| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Program in Cell Biology, Research Institute, The Hospital for Sick Children, and Department of Biochemistry, University of Toronto, Toronto, Ontario, Canada; and
Department of Medicine, University of Pennsylvania School of Medicine, Philadelphia, PA 19104
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The formation of the phagosome requires the targeted delivery of vesicle-associated membrane protein (VAMP)3-3-containing vesicles from the recycling endosome compartment, contributing to the elongation of membranous pseudopods (7). VAMP-3 is a member of the family of soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) proteins that are thought to be required for the fusion of vesicles with their target membranes. In the nervous system, members of the VAMP family present on vesicles form coiled-coil complexes with SNARE proteins from the syntaxin and SNAP-25 families located on the target membrane. The formation of these complexes is thought to provide the driving force for membrane fusion (8). Multiple members of the VAMP and syntaxin families have been identified, and each appears to localize to specific membrane compartments along the secretory and endocytic pathways. This has been taken as evidence that unique sets of SNAREs may mediate fusion between membranes from specific compartments.
Once internalized, the phagosomal membrane undergoes a progressive maturation, first resembling early endosomes and subsequently acquiring markers found in the late endosome and lysosome compartments (9). Maturation can be monitored by the phagosomal accumulation of endocytic proteins such as rab5 or the transferrin receptor at early time points, followed by the acquisition of late endosomal and lysosomal proteins such as rab7, the mannose 6-phosphate receptor, and lysosome-associated membrane protein (LAMP)-1. Interestingly, many of the early markers are lost as the late markers are being acquired, suggesting that this maturation process involves multiple ordered fusion/fission events with different components of the endocytic pathway (10).
In vitro studies have shown that phagosome-endosome and phagosome-lysosome fusions are dependent on the ATPase N-ethylmaleimide-sensitive factor (11, 12), indicating a requirement for SNARE proteins throughout this process. Moreover, it has been observed that the efficiency of defined fusion events with the isolated phagosome changes over time, suggesting that temporal changes in its membrane composition influence its capacity for fusion. Early phagosomes isolated within 20 min of the onset of phagocytosis fuse readily with endosomes, but poorly with lysosomes, while phagosomes that have matured for 2 h in vivo fuse most efficiently with lysosomes, but not at all with endosomes (13, 14).
Because SNARE proteins are required for phagosome-endosome and phagosome-lysosome fusion in vitro, and SNARE proteins such as syntaxin are localized to specific cellular compartments, it is reasonable to predict that specific SNARE proteins are required at different steps in phagosomal maturation in vivo. Moreover, if progressive changes in SNARE composition occur in vivo, this could explain differences in the propensity of phagosomes isolated at different stages of maturity to fuse with organelles in vitro. Therefore, we set out to investigate the role in phagosomal maturation of specific isoforms of the syntaxin family implicated in the endocytic pathway. As a starting point, we examined syntaxins 13 and 7, the two best-characterized endosomal syntaxins. We show in this study that syntaxins 13 and 7 reside in different compartments in phagocytic cells and that they accumulate in the phagosome at different rates. Moreover, we show that inhibition of their function by overexpression of dominant-negative forms arrests the maturation process before the acquisition of lysosomal markers.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
SRBC and rabbit anti-SRBC IgG were purchased from ICN
Pharmaceuticals (Costa Mesa, CA). Polystyrene beads, 3.3 µm in
diameter, were purchased from Bangs Laboratories (Carmel, IN). Human
IgG was purchased from Sigma-Aldrich (St. Louis, MO). 
