regions (10). Such epitopes may be able to evade the normal mechanisms of tolerance induction in individuals predisposed to the development of autoimmune disease.

Another hypothesis arises from observations that environmental factors contribute to the generation of autoantibodies. Those factors include viral and other infections as well as other processes leading to cell injury. The underlying mechanism may involve the generation of novel peptide fragments as the result of protease activity. Autoantigens are much more likely than other cellular proteins to be cleaved by proteases that are activated during inflammation and cell death. Autoantigens are frequent targets of caspase cleavage (11, 12), and staining of apoptotic cells with autoimmune sera shows that autoantigens dramatically redistribute during apoptosis, becoming clustered and concentrated in surface structures on dying cells (13). Autoantigens are also frequent targets for granzyme B, a protease that is released during the cytotoxic T cell response (14). In both cases it is possible that proteolytic cleavage of target proteins alters the pattern of subsequent Ag processing and presentation (12, 13, 14).

Several well-characterized nuclear autoantigens have been shown to have functional roles in the nonhomologous end-joining (NHEJ) pathway of DNA double-strand break repair (reviewed in Ref. 8). Double-strand breaks are induced by ionizing radiation and during V(D)J recombination. The Ku protein, which carries out the initial recognition of DNA breaks, was identified as a target of autoantibodies in a population of Japanese patients with so-called overlap syndrome combining features of scleroderma and polymyositis (15). Subsequent studies using more sensitive techniques revealed the presence of anti-Ku Abs in 5–15% of SLE patients in U.S. populations (16, 17, 18). Abs to another enzyme in the NHEJ pathway, DNA-dependent protein kinase catalytic subunit (DNA-PKcs), have also been detected in SLE patients, and their incidence was shown to be significantly correlated with the presence of anti-Ku autoantibodies (5, 19). This suggests that the autoimmune response may be directed in part against an assembled Ku/DNA-PKcs/DNA particle. In addition, DNA-PKcs can be cleaved by caspase 3 and granzyme B, which may play a role in its selection as an autoantigen (11, 14, 20, 21, 22, 23).

Several other proteins are also part of the NHEJ pathway. Among these are DNA ligase IV (DNL IV) and XRCC4, which is the product of the x-ray cross-complementation group 4 gene. These two polypeptides form a molecular complex that carries out the actual ligation step (24, 25, 26, 27, 28). It has been shown that XRCC4 is phosphorylated by DNA-PK in vitro (29, 30) and in response to radiation exposure in vivo (31). Current models postulate that these and other proteins participate in a series of repair complexes that form at the DNA ends and guide the process toward completion.

It was of interest to investigate whether constituents of the NHEJ pathway other than Ku and DNA-PKcs might be targets of autoantibodies. We screened a panel of sera from patients with autoimmune diseases for autoantibodies to DNL IV and XRCC4 using ELISA and immunoblotting. Autoantibodies to the DNL IV/XRCC4 complex were found in 15–20% of patients with SLE and other systemic rheumatic diseases. An autoimmune epitope was mapped in the C-terminal region of XRCC4. This region is not required for the core biochemical functions of the DNL IV/XRCC4 complex (30), but may play a regulatory role, as it is subject to radiation-induced post-translational modifications, including cleavage by caspases and phosphorylation by DNA-PK (31). We found that the epitope precisely coincides with an in vitro DNA-PK phosphorylation site and lies within a few residues of a caspase 3 cleavage site, suggesting that radiation-induced modifications may play a role in triggering or maintaining the autoimmune response to the DNL IV/XRCC4 complex.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Patients and sera

Patient sera were obtained from the Antinuclear Antibody Laboratory of the Medical College of Georgia. Sera represented 155 individuals with diagnoses including SLE, polymyositis, dermatomyositis, Raynaud’s phenomenon, scleroderma, Sjögren’s syndrome, and Wegener’s granulomatosis. SLE and scleroderma were classified using the American College of Rheumatology criteria (32, 33), and polymyositis was classified by Bohan’s criteria (34). Patients with symptoms of two or more systemic rheumatic diseases were placed in the overlap syndrome category. Sera from 16 control subjects were also tested. Additional Abs used in the work include anti-hemagglutinin tag (mAb 12CA5) and anti-his tag (Tetra-His mAb, Qiagen, Valencia, CA).

Characterization of autoimmune sera by ELISA

Recombinant DNL IV/XRCC4 complex was purified as previously described (35) from extracts of cells coinfected with DNL IV- and XRCC4-expressing recombinant baculoviruses. Individual wells of microtiter plates (Immunoplate MaxiSorp; Nunc, Naperville, IL) were coated overnight at 4°C with the purified DNL IV/XRCC4 complex (10 µg/ml in 20 mM Tris-HCl, pH 8.0). The wells were washed twice and blocked with BBS buffer (0.17 M H3BO3 and 0.12 M NaCl, pH 8.5) containing 0.5% BSA, 1 mM EDTA, and 0.05% Tween 20. Samples of autoimmune serum, diluted in the same buffer at 1/250, were added to individual wells and incubated for 1.5 h at 22°C. The wells were washed with PBS, alkaline phosphatase-conjugated goat anti-human IgG ({gamma}-chain specific, 1/1250 dilution; Sigma-Aldrich, St. Louis, MO) was added, and incubation was continued for 1.5 h. The wells were washed, BluePhos Phosphatase Microwell Substrate (Kirkegaard & Perry Laboratories, Gaithersburg, MD) was added, incubation was continued for 30–60 min, and absorbance was determined at 495 nm.

Characterization of autoimmune sera by immunoblotting

For immunoblotting, purified DNL IV/XRCC4 complex was subjected to SDS-PAGE and transferred by electroblotting to a nitrocellulose or polyvinylidene difluoride membrane. After blocking with 3% BSA in TBS/T buffer (TBS containing 0.05% Tween 20), the membrane was incubated with autoimmune serum at the dilutions indicated in the figure legends. The membrane was washed with TBS/T, incubated with alkaline phosphatase-conjugated secondary Ab, and developed using nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Sigma-Aldrich). In some experiments HRP-conjugated secondary Ab was used, and the membrane was developed using the ECL method (Amersham Pharmacia Biotech, Piscataway, NJ).

In vitro cleavage by caspase 3 and granzyme B

Recombinant DNL IV/XRCC4 complex (5 µg) was incubated with 20 U caspase 3 (Upstate Biotechnology, Lake Placid, NY) in 20 µl reaction buffer (50 mM PIPES (pH 6.5), 2 mM EDTA, and 5 mM DTT) for 1 h at 37°C (36). In some reactions caspase 3 inhibitor (DEVD-CHO; Calbiochem, San Diego, CA) was added. For granzyme B digestion, DNL IV/XRCC4 complex (5 µg) was incubated with 7 U granzyme B in 20 µl PBS for 1 h at 37°C. Cleaved products were resolved by 12% SDS-PAGE. For N-terminal peptide sequencing, cleaved peptides were transferred to a polyvinylidene difluoride membrane, excised, and analyzed at the Molecular Biology Core Facility at the Medical College of Georgia.