-MEM and PBS
were purchased from Cellgro (Herndon, VA). FBS and G418 were from
Wisent (St. Bruno, Quebec, Canada). HEPES-buffered RPMI (H-RPMI)
was purchased from Sigma-Aldrich. FuGene-6 transfection reagent was
obtained from Hoffmann-LaRoche (Nutley, NJ). PEI25K
(polyethylenimine, 25 kDa) was also used as a transfection agent and
came from Sigma-Aldrich. DAKO mounting medium was from DAKO
(Carpenteria, CA). Tetramethylrhodamine-conjugated transferrin was
purchased from Molecular Probes (Eugene, OR). Restriction enzymes
NheI, SacI, EcoRI, and XhoI
were purchased from Life Technologies (Burlington, Ontario,
Canada). PFU DNA polymerase was obtained from Stratagene (La
Jolla, CA).
Mouse anti-human transferrin receptor was purchased from Zymed Laboratories (San Francisco, CA). Rabbit Ab specific to mannosidase II was a kind gift from K. Moreman (University of Georgia, Athens, GA) and M. Farquhar (University of California, San Diego, CA). mAb to Golgi matrix marker GM130 was purchased from Transduction Laboratories (Lexington, KY). Rabbit antimannose 6-phosphate receptor was a gift from S. Höning (Georg-August-Universität, Göttingen, Germany). Mouse anti-LAMP-1 and rat anti-LAMP-1 were obtained from the Developmental Studies Hybridoma Bank (University of Iowa, Iowa City, IA). Anti-MYC Abs were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Donkey anti-mouse Cy3, anti-rabbit Cy3, anti-rat Cy3, and anti-human Cy5 secondary Abs were purchased from Jackson ImmunoResearch Laboratories (West Grove, PA). Goat anti-mouse Alexa 488 and anti-rabbit Alexa 488 secondary Abs were from Molecular Probes.
cDNA constructs
Syntaxin 7 and 13 cDNAs were a kind gift of R. Scheller (Stanford University, Stanford, CA). N-terminal MYC-tagged syntaxin 7 was generated in a two-step process. First, oligomers encoding the MYC-C epitope (CTAGAGCCACCATGGAGCAGAAGC-TGATCAGCGAAGA-GGACCTG and CTAGCAGGTCCTCTTCGCTGATCAGCTT-CTGCTCCAT-GGTGGCT) were phosphorylated, annealed, and ligated into pCDNA3.1 (Invitrogen, San Diego, CA), previously digested with NheI, generating the construct MYC-N. Syntaxin 7 cDNA was PCR amplified using PFU DNA polymerase and oligomers (GCGGAGCTCAACCATGTCTTACACTCCAGGAGTTGG and GCGGAATTCGGTGGTTCAATCCCCATATGATGAGAC), digested with SacI and EcoRI, and ligated into the vector pEGFP-N1 (Clontech Laboratories, Palo Alto, CA), to create syntaxin 7-EGFP. The complete syntaxin 7 gene was then excised with NheI and EcoRI. This fragment was ligated into the MYC-N construct to produce an N-terminal MYC-tagged syntaxin 7 construct, subsequently referred to as 7 MYC. The fidelity of MYC-N and syntaxin 7 cDNA was confirmed by DNA sequence analysis.
Syntaxin 13 cDNA was PCR amplified using PFU DNA polymerase and oligomers (GCGCTCGAGTGTCA-TGTCATACGGTCCCTTAGACAT and GCGGAATTCGCTTAGAAGCAACCCA-GATAACAACTACC). The PCR product was then digested with XhoI and EcoRI and ligated into pEGFP-N1, to be in frame with a C-terminal enhanced green fluorescent protein (EGFP) tag. This construct will subsequently be referred to as 13GFP. The fidelity of syntaxin 13 cDNA was confirmed by DNA sequence analysis.
Cytosolic syntaxin 7 with the transmembrane domain (TM)
(7
TM) was made from the syntaxin 7-EGFP construct using the
QuikChange Site-Directed Mutagenesis kit from Stratagene Cloning
Systems, to create a translation stop codon immediately N terminal to
the transmembrane domain. Oligomers
ATCAGCGCAAATCTAGATAAACCCTG-TGCAT and
ATGCACAGGGTTTATCTAGATTTGCGCTGAT were used, and mutants were
screened for the introduction of a new XbaI site.