Expression of recombinant XRCC4 fragments

Selected portions of the XRCC4 gene were amplified by PCR. To generate C-terminal deletion mutants, PCR was conducted using a common 5' primer, d(TAGGATCCACCCATATGGAGAGAAAAATA), and the following 3' primers: for 1–310, d(TAGTCGACTTACTCCTTTTTCGACGTC); for 1–270, d(TAGTCGACTTATCTACTTGGTGCAATAT); for 1–215, d(TAGTCGACTTAAGTTTCCCCTTCTTGT); for 1–180, d(TAGTCGACTTAAAACCGCTTATAAAGATC); and for 1–115, d(TAGTCGACTTATTTCTCTAGGTTGAAGGA). The PCR products were inserted into the pCR 2.1-TOPO vector (Invitrogen, Carlsbad, CA). The resulting plasmid was digested with BamHI and SalI, and the XRCC4-containing fragment was inserted into corresponding sites in the pET28b bacterial expression vector (Novagen, Madison WI). This vector contributes histidine tag at the C terminus end of the expressed XRCC4 mutant proteins. Plasmids were introduced in Escherichia coli BL21(DE3) for expression (Novagen).

To generate fusion proteins containing XRCC4 sequences from residue 180 to residues 220, 240, 250, 260, and 270, separate amplification reactions were performed with a common 5' primer, d(ATTGGATCCATTCTGGTGTTGAATGAGAA), and the following 3' primers: d(AATGAATTCTTCAGAACAGATTGCAGTTT), d(AATGAATTCTTGGTTTTCACTTTCCTCAT), d(AATGAATTCTACAGCAGCTGAAGCCAA), d(AATGAATTCACTTGAAATAATGGAATCATC), and d(AATGAATTCTTTTCTACTTGGTGCAATATC). To generate a fusion protein containing XRCC4 residues 251–334, amplification was performed using d(TAGGATCCACCCATATGGTAAGTAAGATGATTCCA) and d(ATAGTCGACTTAAATCTCATCAAAGAG). To generate a protein containing residues 266–334, amplification was performed using d(ATTGGATCCATTGCACCAAGTAGAAAAAG) and d(AATGAATTCAATCTCATCAAAGAGGTCTT). PCR products were cloned into the pCR2.1-TOPO vector (Invitrogen). The XRCC4-encoding fragments were excised with BamHI and EcoRI or with BamHI and SalI, and inserted at corresponding sites downstream of the GST gene in pGEX2T or pGEX4T vector, respectively (Amersham Pharmacia Biotech). The resulting plasmids were introduced into E. coli strain Top10 (Invitrogen) for expression.

To generate the XRCC4 S260A point mutant, PCR was performed with complementary primers d(GATGATTCCATTATTTCAGCTCTTGATGTCACTGAT) and d(ATCAGTGACATCAAGAGCTGAAATAATGGAATCATC), which incorporate the desired mutation. After limited PCR (13 cycles), products were digested with DpnI to eliminate dam-methylated template, and the plasmids were introduced into E. coli strain Top10.

Purification of recombinant XRCC4 fragments

For protein purification, 4-ml bacterial cultures were grown to an OD600 of 0.4–0.6 and induced with 1 mM isopropyl thiogalactoside for 4 h at 30 or 37°C. Cells were collected by centrifugation and were resuspended in lysis buffer. For his-tagged constructs, lysis buffer contained 50 mM NaH2PO4 (pH 8.0), 500 mM NaCl, 5 mM 2-ME, and 10% glycerol. The suspension was sonicated, then centrifuged for 30 min at 6500 x g. The supernatants were mixed with 200 µl Ni+-nitriloacetic acid agarose (1/1 slurry in lysis buffer; Qiagen, Valencia, CA), and the mixture was incubated at 4°C overnight. The beads were washed three times with lysis buffer and were eluted with lysis buffer containing 0.5 mM imidazole.

GST fusion proteins were purified by a modification of a previously described method (37). Lysis buffer contained 50 mM Tris-HCl (pH 7.9), 12.5 mM MgCl2, 1 mM EDTA, 100 mM KCl, 20 µg/ml PMSF, 1 µg/ml pepstatin A, 1 µg/ml leupeptin, 1 µg/ml soybean trypsin inhibitor, and 15 mM 2-ME. After incubation on ice for 30 min, Triton X-100 was added to a final concentration of 1%, and incubation was continued for 10 min. The cell lysate was sonicated, then centrifuged for 15 min at 6500 x g. The supernatants were mixed with 100 µl glutathione-agarose (1/1 slurry in lysis buffer containing 1% Triton X-100; Sigma-Aldrich), and the mixture was incubated at 4°C overnight. Beads were collected and subjected to three cycles of washing alternately with wash buffer 1 (50 mM Tris-HCl (pH 7.9), 1 M NaCl, 15 mM 2-ME, and protease inhibitors) and wash buffer 2 (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.4 mM KH2PO4, 1% Triton X-100, 15 mM 2-ME, and protease inhibitors). The GST-XRCC4 fusion proteins were eluted with lysis buffer containing 15 mM glutathione.

Synthetic peptides and peptide ELISA

All peptides were synthesized with a biotin group at the N terminus, followed by three aminocaproic acid spacer moieties and the following amino acid sequences: peptide 1 (aa 211–235), QEGETAICSEMTADRDPVYDESTDE; peptide 2 (aa 221–245), MTADRDPVYDESTDEESENQTDLSG; peptide 3 (aa 231–255), ESTDEESENQTDLSGLASAAVSKDD; and peptide 4 (aa 251–265), VSKDDSIISSLDVTD. Some experiments used variants of peptide 4 where individual serine and threonine residues were substituted with alanine or where a serine residue was substituted with phosphoserine. Peptide quality was monitored by reverse phase HPLC and mass spectrometry. Solutions were prepared based on peptide weight, and concentrations were verified by the bicinchoninic acid method.

For ELISA, autoimmune serum was diluted as indicated in the figure legends, using PBS containing 0.05% Tween 20, 1% BSA, and 1% bovine {gamma}-globulin. NeutrAvidin-coated polystyrene plates (Pierce, Rockford, IL) were washed three times with PBS containing 0.05% Tween 20. Biotinylated peptide (10 nmol) was added and was allowed to adsorb for 2 h at 20°C. Plates were blocked by incubation with 3% BSA in PBS for 1 h at 20°C and were washed with PBS containing 0.05% Tween 20. Diluted human autoimmune serum was added, and incubation was continued for 30 min. The plate was incubated with secondary Ab and developed as described in a preceding section.

In vitro phosphorylation

DNA-PKcs was purified from HeLa cell nuclear extracts as previously described (38). Recombinant Ku protein was purified as described from extracts of Sf 9 cells coinfected with Ku 70- and Ku 80-expressing recombinant baculoviruses (39). In vitro phosphorylation reactions contained 25 mM Tris-HCl (pH 7.9), 25 mM MgCl2, 1.5 mM DTT, 50 mM KCl, 10% glycerol, 20 nM pGEM 3Z plasmid digested with BamHI, 0.16 µM [{gamma}-32P]ATP (6000 Ci/mmol), 8 nM DNA-PKcs, 20 nM Ku, and protein or peptide substrate as indicated in the figure legends. The final volume was 10 µl. Reactions were incubated for 30 min at 30°C. Protein phosphorylation reactions were terminated by addition of SDS-PAGE sample buffer. Products were analyzed by 12% SDS-PAGE and were detected by phosphorimager analysis. Peptide phosphorylation reactions were terminated by addition of an equal volume of 7.5 M guanidine hydrochloride and were spotted on SAM2 biotin capture membrane (Promega, Madison, WI). The membrane was washed three times with 2 M NaCl, four times with 2 M NaCl in 1% phosphoric acid, and twice with water. Relative incorporation of radiolabel was measured by phosphorimager analysis.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Screening by ELISA to detect autoantibodies against the DNL IV/XRCC4 complex

Sera from 155 patients with diagnoses of SLE or other systemic rheumatic diseases were screened by ELISA using purified, recombinant, DNL IV/XRCC4 complex as the Ag (Fig. 1GoA). Sera were considered positive for anti-DNL IV/XRCC4 Abs if they gave an absorbance value above a threshold, denoted by the dashed line, that was 3 SD above the mean value obtained with 16 control sera. By this criterion, 24 positive sera were identified (15.5%).



View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 1. Analysis of human autoimmune sera by ELISA. A, Initial screening. Microtiter wells were coated with purified recombinant DNL IV/XRCC4 protein, blocked, and incubated with the indicated human autoimmune serum at 1/250 dilution. Control wells were incubated as indicated with mAbs directed against hemagglutinin (HA) or hexahistidine (his) tags, which are present in the recombinant XRCC4 and DNL IV, respectively. After washing, wells were incubated with alkaline phosphatase-conjugated secondary Ab and developed as described in Materials and Methods. The dashed line indicates an absorbance value that is 3 SD above the mean observed with 16 normal human sera. Autoimmune sera that gave signals above this value were considered positive for Abs to DNL IV/XRCC4. Screening was performed twice, and representative results are shown. B, Titers of selected autoimmune sera as measured by ELISA. Eleven sera were assayed as described in A. Five representative results shown.

 
Serial dilutions were performed with a representative sampling of positive sera. Most sera gave similar results, with significant immunoreactivity at 1/2,500 and detectable immunoreactivity at 1/25,000 dilutions (Fig. 1GoB).

A breakdown of the results by diagnosis is shown in Table IGo. Except for two patients for whom a definitive diagnosis was not available, all positive sera were derived from patients with SLE or overlap syndrome. The frequency of autoantibodies in these groups together was ~20%. Autoantibodies against the DNL IV/XRCC4 complex were not found among the limited number of patients with scleroderma, polymyositis, Raynaud’s phenomenon, or other diagnoses.


View this table:
[in this window]
[in a new window]
  		Table I. Frequency of DNL IV/XRCC4 autoantibodies by diagnosis

 
Preliminary experiments were performed to screen for the presence of Ku protein in the same sera. Some of the samples showed relatively weak immunoreactivity with purified Ku in an ELISA, but there was no apparent correlation with the presence of Abs to DNL IV and XRCC4 (data not shown), and these experiments were not pursued.

Rescreening and determination of subunit specificity by immunoblotting

Selected sera were rescreened by immunoblotting against purified DNL IV and XRCC4. Representative results are shown in Fig. 2Go. Among the 24 ELISA-positive sera, 8 were positive by immunoblotting (Fig. 2Go, lanes 1–8). The remaining 16 were very weak or negative (data not shown), presumably because they contained Abs at levels below the threshold for detection by immunoblotting or that were directed against conformational epitopes, which were lost when the Ag was subjected to SDS-PAGE. The presence of Abs directed against conformational epitopes is common in other autoantigen systems (40, 41). ELISA-negative sera were very weak or negative when rescreened by immunoblotting (Fig. 2Go, lanes 9–16, and data not shown).



View larger version (68K):
[in this window]
[in a new window]
  		FIGURE 2. Analysis of human autoimmune sera by immunoblotting. Purified DNL IV/XRCC4 protein was subjected to electrophoresis on a 7% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane. The blot was cut into strips, which were individually incubated with the indicated human autoimmune sera at 1/250 dilutions or with mAbs directed against hemagglutinin (HA) or hexahistidine (his) tags, as indicated. A control incubation was performed with normal human serum (NHS). Strips were incubated with alkaline phosphatase-conjugated secondary Abs and developed as described in Materials and Methods. Molecular mass markers are indicated on the left (kilodaltons). Arrows at the right denote the positions of DNL IV and XRCC4 polypeptides. All sera were screened once by immunoblotting. Positive sera and selected negative sera were rescreened to give the results shown. Strips 1–8 were incubated with sera that were positive by ELISA. Strips 9–13 were incubated with sera that were negative by ELISA.

 
For those sera that were positive, immunoblotting provided useful information about the specificity of the autoantibodies. Abs in one serum bound strongly to the DNL IV polypeptide only (M068), Abs in another bound strongly to XRCC4 and weakly to DNL IV (M109), and Abs in a third bound strongly to XRCC4 only (M124). Abs in another five sera bound weakly to either DNL IV or XRCC4, but not to both (M014, M076, M119, M130, M131).

Mapping of an autoimmune epitope in XRCC4

It was of interest to map the autoimmune epitopes with respect to the primary sequence and functional sites in the DNL IV and XRCC4 polypeptides. Initial mapping studies were performed with serum M124, which had the strongest reactivity in an immunoblot among the sera tested. Our experiments took advantage of several unique, naturally occurring protease cleavage sites in XRCC4. It has previously been reported that XRCC4 is an in vivo substrate of caspase 3, which cleaves during radiation-induced apoptosis (31). To identify the exact site of cleavage, we analyzed the products formed when the DNL IV/XRCC4 complex was digested with caspase 3 in vitro. SDS-PAGE showed two products (Fig. 3GoA). These were transferred to a membrane and subjected to N-terminal sequencing as described in Materials and Methods. The results, summarized in Fig. 3GoE, showed that cleavage occurred between residues 265 and 266. We also tested cleavage by granzyme B, an inflammatory protease, in similar experiments. This enzyme also cut at a single site, between XRCC4 residues 254 and 255 (Fig. 3Go, A and E). DNL IV was not cleaved by either protease under the conditions used.