Cytosolic syntaxin 13 (13 TM) was constructed in the same manner
as 13GFP, using oligomers ATCAGCGCAAATCTAGATAAACCCTGTGCAT and
ATGCACAGGGTTTATCTAGATTTGCGCTGAT, and mutants were screened for the
introduction of a new SnaBI site.
Cell culture and transfections
RAW 264.7 cells were obtained from the American Type Culture
Collection (Manassas, VA). The COS-2A stable cell line, a COS-1 cell
line expressing Fc
RIIA, was described previously (4).
Cells were selected in 1 µg/ml G418. For assays, RAW or COS-2A cells
were grown to 50% confluence on 25-mm glass coverslips in -MEM
medium supplemented with 10% FCS, at 37°C in 5%
CO2. Transfection of cells with FuGene-6 was
according to manufacturer’s instructions. For immunofluorescence
studies and phagocytosis assays, 1 µg DNA and 3 µl FuGene-6 were
used per coverslip, 24 h before analysis. For dominant-negative
studies using cytosolic syntaxin 7 or 13, cells were transfected with 2
µg DNA for 48 h, before assaying. Some transfections were also
performed using the reagent PEI25K, as previously described
(15), using 1 µg DNA per coverslip, with similar
results.
Indirect immunofluorescence and confocal microscopy
RAW cells were transfected with 7 MYC or 13GFP DNA and after 24 h fixed in 4% paraformaldehyde/PBS at room temperature for 1 h, or overnight at 4°C. Cells were permeabilized with 0.1% Triton X-100 in PBS containing 100 mM glycine and blocked in 5% serum/PBS for 1 h. Primary Abs were added at room temperature for 1 h in 1% serum at the following dilutions: mouse anti-human transferrin receptor (1:100), rabbit antimannosidase II (1:1000), monoclonal to Golgi matrix marker GM130 (1:500), rabbit antimannose 6-phosphate receptor (1:800), rat anti-LAMP-1 (1:4), mouse anti-MYC (1:200), and rabbit anti-MYC (1:100). After incubation with primary Abs, coverslips were washed in PBS and incubated with secondary Abs in 1% serum for 30–60 min, as follows: donkey anti-rat Cy3; anti-mouse Cy3 or anti-rabbit Cy3 (1:1000); goat anti-mouse Alexa 488 or anti-rabbit Alexa 488 (1:2000). Coverslips were washed in PBS, and mounted using DAKO mounting medium. Imaging was performed on an LSM510 Zeiss (Oberkochen, Germany) confocal microscope.
Phagocytosis of SRBC
SRBCs were opsonized with rabbit anti-SRBC IgG, at 37°C
for 1 h, followed by washing in PBS. Transfected cells on
coverslips were cooled to 4°C in H-RPMI and allowed to bind opsonized
RBCs for 10 min, followed by a PBS wash to remove unbound RBCs, then
transferred to -MEM medium supplemented with 10% FCS and prewarmed
to 37°C. Phagocytosis was allowed to occur for various periods, as
indicated. Phagocytosis was stopped by transferring coverslips to
H-RPMI precooled to 4°C, for 10 min. Coverslips were transferred to
H-RPMI precooled to 4°C and containing 1:1000 donkey anti-rabbit
Cy5, to stain external RBCs, and allowed to incubate for 15 min at
4°C. Coverslips were washed in ice-cold PBS and fixed in 4%
paraformaldehyde overnight. For cells transfected with 7 MYC,
immunofluorescence was performed as discussed above, using mouse
anti-MYC (1:100), followed by goat anti-mouse Alexa 488
(1:2000). For cells transfected with 13GFP, coverslips were washed in
PBS and mounted on slides.
Cytosolic syntaxin 7 or 13 expression
Cos2A cells were plated to 50% confluence in -MEM with 10%
FCS on glass coverslips. Cells were cotransfected with 0.1 µg EGFP
mixed with one of the following: 2 µg syntaxin 7 DNA (7 TM); 2
µg syntaxin 13 DNA (13 TM); or 2 µg control DNA (pCDNA3.1).
Cells were subsequently used after 48 h, as follows: for the
transferrin endocytosis assay, cells were serum starved in -MEM
without FBS for 1 h, washed in PBS, and then incubated in 50
µg/ml rhodamine-transferrin for 30 min at 37°C, followed by a chase
of -MEM containing 10% FBS for 10 min at 37°C. Cells were then
fixed and mounted. For the LAMP-1 detection assay, cells were fixed and
permeabilized. Coverslips were incubated for 1 h at room
temperature in mouse anti-human LAMP-1 in 1% serum (1:4).
Coverslips were then washed in PBS and incubated for 30–60 min in
secondary Ab in 1% serum (donkey anti-mouse Cy3) (1:1000), washed
in PBS, and mounted on slides.
For the phagocytosis assay, polystyrene beads were opsonized with human
IgG at 37°C for 1 h, washed in PBS, and resuspended in H-RPMI to
the original concentration. After transfection, cells were precooled in
ice-cold H-RPMI and allowed to bind opsonized latex beads in H-RPMI at
4°C, followed by a PBS wash to remove unbound beads. Phagocytosis of
the beads was allowed to proceed in -MEM supplemented with 10% FCS
at 37°C in 5% CO2 for 60 min, before being
stopped by placing coverslips in H-RPMI at 4°C for 10 min. External
beads were stained with donkey anti-human Cy5 IgG (1:1000) in
H-RPMI at 4°C, 30 min. Cells were then washed in ice-cold PBS, fixed,
permeabilized, and stained for LAMP-1.
Quantitative image analysis
After confocal microscopy images were obtained, densitometric measurements of LAMP-1 around the phagosome were made and the data were analyzed using Microcal Origin 6.0.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Syntaxin 13 has been localized to tubular early and recycling
endosomes in fibroblasts (16). To determine the location
of syntaxin 13 in professional phagocytic cells, we set out to examine
RAW cells. However, commercially available Abs to syntaxin 13 failed to
detect the protein in these cells (data not shown). Therefore, we
created an in-frame fusion between syntaxin 13 and EGFP in a mammalian
expression vector in which the green fluorescent protein (GFP) was
attached to the carboxyl terminus of syntaxin 13 (called 13GFP
hereafter). This would locate EGFP in the luminal side of the endocytic
membranes. To define the subcellular localization of syntaxin 13, RAW
cells transfected with 13GFP were fixed after 24 h and then
stained with Abs to markers of defined subcellular compartments. As
shown in Fig. 1
, there was significant
overlap between the pattern of transferrin receptors (Fig. 1A) and that of 13GFP (Fig. 1B). In contrast,
there was little, if any, overlap between 13GFP and the Golgi marker
GM130 (Fig. 1, cf C and D), the mannose
6-phosphate receptor (Fig. 1, cf E and F), or
LAMP-1 (Fig. 1, cf G and H). Thus, as in
fibroblasts, syntaxin 13 in phagocytic cells localizes with transferrin
receptor-positive endosomes.
|
In a parallel set of experiments, we examined the localization of syntaxin 7 in RAW cells. Again, due to the lack of suitable Abs, it was necessary to tag the syntaxin 7. Preliminary experiments with a GFP tag similar to that used for syntaxin 13 failed, as a large percentage of the protein appeared to lack the GFP tag (not shown). Given the reported location of syntaxin 7 in the lysosome, we inferred that proteolysis of the luminal GFP may have occurred in this compartment. We therefore created a syntaxin 7 protein with an amino-terminal myc tag (called 7 MYC hereafter) that would be localized to the cytoplasm. This approach had previously been used successfully to localize syntaxin 7 in Madin-Darby canine kidney cells (17).