View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 3. Mapping of a major linear epitope in XRCC4. A, Purified DNL IV/XRCC4 protein was incubated in vitro with 20 U caspase 3 or 7 U granzyme B under the conditions described in Materials and Methods. Products were resolved by 12% SDS-PAGE. Products were visualized by staining with Coomassie blue or by immunoblotting with serum M124 at 1/1000 dilution, as indicated. Filled arrows denote the position of uncleaved DNL IV and XRCC4. Open arrows indicate the positions of caspase 3 and granzyme B cleavage fragments. An asterisk denotes granzyme B. B, Immunoblotting of recombinant XRCC4 fragments with serum M124 as described in A. Recombinant proteins were expressed and purified as described in Materials and Methods. Equal amounts of protein were loaded in each lane, as verified in a Coomassie blue-stained gel run in parallel (not shown). C, Immunoblotting of the indicated proteins was performed using autoimmune serum M124. Equal amounts of protein were loaded in each lane. Background in the region of lanes 2–4 was not seen in other experiments and does not correspond to the positions of protein bands in these lanes. D, Peptide ELISA using serum M124 or normal human serum (NHS) at the indicated dilutions. ELISA was performed using biotinylated peptides in NeutrAvidin-coated microwells as described in Materials and Methods. Error bars denote the range of duplicate measurements. Error bars are not shown when this range was smaller than the symbol. E, Summary diagram showing position of caspase 3 and granzyme B cleavage site and the relative positions of the four peptides used for ELISA. The amino acid sequences shown denote residues identified by N-terminal sequencing of cleavage products.

 
To map the autoimmune epitope with respect to the sites of protease cleavage, digestion products were transferred to a membrane and immunoblotted with serum M124 (Fig. 3GoA). Only the larger caspase 3 fragment was detected, indicating that sequences N-terminal to residue 265 are necessary and sufficient for Ab recognition. Serum M124 did not recognize either of the granzyme B products, indicating that a sequence spanning residue 254/255 must remain intact for epitope recognition (lane 6).

To better identify the boundaries of the XRCC4 epitope, mapping was performed using recombinant XRCC4 fragments expressed in bacteria. Fig. 3GoB shows a series of C-terminal deletion mutants. Proteins were purified as described in Materials and Methods, and equal amounts were loaded, as shown by Coomassie staining of replicate gels (data not shown). The immunoreactivity of XRCC41–310 and XRCC41–270 fragments was comparable to that of full-length XRCC4 (Fig. 3GoB, compare lanes 1, 5, and 6). By contrast, little or no immunoreactivity was seen when additional sequences were deleted in XRCC41–115, XRCC41–180, and XRCC41–215 (Fig. 3GoB, lanes 2–4). Taken together with results from Fig. 3GoA, these data indicate that sequences between residues 215 and 265 form an essential part of the autoimmune epitope.

Further mapping studies were performed using smaller fragments of XRCC4 expressed as GST fusion proteins (Fig. 3GoC). Immunoreactivity was seen with GST-X4180–270 (Fig. 3GoC, lanes 7 and 12), but not with GST-X4180–260 (lane 6) or any of a series of shorter constructs (lanes 3–5). Immunoreactivity was also seen with GST-X4251–334 (lane 10), but not with GST-X4266–334. Thus, immunoreactivity correlated with the presence of a sequence between 251–265, which appears to form the major epitope recognized under these conditions.

To confirm this finding, four overlapping peptides were synthesized covering the predicted epitope region and adjacent sequences. The results of an ELISA are shown in Fig. 3GoD, and the relative location of each peptide is diagrammed in Fig. 3GoE. Only peptide 4, spanning residues 251–265, showed immunoreactivity. These data confirm the epitope mapping results obtained by immunoblotting in Fig. 3Go, A–C. They establish that sequences between residues 251 and 265 are both necessary and sufficient for autoantibody recognition.

Recognition of the XRCC4251–265 epitope by other sera

It was of interest to determine whether the same epitope was recognized by autoantibodies in other sera. Peptide ELISA were performed, with results shown in Fig. 4Go. Serum M109 showed a level of immunoreactivity that was distinctly above background with peptide 4 (Fig. 4GoA). There was no reactivity above background with the other peptides. The specificity of serum M109 was confirmed by immunoblotting, where it reacted with GST-X4180–270 and GST-X4251–334, but not with several other constructs in which the epitope region had been deleted (Fig. 4GoC). Serum M162 also showed immunoreactivity with peptide 4 in an ELISA (Fig. 4GoB). Eleven other autoimmune sera were negative, indicating that they recognize conformational epitopes or epitopes elsewhere in the protein.



View larger version (49K):
[in this window]
[in a new window]
  		FIGURE 4. Screening of additional sera by peptide ELISA. A, Serum M109 were diluted over a range 1/200 to 1/800 and were tested by ELISA using biotinylated peptides, as described in Materials and Methods. Peptides are the same as in Fig. 3Go. Error bars denote the range of duplicate measurements. B, Twelve additional sera were screened for immunoreactivity with peptide 4. Serum M124 was included as a positive control, and normal human serum (NHS) was used as a negative control. C, Immunoblotting of the indicated proteins was performed using serum M109. Equal amounts of protein were loaded in each lane.

 
The XRCC4251–265 epitope can be immunodominant

It was also of interest to determine whether the XRCC4251–265 epitope was immunodominant in any of the sera containing this specificity. Competitive ELISA was performed, in which purified DNL IV/XRCC4 complex was adsorbed to a multiwell plate, and the immunoreactivity of different sera was measured in the presence of varying amounts of free competitor peptide. The results are shown in Fig. 5Go. Serum M124 was strikingly susceptible to competition with peptide 4, but not with a control peptide, indicating that the XRCC4251–265 epitope is immunodominant. Although less immunoreactive under these conditions, sera M109 and M162 did not appear to be susceptible to competition by peptide 4, suggesting that they contain additional specificities.



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 5. Competitive ELISA. DNL IV/XRCC4 complex was adsorbed to microwells, and ELISA was performed as described in Fig. 1Go using a 1/200 dilution of serum M124 and normal human serum (NHS) and a 1/100 dilution of sera M109 and M162. The indicated amounts of peptide were included during the incubation with primary Ab. Peptides are numbered as described in Fig. 4Go. No streptavidin was present, so competitor peptide remained in the solution phase. Error bars denote the range of duplicate measurements.

 
The epitope region is both a substrate and a regulator of DNA-PKcs

Ku and DNA-PKcs bind to broken DNA ends to form an active DNA-PK complex. XRCC4 is a substrate for this kinase in vitro and in vivo (29, 30, 31), and it is believed that this phosphorylation may be important for regulation of the NHEJ pathway. Phosphorylation occurs at multiple sites within the XRCC4 C-terminal region, the exact locations of which have not been reported (29, 30). To determine the relationship between the phosphorylation sites and the epitope region, we conducted an in vitro kinase reaction using native DNL IV/XRCC4 complex and purified Ku and DNA-PKcs. As shown in Fig. 6Go, [{gamma}-32P]ATP radiolabel was incorporated preferentially into XRCC4, rather than DNL IV, although both polypeptides were present in stoichiometric amounts (Fig. 6Go, A and B, lane 1). Caspase 3 digestion, performed subsequent to radiolabeling, revealed that phosphorylation occurred in both the N-terminal 1–265 and C-terminal 266–334 fragments (Fig. 6GoA). We designated the sites in these two fragments as N-X4 and C-X4, respectively. Under the conditions tested, the N-X4 site was used ~3-fold less efficiently than the C-X4 site.



View larger version (42K):
[in this window]
[in a new window]
  		FIGURE 6. In vitro phosphorylation of DNL IV/XRCC4 by DNA-PK. Phosphorylation was performed using purified DNL IV/XRCC4, Ku protein, and DNA-PKcs in the presence of [{gamma}-32P]ATP (6000 Ci/mmol) as described in Materials and Methods. Radiolabeled proteins were resolved by 12% SDS-PAGE and detected by PhosphorImager analysis. A, Mapping of phosphorylation sites with respect to the caspase 3 site. Lane 1, No caspase treatment. Lanes 2 and 3, Caspase 3 was added to the reaction postradiolabeling. The reaction in lane 2 contained 100 mM DEVD peptide inhibitor, which prevented cleavage. Lane 4, Caspase 3 was added to the reaction before radiolabeling. Cleavage was terminated by addition of 100 mM DEVD peptide inhibitor; Ku, DNA-PKcs, and ATP were added; and incubation was continued to allow radiolabeling. B, Mapping of phosphorylation sites with respect to the granzyme B site. Phosphorylation was performed as described in A, except that granzyme B was used in place of caspase 3. C, Mapping of phosphorylation sites using GST fusion proteins. Phosphorylation was performed as described in A, except that substrates were the indicated GST-XRCC4 fusion proteins. The reaction in lane 2 contained caspase 3, added postradiolabeling. D, Peptide phosphorylation assay. Radiolabeled peptide was captured on a streptavidin membrane as described in Materials and Methods. Peptide 4 is as shown in Fig. 4Go. Other peptides had alanine substituted for serine or threonine at the indicated positions. The experiment was performed three times, and representative results are shown. E, Phosphorylation assays using mutant proteins. Phosphorylation was performed using the same GST fusion proteins as in Fig. 3Go and, in addition, protein with the indicated serine to alanine mutation at position 260. Incorporation of radiolabel at positions corresponding to undigested and N-X4 and C-X4 fragments is shown in the table at the bottom, normalized to undigested GST-X4251–334. N/A, not applicable. F, Summary diagram showing relative positions of N-X4 and C-X4 sites. The sequence of the relevant portion of peptide 4 is shown. Asterisks denote potential phosphoacceptor residues in region between granzyme B site (residue 255) and caspase 3 site (residue 265), with the site of actual phosphorylation at residue 260 noted.

 
Further mapping was performed using granzyme B digestion. When radiolabeled protein was cleaved with this enzyme, only a single phosphorylated product was seen, corresponding to a fragment that spans residues 255–334 (Fig. 6GoB, lane 2). Because this is the only radiolabeled cleavage product, it must contain both the N-X4 and C-X4 sites. Taking the results in Fig. 6Go, A and B, together, the N-X4 site must map in the interval between the granzyme B and caspase 3 site, that is, in the interval spanning residues 255–265. The C-X4 site must map C-terminal to the caspase 3 site, between residues 266 and 334. There are no phosphorylation sites N-terminal to the granzyme B site. These results are consistent with and extend findings reported previously by others (29, 30).

Interestingly, when the DNL IV/XRCC4 substrate was cleaved with caspase 3 before radiolabeling, only the N-X4 site was used (Fig. 6GoA, lane 4). Thus, sequences N-terminal to the caspase 3 site control phosphorylation of the C-X4 site. Stimulation of phosphorylation occurs only in cis, and not when the two parts of XRCC4 are severed by protease cleavage.

Phosphorylation results were confirmed using GST fusion proteins as substrates. The results are shown in Fig. 6GoC. GST-X4251–334 contains both the N-X4 and C-X4 sites. It was phosphorylated relatively efficiently, and caspase 3 cleavage showed that both the N-X4 and C-X4 sites were used (Fig. 6GoC, lanes 1 and 2). GST-X4266–334, which contains the C-X4 site only and is analogous to the natural C-terminal caspase 3 cleavage fragment, was used much less efficiently (lane 3). In control experiments GST alone showed no specific phosphorylation (data not shown). These results confirm that in addition to serving as a substrate for DNA-PK, sequences in the N-X4 region are required for efficient phosphorylation elsewhere in the protein.

The N-X4 site maps to an 11-residue interval that coincides with the autoimmune epitope. There are four potential phosphoacceptor residues within the sequence of interest (Fig. 6GoF). Peptide substrates were synthesized in which each of these residues was substituted by alanine. Peptide quality was verified and concentrations were standardized as described in Materials and Methods. The results of a peptide phosphorylation assay are shown in Fig. 6GoD. The S260A substitution completely eliminated the ability to serve as substrate and was the only substitution to have this effect. This indicates that serine 260 is the sole phosphorylation site in the region. The S256A and S259A substitutions increased the apparent km for substrate utilization, but did not affect the apparent maximum velocity, indicating that these contribute to substrate recognition, but do not correspond to actual sites of phosphorylation. The T264A substitution had no effect. These results are summarized in Fig. 6GoF.

To confirm these results in the context of a larger protein fragment, the S260A substitution was introduced into the GST-X4251–334 construct. This substitution reduced use of the N-X4 site to almost undetectable levels and reduced use of the C-X4 site by ~2-fold. The reduction in C-X4 phosphorylation is consistent with the requirement for N-X4 sequences for full use of the C-X4 site, shown originally in Fig. 6GoA.

Precise coincidence between structural determinants required for DNA-PK phosphorylation and immunoreactivity

To examine the correlation between structural determinants required for DNA-PK phosphorylation and recognition by autoantibodies, we performed peptide ELISA using different sequence variants. The results are shown in Fig. 7Go. The S260A substitution eliminated immunoreactivity with serum M124. The S256A and S259A substitutions partially reduced immunoreactivity, and the T264A substitution had no effect. Thus, relative immunoreactivity closely paralleled the ability to be used as a DNA-PK substrate.



View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 7. ELISA using peptides with substitutions in epitope region. Peptide ELISA was performed as described in Fig. 3Go using biotinylated peptides containing the indicated substitutions. ELISA was performed with serum M124, serum M109, and normal human serum (NHS) as indicated. Error bars denote the range of duplicate measurements.