Transfected RAW cells were dual stained with Abs specific to the
myc epitope and to specific cellular organelles. As shown in
Fig. 2, 7 MYC differed from syntaxin 13
in that its distribution was distinct from that of the transferrin
receptor (Fig. 2, A and B). Instead, 7 MYC
overlapped significantly with both the mannose 6-phosphate receptor
(Fig. 2, cf E and F) and LAMP-1 (Fig. 2, cf
G and H). There was little, if any, overlap with
the Golgi marker mannosidase II (Fig. 2, C and
D). Hence, consistent with its localization in other cell
types (18), syntaxin 7 appears to localize with the late
endosome and lysosome compartments.
|
To determine whether syntaxins 13 and 7 participate in phagosome
formation or maturation, we next examined their location
during the ingestion of opsonized particles. RAW cells were transfected
with 13GFP or 7 MYC for 24 h, then exposed to SRBC that had been
coated with rabbit anti-SRBC Abs. As can be seen in Fig. 3A, 13GFP is rapidly recruited
to the nascent phagosomes within 2.5 min (arrows). In some cases, the
accumulation of 13GFP appears to occur before the closure of the
phagocytic cup. The presence of 13GFP begins to decline by 5 min (Fig. 3, B and F), and it is no longer seen around
phagosomes after 10 min (Fig. 3, C and F),
indicating that syntaxin 13 is only transiently associated with the
phagosome.
|
, D and
F), but distinct recruitment was noticeable after 20–30 min
(not shown). A pronounced accumulation of 7 MYC in phagosomes was
evident at 60 min (Fig. 3, E and F). Thus, unlike
13GFP that associated only transiently with phagosomes, 7 MYC
accumulated monotonically throughout the period studied, and no
evidence for cycling off the phagosome was observed. We also monitored
the accumulation of LAMP-1 as a marker of phagosome maturation and, as
seen in Fig. 3F, LAMP-1 accumulated with the same time
course as 7 MYC. Effect of truncated (cytosolic) syntaxin 13 on phagosome formation and maturation
To determine whether the accumulation of syntaxins 13 and 7 at the phagosome had functional significance to phagosomal maturation, we set out to inhibit their function by using a dominant-negative approach. Earlier studies showed that the introduction into cells of the cytoplasmic portions of SNAREs can exert an inhibitory effect on the function of the endogenous, full-length proteins (19, 20, 21). It is thought that these soluble fragments are inhibitory because they can form stable complexes with endogenous cognate SNARE proteins, not having to overcome the energy barrier caused by the repulsion of the two lipid bilayers. Such fragments cannot trigger fusion because they lack the required membrane anchor and therefore negatively compete with the endogenous SNAREs.
Effective dominant-negative action of the cytosolic fragments requires
high levels of ectopic expression. RAW 264.7 cells were cotransfected
with the cytoplasmic portion of syntaxin 13 (13 TM) and with EGFP
(10:1 ratio of the CNDs). The fluorescence of the latter was used to
identify the transiently transfected cells. To confirm that 13 TM
was active in inhibiting syntaxin 13 function, we examined the ability
of transfected COS-2A to internalize fluorescently labeled transferrin,
because syntaxin 13 is implicated in endosome-endosome fusion events
(16). Unfortunately, the moderate expression levels
achieved following transfection of RAW 264.7 cells did not lead to
dominant-negative effects. High expression levels can be best achieved
by transfecting plasmids with the SV40 origin of replication in cells
expressing the large T Ag, such as the monkey COS cells. However, COS
cells are not normally phagocytic, because they lack opsonin receptors.
To circumvent this problem, we used COS-2A cells, which are a stable
line of COS-1 cells that express the FcRIIA. These cells have been
fully characterized for their ability to support phagocytosis in a
manner that closely resembles the behavior of professional phagocytes
(4, 22, 23). Expression of 13 TM in COS-2A cells
resulted in a decrease in the uptake of transferrin (Fig. 4A). Furthermore, the
transferrin that was internalized by the transfected cells did not show
the perinuclear concentration typical of transferrin labeling in normal
cells, which can be readily seen in the adjacent nontransfected cell
(Fig. 4A).
|
TM had any effect on phagocytosis,
transfected cells were incubated in the presence of latex beads
opsonized with human IgG. The location of beads could be observed by
differential interference contrast microscopy, and the beads that were
not internalized could be identified by staining nonpermeabilized cells
with Abs specific for human IgG (Fig. 4B, left
panels). By counting the number of internalized beads in the
transfected cells compared with cells transfected with EGFP alone, we
found that 13 TM had no effect on particle internalization (Fig. 4C, left histogram). To determine whether 13
TM affected phagosome maturation, cells that had undergone phagocytosis
for 60 min were fixed, permeabilized, and stained with Ab to LAMP-1.
Phagosomes were then scored for the presence (Fig. 4B,
arrows) or absence (Fig. 4B, arrowheads) of LAMP-1 to
determine the number of phagosomes positive for this lysosomal protein.
As can be seen in Fig. 4C (right histogram),
13 TM significantly reduced the number of LAMP-1-positive phagosomes
to 
70% of normal. Effect of truncated (cytosolic) syntaxin 7 on phagosome formation and maturation
Similar experiments were then performed to analyze the role of
syntaxin 7 by overexpression of the cytosolic portion of this protein
(called 7 TM). Overexpression of 7 TM altered the distribution of
cellular LAMP-1 (Fig. 5A).
This is most likely due to the inhibitory effect of 7 TM on the
function of endogenous syntaxin 7 in the traffic of vesicles from the
late endosome to the lysosome (18, 24, 25, 26). Phagocytosis
assays were performed as above, and both phagocytosis and LAMP-1
accumulation were assayed (Fig. 5B). As was the case with
13 TM, overexpression of 7 TM had no effect on the efficiency of
phagocytosis (Fig. 5C, left histogram).
Importantly, the dominant-negative 7 TM profoundly inhibited LAMP-1
accumulation (Fig. 5C, right histogram). The
LAMP-1 index declined to 45% of the control value. Simultaneous
overexpression of both 13 TM and 7 TM in separate experiments
decreased the LAMP-1 index from a control value of 372 ± 62 to
141 ± 31, a reduction to 38% of the control value (not shown).
This inhibition is similar in scale to that seen with 7 TM alone,
indicating that the inhibitory effects were not additive.
|
TM and 7 MYC, and the accumulation of LAMP-1 and 7 MYC was
compared. As seen in Fig. 5D, under these conditions 13
TM had little effect on LAMP-1 accumulation (right
histograms), while the appearance of 7 MYC at the phagosome was
reduced to 20% of the control level. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The accumulation of both syntaxins 13 and 7 on the phagosomes during their maturation suggests that both proteins may play roles in the formation of the phagolysosome. Indeed, inhibition of both proteins blocked maturation by preventing the accumulation of LAMP-1. However, their appearance at the phagosome is vastly different. Syntaxin 13 accumulated very early, within 2.5 min of the start of phagocytosis, and rapidly disappeared from the phagosome following particle internalization. In contrast, syntaxin 7 did not begin to appear until after 10 min and continued to accumulate during the course of maturation. A similar time course was seen for LAMP-1 accumulation.
The time course of syntaxin 13 accumulation is consistent with that
previously observed for VAMP-3 (7), and nascent phagosomes
were often found to be positive for 13GFP before the apparent closure
of the phagocytic cup (not shown). However, inhibition of VAMP-3 by
tetanus toxin impaired phagocytosis by limiting the extension of
pseudopods. In contrast, inhibition of syntaxin 13 function appeared to
have no detectable effect on phagocytosis per se, but interfered with
the subsequent steps required for maturation of the phagosome.