 
Peptide ELISA was also performed using peptides with a phosphoserine substitution at position 260. This substitution also eliminated immunoreactivity (Fig. 7Go). Similar results were obtained with both serum M124 and M109. These results together with the results of the alanine substitutions indicate that the side chain hydroxyl group of serine 260 is essential both for DNA-PK recognition and for immunoreactivity. Side chains of serines 256 and 259 contribute to both processes, but are not absolutely required.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
We used a panel of sera from patients with SLE and other systemic rheumatic diseases to identify the DNL IV/XRCC4 complex as a new human autoantigen. Sera from 24 patients, ~15% of the panel, showed significant levels of immunoreactivity against purified complex in an ELISA. Further characterization of the positive sera showed that multiple epitopes were recognized. In some cases these were conformational, but in others they could be mapped to individual DNL IV and XRCC4 polypeptides by immunoblotting. The major linear epitope in XRCC4 was shown to correspond to a short sequence that overlapped with recognition sites for inflammatory and apoptotic proteases and coincided with a site of DNA-PK phosphorylation. Abs to this epitope were detected in three sera. In one serum, which had a relatively high level of immunoreactivity, a competition ELISA showed that this single epitope was immunodominant.

The majority of the positive sera were from patients with SLE. However, only a limited number of sera were available from patients with other diagnoses, and we cannot exclude the possibility that anti-DNL IV and anti-XRCC4 Abs may occur in association with other systemic rheumatic diseases. Although the panel of sera used in the present study was sufficient to demonstrate the existence of this new autoantibody system, sera from a larger and more defined population will be needed to determine the association of these autoantibodies with specific disease states.

The present findings increase to five the number of polypeptides in the NHEJ pathway that have been shown to be targets of autoantibodies in patients with SLE or other systemic rheumatic diseases. These include the two subunits of Ku and the catalytic subunit of DNA-PK as well as the DNL IV and XRCC4 characterized in the present study. These findings raise an obvious question whether exposure to radiation or other agents that induce DNA double-strand breaks may influence the development of an autoimmune response in susceptible individuals. Previous studies in animals and humans have suggested that radiation exposure can be correlated with the production of autoantibodies or the manifestation of autoimmune disease (42, 43, 44, 45, 46). More specific measurements of autoantibodies to NHEJ proteins in exposed populations may help clarify whether radiation contributes to autoantibody production in this context.

NHEJ proteins are latent in the normal cell and form complexes with damaged DNA fragments in the context of genotoxic injury and cell death. In some cases exposure to double-strand break-inducing agents also involves introduction of specific post-translational modifications, including phosphorylation and protease cleavage. In the present study we used a combination of biochemical approaches to map the sites of two of these modifications, a caspase 3 cleavage site and a DNA-PKcs phosphorylation site, with greater precision than had been previously reported (29, 30, 31). We also mapped a novel granzyme B site of as yet unknown significance. All these sites fall within or near the short linear epitope recognized by three of the autoimmune sera. This remarkable juxtaposition provides further support for the idea that the conversion from latent to active form or the introduction of radiation-induced post-translational modifications is connected with initiation of the autoimmune response.

Although many autoantigens are susceptible to cleavage with caspase 3, granzyme B, or both, the present results provide one of the few examples of an autoimmune epitope that has been mapped with sufficient precision to show that it lies in immediate physical proximity to the protease cleavage sites. It will be of interest to learn whether close physical proximity of autoimmune epitopes and protease cleavage sites is a general feature in other autoantigen systems. Closely spaced caspase 3 and granzyme B sites occur in DNA-PKcs (14), but their relationship to the autoimmune epitopes is unknown. In another DNA repair protein, poly(ADP)-ribose polymerase, autoantibodies were shown to recognize conformational epitopes in the two zinc finger motifs, one of which lies only 10 residues upstream from the major caspase site (47). Thus, poly(ADP)-ribose polymerase may afford another example of an epitope that maps immediately adjacent to a site of proteolytic cleavage.

One of the interesting characteristics of the autoantisera in the present study is that, although strongly reactive in the initial screening assays, interaction with the DNL IV/XRCC4 complex in solution was relatively inefficient. Only weak immunoreactivity was seen in immunoprecipitation assays, and in preliminary experiments antisera failed to give functional inhibition in cell-free, end-joining assays (data not shown). Preliminary attempts to increase the immunoprecipitation efficiency by digestion of the complex with caspase 3, in vitro phosphorylation, or incubation with Ku, DNA-PKcs, and DNA did not result in persuasive differences. It is thus possible that there are additional, unknown modifications or conformational changes that accompany the assembly of a functional repair complex in vivo that enhance the accessibility of the epitope in the native protein.


   Acknowledgments
 
We thank John A. Hardin for assistance with initiating these studies and Joseph Bailey and Tom Ulmer for provision of sera. We acknowledge the Medical College of Georgia Molecular Biology and Cell Production core facilities for technical support.


   Footnotes
 
1 This work was supported by the U.S. National Science Foundation (MCB-9906440), the U.S. Public Health Service (GM35866), and the U.S. Department of Energy Low Dose Radiation Research Program (DE-FG07-99ER62875). W.S.D. received support as an Eminent Scholar of the Georgia Research Alliance. Back

2 K.-J.L. and X.D. made equal contributions to this work. Back

3 Current address: Department of Molecular Biology, Massachusetts General Hospital, 38 Sidney Street, Suite 100, Cambridge, MA 02139. Back

4 Current address: Division of Rheumatology, Immunology, and Allergy, Brigham and Women’s Hospital, Harvard Medical School, Department of Immunology and Infectious Diseases, Harvard School of Public Health, Boston, MA 02115. Back

5 Address correspondence and reprint requests to Dr. William S. Dynan, Institute of Molecular Medicine and Genetics, Room CB-2803, Medical College of Georgia, Augusta, GA 30912. Email address: wdynan{at}mail.mcg.edu Back

6 Abbreviations used in this paper: SLE, systemic lupus erythematosus; DNA-PKcs, DNA-dependent protein kinase catalytic subunit; DNL IV, DNA ligase IV; NHEJ, nonhomologous end joining. Back