Interestingly, coexpression of 13 TM along with 7 MYC led to a
significant block of 7 MYC accumulation at the phagosome, while the
maturation of the phagosome as measured by LAMP-1 accumulation was not
affected. The relative resistance of LAMP-1 accumulation to inhibition
by 13 TM compared with 7 MYC could indicate that LAMP-1 accumulation
occurs by a 7 MYC-independent pathway. However, coexpression of 7 MYC
with 13 TM led to a rescue of the inhibitory effect of 13 TM on
LAMP-1 accumulation (Fig. 4, cf C and D). This
may mean that only residual levels of 13 TM are required to allow
full LAMP-1 accumulation and that under conditions in which 7 MYC is
not overrexpressed (Fig. 4C), a more complete blockade of
syntaxin 7 occurs, limiting LAMP-1 arrival. Future studies will be
aimed at addressing these two possibilities.
Based on the SNARE model, it is possible to predict that VAMP-3 functions as the vesicular SNARE required for the fusion of vesicles from the recycling endosome with the target membrane. In this case, the target membrane is the region of the plasma membrane defined by the activation of the FcR engaged by the opsonized particle. Previous studies had shown that phagosomes also contained syntaxins 2, 3, and 4 (30), and these are plasma membrane-localized forms of syntaxin that are thought to be cognate partners for VAMP-2 and VAMP-3 (31). It is likely, therefore, that VAMP-3 functions in conjunction with plasma membrane resident syntaxin isoforms to provide the fusion events needed to form the nascent phagosome. Although syntaxin 13 delivery to the phagosome is not required for phagosome formation, it may serve to change the membrane milieu by making the nascent phagosome competent for fusion with endosomes at the early stages of phagosome maturation. Each step in the endocytic pathway most likely requires distinct sets of syntaxin proteins to receive the appropriate transport vesicles. For phagosome maturation to mimic the stepwise progression through the endocytic pathway would therefore require the removal of the existing syntaxins with replacement by the syntaxin responsible for the next step. Based on our observations, we would hypothesize that syntaxin 13 serves to facilitate early endosome fusion events, while syntaxin 7 would be required to permit the fusion of vesicles from the late endosome/lysosome compartments. This would be consistent with in vitro studies showing that young phagosomes fuse efficiently with endosomes, while old phagosomes can fuse best with lysosomes.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. William S. Trimble, Program in Cell Biology, The Hospital for Sick Children, 555 University Avenue, Toronto, Ontario, Canada M5G 1X8. E-mail address: wtrimble{at}sickkids.on.ca
3 Abbreviations used in this paper: VAMP, vescicle-associated membrane protein; GFP, green fluorescent protein; EGFP, enhanced GFP; LAMP, lysosome-associated membrane protein; SNARE, soluble N-ethylmaleimide-sensitive factor attachment protein receptor; TM, transmembrane domain.
Received for publication January 25, 2002. Accepted for publication July 10, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
receptor mediated phagocytosis. Blood 86:4389.This article has been cited by other articles:
|
|
 |
|
  I. Jutras, M. Houde, N. Currier, J. Boulais, S. Duclos, S. LaBoissiere, E. Bonneil, P. Kearney, P. Thibault, E. Paramithiotis, et al. Modulation of the Phagosome Proteome by Interferon-{gamma} Mol. Cell. Proteomics, April 1, 2008; 7(4): 697 - 715. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. H. S. Ho, D. T. Cai, C.-C. Wang, D. Huang, and S. H. Wong Vesicle-Associated Membrane Protein-8/Endobrevin Negatively Regulates Phagocytosis of Bacteria in Dendritic Cells J. Immunol., March 1, 2008; 180(5): 3148 - 3157. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. B. Dacks, P. P. Poon, and M. C. Field Phylogeny of endocytic components yields insight into the process of nonendosymbiotic organelle evolution PNAS, January 15, 2008; 105(2): 588 - 593. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Brumell and M. A. Scidmore Manipulation of Rab GTPase Function by Intracellular Bacterial Pathogens Microbiol. Mol. Biol. Rev., December 1, 2007; 71(4): 636 - 652. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. P. Manderson, J. G. Kay, L. A. Hammond, D. L. Brown, and J. L. Stow Subcompartments of the macrophage recycling endosome direct the differential secretion of IL-6 and TNF{alpha} J. Cell Biol., October 3, 2007; 178(1): 57 - 69. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. A. Lapierre, K. M. Avant, C. M. Caldwell, A.-J. L. Ham, S. Hill, J. A. Williams, A. J. Smolka, and J. R. Goldenring Characterization of immunoisolated human gastric parietal cells tubulovesicles: identification of regulators of apical recycling Am J Physiol Gastrointest Liver Physiol, May 1, 2007; 292(5): G1249 - G1262. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. E. Jacobs, L. V. DeSouza, H. Samaranayake, R. E. Pearlman, K. W. M. Siu, and L. A. Klobutcher The Tetrahymena thermophila Phagosome Proteome Eukaryot. Cell, December 1, 2006; 5(12): 1990 - 2000. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Hatsuzawa, T. Tamura, H. Hashimoto, H. Hashimoto, S. Yokoya, M. Miura, H. Nagaya, and I. Wada Involvement of Syntaxin 18, an Endoplasmic Reticulum (ER)-localized SNARE Protein, in ER-mediated Phagocytosis Mol. Biol. Cell, September 1, 2006; 17(9): 3964 - 3977. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. C. Smith, J. T. Cirulis, J. E. Casanova, M. A. Scidmore, and J. H. Brumell Interaction of the Salmonella-containing Vacuole with the Endocytic Recycling System J. Biol. Chem., July 1, 2005; 280(26): 24634 - 24641. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G.-Y. Liu, V. Kulasingam, R. T. Alexander, N. Touret, A. M. Fong, D. D. Patel, and L. A. Robinson Recycling of the Membrane-anchored Chemokine, CX3CL1 J. Biol. Chem., May 20, 2005; 280(20): 19858 - 19866. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Bared, C. Buechler, A. Boettcher, R. Dayoub, A. Sigruener, M. Grandl, C. Rudolph, A. Dada, and G. Schmitz Association of ABCA1 with Syntaxin 13 and Flotillin-1 and Enhanced Phagocytosis in Tangier Cells Mol. Biol. Cell, December 1, 2004; 15(12): 5399 - 5407. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Kuliawat, E. Kalinina, J. Bock, L. Fricker, T. E. McGraw, S. R. Kim, J. Zhong, R. Scheller, and P. Arvan Syntaxin-6 SNARE Involvement in Secretory and Endocytic Pathways of Cultured Pancreatic {beta}-Cells Mol. Biol. Cell, April 1, 2004; 15(4): 1690 - 1701. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Nagai, T. Meerloo, T. Takeda, and M. G. Farquhar The Adaptor Protein ARH Escorts Megalin to and through Endosomes Mol. Biol. Cell, December 1, 2003; 14(12): 4984 - 4996. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Touret, W. Furuya, J. Forbes, P. Gros, and S. Grinstein Dynamic Traffic through the Recycling Compartment Couples the Metal Transporter Nramp2 (DMT1) with the Transferrin Receptor J. Biol. Chem., July 3, 2003; 278(28): 25548 - 25557. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. V. Vieira, C. Bucci, R. E. Harrison, W. S. Trimble, L. Lanzetti, J. Gruenberg, A. D. Schreiber, P. D. Stahl, and S. Grinstein Modulation of Rab5 and Rab7 Recruitment to Phagosomes by Phosphatidylinositol 3-Kinase Mol. Cell. Biol., April 1, 2003; 23(7): 2501 - 2514. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||