Received for publication March 7, 2002. Accepted for publication July 11, 2002.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Tan, E. M.. 1989. Antinuclear antibodies: diagnostic markers for autoimmune diseases and probes for cell biology. Adv. Immunol. 44:93.[Medline]
  2. Reeves, W. H., M. Satoh, J. Wang, C. H. Chou, A. K. Ajmani. 1994. Systemic lupus erythematosus: antibodies to DNA, DNA-binding proteins, and histones. Rheum. Dis. Clin. North Am. 20:1.[Medline]
  3. Hardin, J. A.. 1986. The lupus autoantigens and the pathogenesis of systemic lupus erythematosus. Arthritis Rheum. 29:457.[Medline]
  4. Craft, J. E., J. A. Hardin. 1987. Linked sets of antinuclear antibodies: what do they mean?. J. Rheumatol. 14:(Suppl. 13):106.
  5. Satoh, M., A. K. Ajmani, L. Stojanov, J. J. Langdon, T. Ogasawara, J. Wang, M. A. Dooley, H. B. Richards, J. B. Winfield, T. H. Carter, et al 1996. Autoantibodies that stabilize the molecular interaction of Ku antigen with DNA-dependent protein kinase catalytic subunit. Clin. Exp. Immunol. 105:460.[Medline]
  6. Satoh, M., H. B. Richards, K. J. Hamilton, W. H. Reeves. 1997. Human anti-nuclear ribonucleoprotein antigen autoimmune sera contain a novel subset of autoantibodies that stabilizes the molecular interaction of U1RNP-C protein with the Sm core proteins. J. Immunol. 158:5017.[Abstract]
  7. Wang, J., X. Dong, L. Stojanov, D. Kimpel, M. Satoh, W. H. Reeves. 1997. Human autoantibodies stabilize the quaternary structure of Ku antigen. Arthritis Rheum. 40:1344.[Medline]
  8. Takeda, Y., W. S. Dynan. 2001. Autoantibodies against DNA double-strand break repair proteins. Front. Biosci. 6:D1412.[Medline]
  9. Jafri, F., J. A. Hardin, W. S. Dynan. 2001. A method to detect particle-specific antibodies against Ku and the DNA-dependent protein kinase catalytic subunit in autoimmune sera. J. Immunol. Methods 251:53.[Medline]
  10. Tan, E. M., Y. Muro, K. M. Pollard. 1994. Autoantibody-defined epitopes on nuclear antigens are conserved, conformation-dependent and active site regions. Clin. Exp. Rheumatol. 12:(Suppl. 11):S27.
  11. Casciola-Rosen, L. A., G. J. Anhalt, A. Rosen. 1995. DNA-dependent protein kinase is one of a subset of autoantigens specifically cleaved early during apoptosis. J. Exp. Med. 182:1625.[Abstract/Free Full Text]
  12. Casciola-Rosen, L., D. W. Nicholson, T. Chong, K. R. Rowan, N. A. Thornberry, D. K. Miller, A. Rosen. 1996. Apopain/CPP33 cleaves proteins that are essential for cellular repair: a fundamental principle of apoptotic death. J. Exp. Med. 183:1957.[Abstract/Free Full Text]
  13. Casciola-Rosen, L. A., G. Anhalt, A. Rosen. 1994. Autoantigens targeted in systemic lupus erythematosus are clustered in two populations of surface structures on apoptotic keratinocytes. J. Exp. Med. 179:1317.[Abstract/Free Full Text]
  14. Casciola-Rosen, L., F. Andrade, D. Ulanet, W. B. Wong, A. Rosen. 1999. Cleavage by granzyme B is strongly predictive of autoantigen status: implications for initiation of autoimmunity. J. Exp. Med. 190:815.[Abstract/Free Full Text]
  15. Mimori, T., M. Akizuki, H. Yamagata, S. Inada, S. Yoshida, M. Homma. 1981. Characterization of a high molecular weight acidic nuclear protein recognized by autoantibodies in sera from patients with polymyositis-scleroderma overlap. J. Clin. Invest. 68:611.
  16. Reeves, W. H.. 1985. Use of monoclonal antibodies for the characterization of novel DNA-binding proteins recognized by human autoimmune sera. J. Exp. Med. 161:18.[Abstract/Free Full Text]
  17. Yaneva, M., F. C. Arentt. 1989. Antibodies against Ku protein in sera from patients with autoimmune diseases. Clin. Exp. Immunol. 76:366.[Medline]
  18. Olhoffer, I. H., S. L. Peng, J. Craft. 1997. Revisiting autoantibody profiles in systemic lupus erythematosus. J. Rheumatol. 24:297.[Medline]
  19. Suwa, A., M. Hirakata, Y. Takeda, U. Okano, T. Mimori, S. Inada, F. Watanabe, H. Teraoka, W. S. Dynan, J. A. Hardin. 1996. Autoantibodies to DNA-dependent protein kinase: probes for the catalytic subunit. J. Clin. Invest. 97:1417.[Medline]
  20. McConnell, K. R., W. S. Dynan, J. Hardin. 1997. The DNA-dependent protein kinase catalytic subunit (p460) is cleaved during Fas-mediated apoptosis in Jurkat cells. J. Immunol. 158:2083.[Abstract]
  21. Han, Z., N. Malik, T. Carter, W. H. Reeves, J. H. Wyche, E. A. Hendrickson. 1996. DNA-dependent protein kinase is a target for a CPP32-like apoptotic protease. J. Biol. Chem. 271:25035.[Abstract/Free Full Text]
  22. Teraoka, H., Y. Yumoto, F. Watanabe, K. Tsukada, A. Suwa, M. Enari, S. Nagata. 1996. CPP32/yama/apopain cleaves the catalytic component of DNA-dependent protein kinase in the holoenzyme. FEBS Lett. 393:1.[Medline]
  23. Song, Q., S. P. Lees-Miller, S. Kumar, Z. Zhang, D. W. Chan, G. C. Smith, S. P. Jackson, E. S. Alnemri, G. Litwack, et al 1996. DNA-dependent protein kinase catalytic subunit: a target for an ICE-like protease in apoptosis. EMBO J. 15:3238.[Medline]
  24. Critchlow, S. E., R. P. Bowater, S. P. Jackson. 1997. Mammalian DNA double-strand break repair protein XRCC4 interacts with DNA ligase IV. Curr. Biol. 7:588.[Medline]
  25. Grawunder, U., M. Wilm, X. Wu, P. Kulesza, T. E. Wilson, M. Mann, M. R. Lieber. 1997. Activity of DNA ligase IV stimulated by complex formation with XRCC4 protein in mammalian cells. Nature 388:492.[Medline]
  26. Schär, P., G. Herrmann, G. Daly, T. Lindahl. 1997. A newly identified DNA ligase of Saccharomyces cerevisiae involved in RAD52-independent repair of DNA double-strand breaks. Genes Dev. 11:1912.[Abstract/Free Full Text]
  27. Teo, S.-H., S. P. Jackson. 1997. Identification of Saccharomyces cerevisae DNA ligase IV: involvement in DNA double-strand break repair. EMBO J. 16:4788.[Medline]
  28. Wilson, T. E., U. Grawunder, M. R. Lieber. 1997. Yeast DNA ligase IV mediates non-homologous DNA end joining. Nature 388:495.[Medline]
  29. Leber, R., T. W. Wise, R. Mizuta, K. Meek. 1998. The XRCC4 gene product is a target for and interacts with the DNA-dependent protein kinase. J. Biol. Chem. 273:1794.[Abstract/Free Full Text]
  30. Modesti, M., J. E. Hesse, M. Gellert. 1999. DNA binding of Xrcc4 protein is associated with V(D)J recombination but not with stimulation of DNA ligase IV activity. EMBO J. 18:2008.[Medline]
  31. Matsumoto, Y., N. Suzuki, N. Namba, N. Umeda, X. J. Ma, A. Morita, M. Tomita, A. Enomoto, S. Serizawa, K. Hirano, et al 2000. Cleavage and phosphorylation of XRCC4 protein induced by x-irradiation. FEBS Lett. 478:67.[Medline]
  32. Tan, E. M., A. S. Cohen, J. F. Fries, A. T. Masi, D. J. McShane, N. F. Rothfield, J. G. Schaller, N. Talal, R. J. Winchester. 1982. The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum. 25:1271.[Medline]
  33. Subcommittee for Scleroderma Criteria of the American Rheumatism Association Diagnostic and Therapeutic Criteria Committee. 1980. Preliminary criteria for the classification of systemic sclerosis (scleroderma). Arthritis Rheum. 23:581.[Medline]
  34. Bohan, A., J. B. Peter. 1975. Polymyositis and dermatomyositis (first of two parts). N. Engl. J. Med. 292:344.[Medline]
  35. Lee, K. J., J. Huang, Y. Takeda, W. S. Dynan. 2000. DNA ligase IV and XRCC4 form a stable mixed tetramer that functions synergistically with other repair factors in a cell-free end-joining system. J. Biol. Chem. 275:34787.[Abstract/Free Full Text]
  36. Takeda, Y., P. Caudell, G. Grady, G. Wang, A. Suwa, G. C. Sharp, W. S. Dynan, J. A. Hardin. 1999. Human RNA helicase A is a lupus autoantigen that is cleaved during apoptosis. J. Immunol. 163:6269.[Abstract/Free Full Text]
  37. Peterson, S. R., A. Dvir, C. W. Anderson, W. S. Dynan. 1992. DNA binding provides a signal for phosphorylation of the RNA polymerase II heptapeptide repeats. Genes Dev. 6:426.[Abstract/Free Full Text]
  38. Dvir, A., L. Y. Stein, B. L. Calore, W. S. Dynan. 1993. Purification and characterization of a template-associated protein kinase that phosphorylates RNA polymerase II. J. Biol. Chem. 268:10440.[Abstract/Free Full Text]
  39. Yoo, S., A. Kimzey, W. S. Dynan. 1999. Photocross-linking of an oriented DNA repair complex. Ku bound at a single DNA end. J. Biol. Chem. 274:20034.[Abstract/Free Full Text]
  40. Satoh, M., J. J. Langdon, K. J. Hamilton, H. B. Richards, D. Panka, R. A. Eisenberg, W. H. Reeves. 1996. Distinctive immune response patterns of human and murine autoimmune sera to U1 small nuclear ribonucleoprotein C protein. J. Clin. Invest. 97:2619.[Medline]
  41. Tsuzaka, K., T. Fujii, M. Akizuki, T. Mimori, T. Tojo, H. Fujii, Y. Tsukatani, A. Kubo, M. Homma. 1994. Clinical significance of antibodies to native or denatured 60-kd or 52-kd Ro/SS-A proteins in Sjogren’s syndrome. Arthritis Rheum. 37:88.[Medline]
  42. Sakaguchi, N., K. Miyai, S. Sakaguchi. 1994. Ionizing radiation and autoimmunity: induction of autoimmune disease in mice by high dose fractionated total lymphoid irradiation and its prevention by inoculating normal T cells. J. Immunol. 152:2586.[Abstract]
  43. Balsalobre, B.. 1991. Complement, circulating immunocomplexes and autoantibodies after ionizing radiation exposure. Rev. Esp. Fisiol. 47:147.[Medline]
  44. Pacini, F., T. Vorontsova, E. Molinaro, E. Kuchinskaya, L. Agate, E. Shavrova, L. Astachova, L. Chiovato, A. Pinchera. 1998. Prevalence of thyroid autoantibodies in children and adolescents from Belarus exposed to the Chernobyl radioactive fallout. Lancet 352:763.[Medline]
  45. Vermiglio, F., M. G. Castagna, E. Volnova, V. P. Lo Presti, M. Moleti, M. A. Violi, A. Artemisia, F. Trimarchi. 1999. Post-Chernobyl increased presence of humoral thyroid autoimmunity in children and adolescents from a moderately iodine-deficient area in Russia. Thyroid 9:781.[Medline]
  46. Kasatkina, E. P., D. E. Shilin, A. L. Rosenbloom, M. I. Pykov, G. V. Ibragimova, V. N. Sokolovskaya, A. N. Matkovskaya, T. N. Volkova, E. A. Odoud, M. I. Bronshtein, et al 1997. Effects of low level radiation from the Chernobyl accident in a population with iodine deficiency. Eur. J. Pediatr. 156:916.[Medline]
  47. Decker, P., J. P. Briand, G. de Murcia, R. W. Pero, D. A. Isenberg, S. Muller. 1998. Zinc is an essential cofactor for recognition of the DNA binding domain of poly(ADP-ribose) polymerase by antibodies in autoimmune rheumatic and bowel diseases. Arthritis Rheum. 41:918.[Medline]



This article has been cited by other articles:


Home page
 LupusHome page
Y-J. Lin, L. Wan, C-M. Huang, S-Y. Chen, Y-C. Huang, C-H. Lai, W-Y. Lin, H-P. Liu, Y-S. Wu, C-M. Chen, et al.
Polymorphisms in the DNA repair gene XRCC1 and associations with systemic lupus erythematosus risk in the Taiwanese Han Chinese population
Lupus, December 1, 2009; 18(14): 1246 - 1251.
[Abstract] [PDF]

Home page
 Rheumatology (Oxford)Home page
C. Schild-Poulter, A. Su, A. Shih, O. P. Kelly, M. J. Fritzler, R. Goldstein, and R. J. G. Hache
Association of autoantibodies with Ku and DNA repair proteins in connective tissue diseases
Rheumatology, February 1, 2008; 47(2): 165 - 171.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
H. Yajima, K.-J. Lee, and B. P. C. Chen
ATR-Dependent Phosphorylation of DNA-Dependent Protein Kinase Catalytic Subunit in Response to UV-Induced Replication Stress
Mol. Cell. Biol., October 15, 2006; 26(20): 7520 - 7528.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
M. Sebbagh, J. Hamelin, J. Bertoglio, E. Solary, and J. Breard
Direct cleavage of ROCK II by granzyme B induces target cell membrane blebbing in a caspase-independent manner
J. Exp. Med., February 7, 2005; 201(3): 465 - 471.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y.-G. Wang, C. Nnakwe, W. S. Lane, M. Modesti, and K. M. Frank
Phosphorylation and Regulation of DNA Ligase IV Stability by DNA-dependent Protein Kinase
J. Biol. Chem., September 3, 2004; 279(36): 37282 - 37290.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
D. B. Ulanet, M. Torbenson, C. V. Dang, L. Casciola-Rosen, and A. Rosen
Unique conformation of cancer autoantigen B23 in hepatoma: A mechanism for specificity in the autoimmune response
PNAS, October 14, 2003; 100(21): 12361 - 12366.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, K.-J.
Right arrow Articles by Dynan, W. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, K.-J.
Right arrow Articles by Dynan, W. S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS