The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dorado, B.
Right arrow Articles by Ballester, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dorado, B.
Right arrow Articles by Ballester, S.
The Journal of Immunology, 2002, 169: 3030-3037.
Copyright © 2002 by The American Association of Immunologists

Autocrine IL-4 Gene Regulation at Late Phases of TCR Activation in Differentiated Th2 Cells1

Beatriz Dorado, María J. Jerez, Natalia Flores, Francisco M. Martín-Saavedra, Cristina Durán2 and Sara Ballester3

Centro Nacional de Biología Fundamental, Instituto de Salud Carlos III, Madrid, Spain


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-4 is a multifunctional cytokine whose secretion displays important immunomodulatory functions. Its expression is regulated at the level of transcription, and one of the main factors involved is NFAT. The IL-4-induced transcription factor Stat6 is required for the development of naive T cells into Th2 phenotype, capable of secreting IL-4. However, IL-4 production by differentiated Th2 cells is IL-4 independent; thus, it remains unclear whether Stat6 plays any role in the IL-4 expression by mature Th2 cells. We have analyzed in the Th2 clone D10.G4.1 the nuclear proteins able to bind the regulatory element P1 of the IL-4 promoter. Gel-shift assays show NFAT1 as the most abundant nuclear protein that binds to P1 after ionomycin plus PMA activation, whereas Stat6 accounts for the bulk of the P1 binding in the presence of exogenous IL-4. Reporter experiments agree with an inhibitory effect of Stat6 on the NFAT1-induced transcriptional activity directed by the P1 element. CD3 signaling leads to an early induction of NFAT1-P1 complexes correlating with a strong induction of the IL-4 gene. In later phases of CD3 activation, P1 is also bound by Stat6 and a fall in the IL-4 mRNA levels takes place. These two late events during CD3 activation were found to be sensible in experiments conducted with an anti-IL-4 Ab. These results suggest that IL-4 endogenously produced by Th2 cells under TCR triggering modulates its own expression through Stat6.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-4 can be secreted by several cell types, such as basophils or mast cells, but the most important source of IL-4 is CD4+ Th2 cells activated by Ag recognition through TCR. Among the effector functions of IL-4 are induction of IgE production by B cells (1), direct differentiation of antigenically activated naive CD4 T cells into Th2 population (2), inhibition of TNF-{alpha} and IL-1 production by activated monocytes (3), and acting as a growth factor for both B and Th2 cells (4, 5).

Therefore, regulation of IL-4 expression is critical to determine the overall character of immune responses. Many studies have focused on the mechanisms governing IL-4 gene expression and it is clear that NFAT plays a central role in it (6, 7, 8, 9). Five proteins have been reported as components of the NFAT family, named NFAT1 through NFAT5. NFAT5, described most recently, differs strikingly from the other members in the subcellular location and the activity regulation (10). The other NFAT family members are constitutively present in the cytoplasm in an inactive phosphorylated form. Stimuli able to promote calcium mobilization, such as TCR signaling or ionomycin, lead to activation of NFAT proteins by dephosphorylation mediated by the calcium/calmodulin-dependent phosphatase calcineurin (11). Once dephosphorylation has taken place, conformational changes occur, resulting in the exposure of the nuclear location signal and the promotion of transcriptional activity (12). This activating mechanism can be blocked by the immunosuppressive drugs FK506 and cyclosporin A (CsA)4 by inhibition of calcineurin (13). Recently it has been demonstrated that, for its complete transcriptional activity, NFAT1 requires a combined input from calcium mobilization and a second signal mediated by phorbol ester (14).

Both murine and human IL-4 promoters present five well-characterized NFAT sites (P0 through P4) (7, 15, 16). A new NFAT site named P5 has been recently described on the human promoter of IL-4 (17). P1 and P0 sites have been shown to be critical for optimal promoter activity in T cells (8). Coordinate action of NFAT with other transcription factors has been reported to modulate the gene activity of IL-4 through P0 and P1 murine sites, such as the well-established cooperation between NFAT and c-maf on P0-mare (18, 19) or NFAT and AP-1 on P1 element (6, 9, 20). In addition, a group of proteins unrelated to the NFAT family has been reported to interact with P1 site. They are Oct (21), HMG I(Y) (22), NF-{kappa}B (23, 24), and Stat6 (16). The involvement of Stat6 in the IL-4 gene regulation is particularly interesting. Stat6 seems to be essential in the initial IL-4 production during Th development (25, 26, 27), but it is not required for IL-4 expression in differentiated Th2 cells (28). Both human (29) and murine (30) IL-4 promoters have Stat6 binding elements that overlap the corresponding P2 NFAT sites. Georas et al. (16) described two more Stat6 sites overlapping the P1 and P4 NFAT sites in the human IL-4 promoter and reported in vitro experiments in which purified Stat6 was able to compete NFAT binding to P4, P2, and P1 sites.

The present work analyzes in murine Th2 cells the nuclear induction of proteins capable of binding to the P1 element of the murine IL-4 promoter along cell activation by CD3 engagement, exogenous IL-4, or a combination of ionomycin and the phorbol ester PMA (I+P). Among the transcription factors previously reported to bind P1, we found that only NFAT1 and Stat6 interact with P1 element in stimulated Th2 cells. Early phases of activation through TCR showed the induction of NFAT-P1 complexes, while in later phases Stat6 also interacted with the P1 site. A decrease in the levels of IL-4 mRNA during TCR activation correlated with the presence of the Stat6-P1 complex. Both late events were sensible to an anti-IL-4 Ab, indicating the involvement of the IL-4 endogenously produced by D10.G4.1 cells. In addition, the NFAT1-dependent luciferase activity driven by the P1 element was inhibited by IL-4 or Stat6 cDNA cotransfection. Elimination of the Stat6 site in the P1 element strongly increased the response to NFAT1. These data together indicate a possible mechanism involving Stat6 for the autoregulation of IL-4 gene expression in TCR-activated Th2 cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells and stimulation conditions

The murine Th2 clone D10.G4.1 is a cell line specific for conalbumin in the I-Ak class II MHC context (31). Cells were maintained in Click’s medium supplemented with 10% heat-inactivated FCS and stimulated every 2 wk at 105 cells/ml with mitomycin C-treated spleen cells from C3H mice (5 x 105 cells/ml). Ag (conalbumin) was added at 100 µg/ml.

Before extraction of proteins or RNA, resting cells (10–15 days after activation as above) were incubated with 100 U/ml mouse IL-4, plate-bound anti-CD3 (YCD3-1) (32), or a mixture of 1 µM ionomycin (Calbiochem, La Jolla, CA) and 10 ng/ml PMA (Sigma-Aldrich, St. Louis, MO) (I+P). All the results obtained with YCD3-1 were corroborated with the anti-TCR Ab 3D3 (31). Mouse IL-4 was obtained from culture supernatants of the murine IL-4 cDNA transfected X63Ag8–653, which was kindly provided by Dr. F. Melchers (Basel Institute for Immunology, Basel, Switzerland) (33). The kinetics of P1 binding proteins induction was identical using culture supernatants of X63Ag8–653 cells or purified IL-4 (Immunokontac, Oxon, U.K.). YCD3-1, 3D3, and 11B11 (anti-murine IL-4) (34) mAbs were used as a protein A affinity-purified preparation from ammonium sulfate-precipitated culture supernatants. For assays of protein synthesis or calcineurin dependence, 10 µg/ml cycloheximide (Chx; Sigma-Aldrich) or 2 µM CsA (Sigma-Aldrich) to the cultures 30 min before the stimuli were added.

Proliferation assays

Proliferation of cells was measured in 96-well plates by incubating 104 cells with the stimuli indicated at 37°C and 5% CO2 for 72 h. Cell growth was measured by colorimetric assay as described (35).

EMSA

Nuclear proteins extraction and generation of 32P-end-labeled probe were performed as in Ref. 36 . Nuclear proteins (2 µg) were incubated for 10 min in a final volume of 10 µl in the presence of 20 mM KCl, 4% Ficoll, and 200 ng poly(dIdC) (Amersham Pharmacia Biotech, Piscataway, NJ) before addition of 0.3 ng of 5' end-labeled double stranded-oligonucleotide P1, which contains the sequence from -87 to -61 of the murine IL-4 promoter (TGGTGTAATAAAATTTTCCAATGTAAA) (6). Binding reactions were allowed for 40 min at room temperature and subjected to 5% PAGE in TBE (0.5x). DNA-protein complexes were detected by x-ray film exposure. For supershift assays, the binding mixtures were preincubated for 20 min with anti-NFAT1 (06-348; Upstate Biotechnology, Lake Placid, NY) or anti-Stat6 (sc-621x; Santa Cruz Biotechnology, Santa Cruz, CA) before adding the end-labeled probe. Competition was conducted in the presence of a 50-fold molar excess of cold oligonucleotide 10 min before the addition of the probe. The oligonucleotides used as competitor contained the following sequences: AP-1, GAGCCGCAAGTGACTCAGCGCGGGGCG (21); HMG I(Y), CACTTTGTAGATTT(A)10(G)9AGGGGTGTTTC (22); Oct-1, CTAGAGCAGAAATGCAAATTATACCC (21); Stat6, CAAGACCTTTCCCAAGAAATCTATC (37); NF-{kappa}B, CAAGGAAAAGGGGGATTCCTGCCGCGC (36); unrelated sequence, TACACAACATTGTGTGACGTTGTGGTC.

Transfection and luciferase assays

Cells (107) were electroporated at 270 V and 960 µF in 0.4-cm cuvettes using a Bio-Rad Gene Pulser with 5 µg of luciferase reporter plasmid. 2xP1-Luc construct contains a dimer of the sequence from -76 to -61 of the murine IL-4 promoter at the XhoI site of the pGL3-promoter vector (Promega, Madison, WI). mut-NFAT and mut-Stat6 are derivatives of 2xP1-Luc in which NFAT or Stat6 recognition sites have been eliminated, as is shown in the corresponding figure. Where indicated, 25 µg of full-length NFAT1 (38) or Stat6 (37) expression vectors were added. Plasmids codifying murine NFAT1 and Stat6 were provided by Dr. A. Rao (Center for Blood Research, Boston, MA) and Dr. J. N. Ihle (St. Jude Children’s Research Hospital, Memphis, TN), respectively. DNA of pBluescript (Stratagene, La Jolla, CA) was used to keep constant the total DNA amount in all the transfections. Each sample was transfected with 4 µg of pRL-TK plasmid, which contains the cDNA encoding Renilla luciferase (Promega). Transfections were divided for the different culture conditions indicated. After 18 h, protein extraction and luciferase determinations were conducted by the dual-luciferase assay system of Promega. Each value of the firefly luciferase activity codified by pGL3 promoter or 2xP1-Luc plasmids was normalized to the Renilla luciferase activity.

Northern blot analysis

Total RNA was obtained by the phenol extraction at acid pH method (39). Samples of RNA (5 µg) were fractionated in agarose-formaldehyde gels and transferred to nylon membranes to be hybridized with 32P-labeled probes. The IL-4 probe was a DNA fragment containing 150 nt of the cDNA of murine IL-4. A specific DNA probe for the murine 7s rRNA (40) was used as a control of load, kindly provided by Dr. F. Varas (Centro de Investigaciones Energéticas, Medioambientales y Tecnológicas, Madrid, Spain).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Different cell stimuli induce different patterns of P1-protein complexes in Th2 cells

To establish whether in Th2 cells different cell stimuli could induce different proteins able to bind the P1 NFAT site of the IL-4 promoter, we used the murine clone D10.G4.1. Fig. 1GoA shows a mobility shift assay performed with nuclear proteins obtained after different periods of cell culture in the presence of activating stimuli. Taking into account the mobility and the relative intensity of the DNA-protein complexes detected, different patterns of P1 complexes can be observed after different stimulations. The complexes detected were named I and II. The combination of I+P, used as a control of NFAT induction, strongly induced complex II, although in few assays a slight complex I was observed (data not shown). Cells treated with IL-4 or anti-CD3 Ab showed complexes I and II. However, complex I was detected in cell samples treated with IL-4 during 1 h, while in the presence of anti-CD3 it was undetectable until after 4 h of treatment. To determine whether there were earlier differences for the presence of P1 complexes among the different stimulations, we conducted kinetics experiments at shorter times of cell activation. As shown in Fig. 1GoB, complex I was already present at a time as short as 10 min of IL-4 stimulation. From this time on, a slight band corresponding to complex II was also detected. Short stimulation periods with anti-CD3 revealed that complex II was present in the nucleus after 20 min of activation, while complex I could not be detected at any time <4 h. The strongest and earliest induction of complex II was obtained by activation with I+P. All the experiments performed with the anti-CD3 Ab (YCD3-1) were also conducted by stimulation with an anti-TCR Ab (3D3) (31), leading to identical results (data not shown).



View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 1. Different cell stimuli in D10.G4.1 cells leads to distinct kinetics of induction of P1 binding proteins. Cultures were stimulated by I+P, IL-4, or anti-CD3 Ab (YCD3-1). Samples were taken out at long (A) or short (B) time intervals of stimulation and subjected to nuclear protein extraction. EMSA were conducted using 5'-labeled P1 double stranded-oligonucleotide as indicated in Materials and Methods. I and II indicate the position of the complexes detected. Exposure times of x-ray film were 2 h for I+P stimulation and 24 h for anti-CD3 or IL-4 stimulations.

 
Analysis of the P1 complex composition

The recognition specificity of the P1 sequence by the nuclear proteins contained in complexes I and II was demonstrated by competition assays. Each of these complexes was efficiently competed by an excess of cold P1 oligonucleotide but not by an unrelated DNA sequence (Fig. 2Go). In T lymphocytes, the most abundant NFAT proteins are NFAT1 and NFAT2 (41, 42). We performed supershift experiments to identify which of the P1 complexes detected in D10.G4.1 contained these NFAT transcription factors. The assays with two different anti-NFAT2 Abs (sc-1149 and 804-022-R100, supplied by Santa Cruz Biotechnology and Alexis, Nottingham, U.K., respectively) failed to reveal the presence of this protein in any of the P1 complexes (data not shown). However, anti-NFAT1 Ab affected complex II induced with every stimulation, indicating that NFAT1 is included in it (Fig. 2Go). Complex I was not affected by any anti-NFAT Ab assayed. To identify its composition, we conducted competition assays with oligonucleotides harboring the recognition sequence for proteins different from NFAT reported to bind the P1 sequence. Those were AP-1, HMG I(Y), Oct1, Stat6, and NF-{kappa}B. Only C{epsilon} oligonucleotide, which contains the Stat6 recognition sequence of the H chain {epsilon} Ig promoter, was able to compete complex I induced by IL-4 (Fig. 3GoA). This result was identical for complex I induced by anti-CD3 (data not shown). The presence of Stat6 in complex I was confirmed using an Ab recognizing Stat6 (Fig. 3GoB). The Stat6 binding to P1 site would be allowed by the existence of a noncanonical Stat6 recognition sequence overlapping the NFAT site in P1 element, as has been reported for the P1 site of the human IL-4 promoter (16). This sequence (TTCCAATGTA) differs only in one nucleotide from the consensus Stat6 recognition sequence (TTCN4GAA).



View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 2. Complex II contains NFAT1. Binding reactions were performed with the P1 probe and nuclear proteins from D10.G4.1 cells treated with the stimuli indicated. For competition assays 50-fold molar excess of cold P1 or nonrelated (nr) oligonucleotide was used. +, Samples in which anti-NFAT1 Ab was included; *, an unspecific band produced by the anti-NFAT1 assayed.

 


View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 3. Complex I contains Stat6. A, Competition assays to P1 probe by oligonucleotides containing the recognition sequences of the transcription factors indicated. Nuclear proteins of D10.G4.1 cells were obtained after 4 h of treatment with IL-4. Unlabeled cold competitors were used in 50-fold molar excess. B, Nuclear proteins of D10.G4.1 cultures were extracted after activation with the different stimuli indicated. Interactions with labeled P1 were assayed for competition with 50-fold molar excess of cold Stat6 oligonucleotide. +, Samples in which anti-Stat6 Ab was included.

 
Despite the absence of NFAT1 and NFAT2 in complex I suggested by the results of the supershift assays performed with Abs against these proteins, the interaction of Stat6 with NFAT1 or NFAT2 in complex I could not be excluded. This interaction might be masking the anti-NFAT Abs recognition site. Alternatively, Stat6 could be complexed with another member of the NFAT family. To investigate these possibilities we analyzed whether complex I induction shared two features of the induction of conventional NFAT proteins, which are CsA susceptibility and Chx resistance (13). Complex II induced by I+P behaved as expected for NFAT proteins (Fig. 4GoA), whereas complex I induced by IL-4 showed a clear resistance to CsA, suggesting the absence of NFAT proteins in this complex. However, complex I induced by anti-CD3 was inhibited by CsA, indicating a calcineurin dependence for its formation. Chx experiments showed that induction of complex I by TCR signaling (Fig. 4GoA) is also dependent on new synthesis of protein. These results can be easily explained by the fact that TCR triggering induces the production of IL-4 in Th2 cells, which is transcriptionally regulated by NFAT. Because one of the main effectors of IL-4 is the transcription factor Stat6 (25, 27, 43), the IL-4 newly synthesized after TCR stimulation could be, in an autocrine manner, the inductor of complex I containing Stat6. To confirm this possibility, we obtained nuclear extracts of D10.G4.1 activated by anti-CD3 in the presence of the anti-IL-4 Ab 11B11. The effectiveness of this Ab impairing the IL-4 signal was verified by the inhibition of D10.G4.1 proliferation induced by exogenous IL-4 (Fig. 4GoB). The results depicted in Fig. 4GoC showed that 11B11 Ab inhibited the induction of complex I under TCR activation, confirming that Stat6 induction during CD3 activation is dependent on endogenously produced IL-4.



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 4. Stat6 induction after CD3 ligation is sensible to Chx and CsA and is mediated by autocrine IL-4. A, D10.G4.1 cells were stimulated with I+P, IL-4, or anti-CD3. For treatments with CsA (2 µM) or Chx (10 µg/ml), the drugs were added 30 min before stimulation. After 4 h of stimulation, nuclear extracts were obtained and EMSA were performed with P1 probe. B, Duplicates samples of D10.G4.1 cells (104/well) were cultured in 96-well plates with or without IL-4 (100 U/ml). For 11B11 treatment, the Ab was added at 100 µg/ml 1 h before IL-4 stimulation. After 72 h of culture, proliferation was determined by colorimetric assay. C, Samples from the same resting cultures used in B were incubated or not with anti-CD3 in the absence of exogenous IL-4. 11B11 was used as in B. After 4 h of stimulation, cells were subjected to nuclear protein extraction and binding to P1 was assayed.

 
Correlation of P1-NFAT1 or P1-Stat6 complex induction with IL-4 gene expression

We next analyzed the consequences of Stat6 binding on the transcriptional activity directed by P1. To do that, we inserted two copies of P1 sequence (2xP1), including the recognition sites of NFAT, and Stat6, in the luciferase reporter plasmid pGL3prom. Experiments of transient transfection in D10.G4.1 cells showed that 2xP1 construct increases 13-fold transcriptional activity comparing to that conferred by the empty vector (Fig. 5GoA). Basal activity was not affected by IL-4, but it was induced 36-fold by I+P stimulation and up to 54-fold when NFAT1 was cotransfected, according to a positive transactivation of P1 by NFAT1. However, cotransfection of Stat6 lowered both the basal levels driven by P1 and those induced by I+P stimulation (Fig. 5GoB). In addition, IL-4 strengthened the inhibition produced by Stat6. To further address whether the effects observed with NFAT1 and Stat6 were exerted through their respective recognition sequences in the P1 element, derivatives of 2xP1 lacking NFAT or Stat6 sites were generated (mut-NFAT and mut-Stat6, respectively). The resulting sequence in each of these mutants is shown in Fig. 6GoA. EMSAs performed with oligonucleotides containing the same mutated sequences showed the abrogation of the formation of complex II in mut-NFAT and complex I in mut-Stat6. Fig. 6GoB depicts fold induction luciferase activity referred to the value obtained for each plasmid in basal conditions (one for each case). In contrast to results obtained for wild-type plasmid, transient transfections of its derivatives showed that basal luciferase activity conferred by the mutants was not significantly modified by Stat6 cDNA cotransfection. These findings were as expected, because mut-Stat6 lacks the Stat6 binding site and the basal activity conferred by mut-NFAT is near to the obtained with the empty vector. Fig. 6GoC shows that stimulation or NFAT1 cDNA cotransfection were not able to induce luciferase activity in mut-NFAT transfections. In contrast, mut-Stat6 strikingly showed a stronger response to NFAT1 than the wild-type plasmid. All these findings evidence a negative effect of the Stat6 site on the NFAT-dependent transcriptional activity directed by P1 and suggest the involvement of IL-4 in an autoregulatory mechanism to modulate its own expression in Th2 cells.



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 5. Transcriptional activity driven by the IL-4 promoter-isolated P1 element, containing NFAT and Stat6 sites, is enhanced by NFAT1 and inhibited by Stat6. Triplicate samples of 107 D10.G4.1 cells were electroporated with 5 µg of 2xP1-Luc at 270 V. For coexpression of NFAT1 (A) or Stat6 (B), 25 µg of plasmid containing the respective cDNA was used. Samples without cDNA were completed with 25 µg of carrier plasmid pBluescript. All the samples were cotransfected with pRL-TK plasmid codifying Renilla luciferase. Transfected cells were subjected to the culture conditions indicated. After 18 h firefly luciferase activity was determined and normalized to Renilla luciferase values. Results are indicated in fold activity relative to the values obtained by transfection with the pGL3prom empty vector.

 


View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 6. Elimination of Stat6 site in the P1 element abrogates inhibition mediated by Stat6 and increases transcriptional activity dependent on NFAT1. A, Abrogation of the formation of complex II and I with mut-NFAT and mut-Stat6 oligonucleotides, respectively. After 4 h of anti-CD3 stimulation, nuclear extracts were obtained and EMSA was performed with wild-type P1 (wt), mut-NFAT, and mut-Stat6 probes. The sequence of each element is shown at the top. The changed and deleted nucleotides are indicated in lower case letters and hyphens, respectively. B and C, Luciferase activity driven by wild-type (wt) P1, mut-NFAT, or mut-Stat6. Triplicate samples of 107 D10.G4.1 cells were electroporated with 5 µg of wild-type (wt), mut-NFAT, or mut-Stat6. For coexpression of Stat6 (B) or NFAT1 (C), 25 µg of plasmid containing the respective cDNA were used. Samples without cDNA were completed with 25 µg of carrier plasmid pBluescript. All the samples were cotransfected with the pRL-TK plasmid codifying Renilla luciferase. Transfected cells were subjected to the culture conditions indicated. After 18 h firefly luciferase activity was determined and normalized to Renilla luciferase values. Results for each construct are indicated in fold activity referred to the value obtained with each one in basal conditions.

 
According to this hypothesis, TCR activation was expected to produce an early induction of IL-4 gene transcription and a later negative control mediated by the IL-4-induced Stat6. To test this, determining the kinetics of the transcriptional activity directed by 2xP1 construct in CD3-stimulated cells was ruled out. Because luciferase codified by pGL3 plasmids has a long half-life, the presence of the protein initially produced could mask a later inhibition of transcriptional activity. Thus, to know whether the negative effect exerted by Stat6 through the P1 element correlated with a down-regulation of IL-4 expression, we directly analyzed the levels of IL-4 transcripts after stimulation with I+P, IL-4, or anti-CD3. Results depicted in Fig. 7Go show that I+P stimulation induced a strong increase in the mRNA levels, which was maintained for at least 24 h, while exogenous IL-4 did not stimulate the production of IL-4 transcripts. This supports the results of the luciferase experiments. Cells activated by CD3 ligation showed a transitory induction in the IL-4 mRNA levels (maximum, ~1.5 h) followed by a later decrease at times at which Stat6 binding to P1 is detected by mobility shift assay (Fig. 1Go). Thus, the presence of nuclear P1-NFAT1 complexes correlates with IL-4 gene induction, while the presence of P1-Stat6 complexes coincides with a down-regulation of this gene.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 7. IL-4 mRNA levels in D10.G4.1 cells are strongly induced by I+P, not affected by exogenous IL-4, and first increased and then decreased by anti-CD3 ligation. Total RNA (5 µg) from cells stimulated during the indicated times were subjected to Northern analysis by hybridization with a specific DNA probe for IL-4. Membranes were rehybridized with a DNA probe for 7s RNA as a control of load.

 
To know whether neutralizing the autocrinally produced IL-4 had any effect on the decrease of IL-4 mRNA at late phases of anti-CD3 stimulation, we analyzed the IL-4 mRNA levels produced in the presence of 11B11. Results depicted in Fig. 8Go showed that, although some reduction in the levels of transcripts is yet observed in the presence of anti-IL-4, the decrease in the steady-state levels of IL-4 message was significantly affected in these culture conditions, supporting the autoregulatory role of IL-4 on its own expression.



View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 8. Effect of neutralizing IL-4 Ab in the decrease of IL-4 mRNA at late phases of TCR activation. Total RNA (5 µg) from cells stimulated by anti-CD3 incubated or not with 11B11 was subjected to Northern analysis by hybridization with a specific DNA probe for IL-4. Membranes were rehybridized with a DNA probe for 7s RNA as a control of load.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Several reports conclude that NFAT1 and NFAT2 are responsible for the NFAT DNA binding activity in mature T lymphocytes (8, 11, 42, 44, 45). Although there are some discrepancies about the predominance of each one, they are probably due to the different stimulation conditions, activation status, or NFAT-regulated elements analyzed in each study. Our results show that the predominant NFAT protein bound to the P1 site in mature Th2 cells is NFAT1. The supershift assays of Fig. 2Go showed that nearly whole complex II is removed by an anti-NFAT1-specific Ab. Thus, the presence of NFAT2, if any, would be at trace levels. This result is according to the reported by Cron et al. (8) for primed T cells and by Adachi et al. (42), showing that NFAT1 becomes the dominant NFAT protein in mature activated CD4+ T cells. However, a study in the defined Th1 clone Ar-5 showed that, after CD3 engagement, both NFAT1 and NFAT2 bind to the distal NFAT site of the IL-2 promoter (11). This apparent discrepancy with our results is likely to have came not from the different Th phenotype but from the different NFAT sites analyzed in each study. The P1 site of the IL-4 promoter used here seems to be more selective in the NFAT proteins it binds than the distal NFAT site of the IL-2 promoter (46). In addition, IL-2 expression can be directed by other NFAT proteins in the absence of NFAT1, while IL-4 expression would be more sensitive to its absence (8).

It has been reported that P1 site is also recognized by AP-1 (6, 20), NF-{kappa}B (23, 24), Stat6 (16), Oct (21), and HMG I(Y) proteins (22). Among these proteins, only Stat6 was found to bind P1 in murine Th2 cells under the stimulations assayed in the present work. The absence of NF-{kappa}B proteins bound to PI was not surprising because it has been reported that the binding of this factor to the murine P1 sequence is weaker than the interaction with the human P1 counterpart (23). Furthermore, the strength of the P1-NF-{kappa}B interaction and the resulting activity seem to be dependent on determined cell stimulations (24). In addition, Oct and HMG I(Y) complexed with the P1 element are well established in some cell lines as Jurkat or EL4 (21, 22), but to our knowledge none of these interactions has been shown to be relevant for the expression of IL-4 in defined Th2 cells. The diversity of transcription factors recognizing the P1 element depending on the cell type, stimuli, or differentiation stage might constitute a strict IL-4 gene regulation to enable distinct responses to particular extracellular environments. Even more complexity could be added by the multiple cis-acting elements involved in the IL-4 expression, whose integrated action would be responsible for the definitive IL-4 gene activity, modulated for each specific situation.

The binding of AP-1 proteins to the P1 site of the IL-4 promoter was first reported by Rooney et al. (6). Moreover, Li et al. (9) found that JunB, a member of the AP-1 family, is involved in the regulation of IL-4 expression through the P1 site during Th cell differentiation. Nevertheless, Rincón and Flavell (45) reported other gel-shift assays in which they did not found AP-1 complexes with the P1 element, discussing the special experimental conditions required to detect them. This could also explain the absence of AP-1 complexes indicated by the inability of AP-1 oligonucleotides to compete the P1 complexes detected in our analysis, which was observed for oligonucleotides containing the AP-1 sequences of the metallothionein IIA promoter (Fig. 3GoA), the TRE IL-2 enhancer, or a perfect consensus for AP-1 recognition (Santa Cruz Biotechnology) (data not shown).

Purified recombinant Stat6 was previously reported to bind the P1 site of the human IL-4 promoter (16). In this work we show the first demonstration of endogenous Stat6 interacting with the murine P1 element in normal Th2 cells activated by anti-CD3 or IL-4 addition. The presence of Stat6 in complex I was evidenced by the results of competition and supershift assays depicted in Fig. 3Go. CsA resistance of complex I induction indicates that any conventional NFAT protein is included in it (Fig. 4Go); thus, Stat6 and NFAT do not complex together, but they independently interact with the P1 site. A number of facts points out the involvement of the endogenously produced IL-4 in the Stat6 induction after TCR Th2 cell activation. First, 4-h stimulation with anti-CD3 is necessary to detect nuclear Stat6 in D10.G4.1 cells (Fig. 1Go). Second, the induction of Stat6 by the TCR signal is dependent on protein synthesis (Fig. 4GoA). Third, blockage of the IL-4 signal abolished the anti-CD3-mediated Stat6 activation (Fig. 4GoC). All these results suggest that the lag period in the Stat6 induction after CD3 ligation corresponds to the time needed for the cells to produce IL-4, which would be directly responsible for the Stat6 activation after TCR stimulation.

Exogenous IL-4 did not increase the basal levels of P1-driven transcriptional activity (Fig. 5Go) or IL-4 mRNA (Fig. 7Go). This is according to previous reports showing that IL-4 production in differentiated Th2 cells is not IL-4 dependent (28). In contrast, the results from the transient transfections depicted in Fig. 5Go indicate that overexpression of Stat6 inhibits both basal and I+P-induced transcriptional activity of P1. Additionally, elimination of the Stat6 recognition site allows a higher transcriptional activity of the P1 element in response to NFAT1 (Fig. 6Go). These findings support a negative role of the Stat6 site on P1 transcriptional activity. However, the final expression of IL-4 has to be considered to be regulated by multiple cis-acting elements; therefore, the activity promoted by P1 could or could not be definitive in the final IL-4 gene activity. In Fig. 7Go, Northern analysis shows a clear increase in the levels of the IL-4 mRNA in the early stages of anti-CD3 stimulation, coinciding with the early NFAT1 binding to P1 (Fig. 1Go). Afterward, a decrease in the levels of IL-4 mRNA takes place, correlating with the recognition of the P1 element by Stat6 in the gel-shift assays. In addition, the endogenously produced IL-4 is, at least in part, responsible for the late decrease of IL-4 message under CD3 stimulation, as inferred from the results obtained in the presence of 11B11 Ab (Fig. 8Go). However, 11B11 could not completely revert the fall in IL-4 mRNA levels. Therefore, it could not be excluded that other causes may also be involved, such as the reduction in nuclear NFAT1 levels that takes place during late phases of TCR triggering in differentiated Th cells (Ref. 11 and our unpublished observations). Nevertheless, this possibility alone could not fully explain the results shown here with 11B11 (Fig. 8Go) or the luciferase data (Figs. 5Go and 6Go). Therefore, we proposed that, in effector Th2 cells activated by TCR, induction of Stat6 binding to P1 could be part of an autoregulatory mechanism of IL-4 to modulate its own expression. A model for the sequence of the events that could take place is presented in Fig. 9Go. In early phases of TCR activation, NFAT1 would drive the up-regulation of the IL-4 gene expression to carry out the effector Th2 functions. In late phases, when the levels of this IL were enough to autocrinally induce Stat6, this factor would participate in lowering the transcriptional rate of IL-4 by competition with NFAT1 in the P1 site occupancy. The relative quantities of each factor would determine its probability to bind P1, without necessarily implying an advantage of any of them in affinity by P1. In conditions of strong NFAT1 activation, such as I+P stimulation (Fig. 1Go), the balance between available NFAT1 and Stat6 would be displaced toward NFAT-P1 interaction. This could explain the low probability of complex I formation compared to complex II under this nonphysiological stimulation.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 9. Model for autoregulation of IL-4 gene expression in Th2 cells during TCR activation. After TCR ligation, an increase in the intracellular calcium concentration occurs, leading to calmodulin (CaM)-dependent calcineurin (Cn) activation. Dephosphorylation of NFAT mediated by calcineurin results in nuclear import. NFAT acts through the P elements of the IL-4 promoter, inducing the expression of IL-4. Once outside the cell, IL-4 interacts with the IL-4R, leading to the activation of Stat6, which binds to the P1 element down-regulating the IL-4 promoter. The final contribution of P1 to IL-4 gene activity would be the result of the balance between NFAT and Stat6 actions.

 
In addition to the composed NFAT-Stat6 P1 element, two more Stat6 binding sites overlapping P2 and P4 NFAT elements were identified within the human IL-4 promoter, and competition between both transcription factors for binding to these sites has been proposed (16). Although previous reports showed that Stat6 positively regulates the transcriptional activity driven by P2 when it is linked to heterologous promoters (29, 30), Huang et al. (28) showed that multimerization of the Stat6 site present in the P2 element strongly inhibited the activity of the IL-4 minimal promoter. Thus, the inhibitory effect of Stat6 along activation by TCR in defined Th2 cells could be also exerted through P2 and P4 sites. Nevertheless, according to our results Stat6 does not inhibit completely the IL-4 expression, because the levels of IL-4 mRNA after 24 h of CD3 ligation do not decrease to the basal levels in nonactivated cells (Figs. 7Go and 8Go). Thus, after the first period of high activity of the IL-4 gene, probably a balance is established between Stat6 and NFAT binding to P1 site to allow a moderate production of IL-4 until the extinction of the extracellular stimulus.


    Acknowledgments
 
We thank Dr. A. Rao for plasmid codifying murine NFAT1, Dr. J. N. Ihle for plasmid codifying murine Stat-6, Dr. F. Melchers for IL-4 producer cells, Dr. P. Portolés for anti-CD3, anti-TCR, and anti-IL-4 mAb producer cells, and Dr. F. Varas for the 7s probe. We also thank Olga Cano for technical assistance and Angel del Pozo for help with the photographic work.


    Footnotes
 
1 This work was supported by grants from Fondo de Investigaciones Sanitarias (FIS98/0038) and from Plan Nacional de Investigación Científica y Tecnológicas (PM1999-0013). N.F., F.M.M.-S., and C.D. were supported by grants from the Instituto de Salud Carlos III. Back

2 Current address: Instituto Nacional de Investigaciones Tecnológicas Agrarias y Alimentarias, E-28040 Madrid, Spain. Back

3 Address correspondence and reprint requests to Dr. Sara Ballester, Centro Nacional de Biología Fundamental, Instituto de Salud Carlos III, Majadahonda, E-28220 Madrid, Spain. E-mail address: sballes{at}isciii.es Back

4 Abbreviations used in this paper: CsA, cyclosporin A; Chx, cycloheximide; I+P, ionomycin plus PMA. Back

Received for publication October 22, 2001. Accepted for publication July 17, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Gascan, H., J. F. Gauchat, M. G. Roncarolo, H. Yssel, H. Spits, J. E. de Vires. 1991. Human B cell clones can be induced to proliferate and to switch to IgE and IgG4 synthesis by interleukin 4 and a signal provided by activated CD4+ T cell clones. J. Exp. Med. 173:745.
  2. Seder, R. A., W. E. Paul. 1994. Acquisition of lymphokine-producing phenotype by CD4+ T-cells. Annu. Rev. Immunol. 12:635.[Medline]
  3. Te Velde, A. A., R. J. Huijbens, K. E. Heije, J. de Vrie, C. G. Figdor. 1990. Interleukin 4 (IL-4) inhibits secretion of IL-1{beta}, tumor necrosis factor {alpha} and IL-6 by human monocytes. Blood 76:1392.[Abstract/Free Full Text]
  4. Howard, M., J. Farrar, M. Hilfiker, B. Johnson, K. Takatsu, T. Hamaoka, W. E. Paul. 1982. Identification of a T cell-derived B cell growth factor distinct from interleukin 2. J. Exp. Med. 155:914.[Abstract/Free Full Text]
  5. Romagnani, S.. 1993. Regulatory role of IL4 and other cytokines in the function and development of human T-cell clones. Res. Immunol. 144:625.[Medline]
  6. Rooney, J. W., T. Hoey, L. H. Glimcher. 1995. Coordinate and cooperative roles for NF-AT and AP-1 in the regulation of the murine IL-4 gene. Immunity 2:473.[Medline]
  7. Szabo, S. J., L. H. Glimcher, I. C. Ho. 1997. Genes that regulate interleulin-4 expression in T cells. Curr. Opin. Immunol. 9:776.[Medline]
  8. Cron, R. Q., S. J. Bort, Y. Wang, M. W. Brunvand, D. B. Lewis. 1999. T cell priming enhances IL-4 gene expression by increasing nuclear factor of activated T cells. J. Immunol. 162:860.[Abstract/Free Full Text]
  9. Li, B., C. Tournier, R. J. Davis, R. A. Flavell. 1999. Regulation of IL-4 expression by the transcription factor JunB during T helper cell differentiation. EMBO J. 18:420.[Medline]
  10. López-Rodríguez, C., J. Aramburu, A. S. Rakeman, A. Rao. 1999. NFAT5, a constitutively nuclear NFAT protein that does not cooperate with Fos and Jun. Proc. Natl. Acad. Sci. USA 96:7214.[Abstract/Free Full Text]
  11. Loh, C., J. A. Carew, J. Kim, P. G. Hogan, A. Rao. 1996. T-cell receptor stimulation elicits an early phase of activation and a later phase of deactivation of the transcription factor NFAT1. Mol. Cell. Biol. 16:3945.[Abstract]
  12. Okamura, H., J. Aramburu, C. García-Rodríguez, J. P. Viola, A. Raghavan, M. Tahiliani, X. Zhang, J. Qin, P. G. Hogan, A. Rao. 2000. Concerted dephosphorylation of the transcription factor NFAT1 induces a conformational switch that regulates transcriptional activity. Mol. Cell 6:539.[Medline]
  13. McCaffrey, P. G., B. A. Perrino, T. R. Soderling, A. Rao. 1993. NF-ATp, a T lymphocyte DNA-binding protein that is a target for calcineurin and immunosuppressive drugs. J. Biol. Chem. 268:3747.[Abstract/Free Full Text]
  14. Garcia-Rodriguez, C., A. Rao. 2000. Requirement for integration of phorbol 12-myristate 13-acetate and calcium pathways is preserved in the transactivation domain of NFAT1. Eur. J. Immunol. 30:2432.[Medline]
  15. Szabo, S. J., J. S. Gold, T. L. Murphy, K. M. Murphy. 1993. Identification of cis-acting regulatory elements controlling IL4 gene expression in T-cells: roles for NF-Y and NF-ATc. Mol. Cell. Biol. 13:4793.[Abstract/Free Full Text]
  16. Georas, S. N., J. E. Cumberland, T. F. Burke, R. Chen, U. Schindler, V. Casolaro. 1998. Stat6 inhibits human interleukin-4 promoter activity in T cells. Blood 92:4529.[Abstract/Free Full Text]
  17. Burke, T. F., V. Casolaro, S. N. Georas. 2000. Characterization of P5, a novel NFAT/AP-1 site in the human IL-4 promoter. Biochem. Biophys. Res. Commun. 270:1016.[Medline]
  18. Ho, I. C., M. R. Hodge, J. W. Rooney, L. H. Glimcher. 1996. The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4. Cell 85:973.[Medline]
  19. Hodge, M. R., H. J. Chun, J. Rengarajan, A. Alt, R. Lieberson, L. H. Glimcher. 1996. NFAT driven interleukin-4 transcription potentiated by NIP45. Science 274:1903.[Abstract/Free Full Text]
  20. Macian, F., C. Garcia-Rodriguez, A. Rao. 2000. Gene expression elicited by NFAT in the presence or absence of cooperative recruitment of Fos and Jun. EMBO J. 19:4783.[Medline]
  21. Chuvpilo, S., C. Schomberg, R. Gerwing, A. Heinfling, R. Reeves, F. Grummt, E. Serfling. 1993. Multiple closely-linked NFAT/octamer and HMG I (Y) binding sites are part of the interleukin-4 promoter. Nucleic Acids Res. 21:5694.[Abstract/Free Full Text]
  22. Klein-Hessling, S., G. Schneider, A. Heinfling, S. Chuvpilo, E. Serfling. 1996. HMG I(Y) interferes with the DNA binding of NFAT factors and the induction of the interleukin 4 promoter in T cells. Proc. Natl. Acad. Sci. USA 93:15311.[Abstract/Free Full Text]
  23. Casolaro, V., S. N. Georas, Z. Song, I. D. Zubkoff, S. A. Abdulkadir, D. Thanos, S. J. Ono. 1995. Inhibition of NF-AT-dependent transcription by NF-{kappa}B: implications for differential gene expression in T helper cell subsets. Proc. Natl. Acad. Sci. USA 92:11623.[Abstract/Free Full Text]
  24. Li-Weber, M., M. Giasi, P. H. Krammer. 1998. Involvement of Jun and Rel proteins in up-regulation of interleukin-4 gene activity by the T cell accessory molecule CD28. J. Biol. Chem. 273:32460.[Abstract/Free Full Text]
  25. Kaplan, M. H., U. Schindler, S. T. Smiley, M. J. Grusby. 1996. Stat6 is required for mediating responses to IL-4 and for development of Th2 cells. Immunity 4:313.[Medline]
  26. Shimoda, K., J. van Deursen, M. Y. Sangster, S. R. Sarawar, R. T. Carson, R. A. Tripp, C. Chu, F. W. Quelle, T. Nosaka, D. A. Vignali, et al 1996. Lack of IL-4-induced Th2 response and IgE class switching in mice with disrupted Stat6 gene. Nature 380:630.[Medline]
  27. Takeda, K., T. Tanaka, W. Shi, M. Matsumoto, M. Minami, S. Kashiwamura, K. Nakanishi, N. Yoshida, T. Kishimoto, S. Akira. 1996. Essential role of Stat6 in IL-4 signalling. Nature 380:627.[Medline]
  28. Huang, H., J. Hu-Li, H. Chen, S. Z. Ben-Sasson, W. E. Paul. 1997. IL-4 and IL-13 production in differentiated Th type 2 cells is not IL-4 dependent. J. Immunol. 159:3731.[Abstract]
  29. Curiel, R. E., R. Lahesmaa, J. Subleski, M. Cippitelli, R. A. Kirken, H. A. Young, P. Ghosh. 1997. Identification of a Stat-6-responsive element in the promoter of the human interleukin-4 gene. Eur. J. Immunol. 27:1982.[Medline]
  30. Lederer, J. A., V. L. Pérez, L. DesRoches, S. M. Kim, A. K. Abbas, A. H. Lichtman. 1996. Cytokine transcriptional events during helper T cell subset differentiation. J. Exp. Med. 184:397.[Abstract/Free Full Text]
  31. Kaye, J., S. Porcelli, J. Tite, B. Jones, Jr C. A. Janeway. 1983. Both a monoclonal antibody and antisera specific for determinants unique to individual cloned helper T cell lines can substitute for antigen and antigen-presenting cells in the activation of T cells. J. Exp. Med. 158:836.[Abstract/Free Full Text]
  32. Portolés, P., J. Rojo, A. Golby, M. Bonneville, S. Gromkowski, L. Greenbaum, Jr C. A. Janeway, D. B. Murphy, K. Bottomly. 1989. Monoclonal antibodies to murine CD3{epsilon} define distinct epitopes, one of which may interact with CD4 during T cell activation. J. Immunol. 142:4169.[Abstract]
  33. Karasuyama, H., F. Melchers. 1988. Establishment of mouse cell lines which constitutively secrete large quantities of interleukin 2, 3, 4 or 5, using modified cDNA expression vectors. Eur. J. Immunol. 18:97.[Medline]
  34. Ohara, J., W. E. Paul. 1985. Production of a monoclonal antibody to and molecular characterization of B-cell stimulatory factor-1. Nature 315:333.[Medline]
  35. Mosman, T.. 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods 65:55.[Medline]
  36. Dorado, B., P. Portolés, S. Ballester. 1998. NF{kappa}B in Th2 cells: delayed and long-lasting induction through the TCR complex. Eur. J. Immunol. 28:2234.[Medline]
  37. Quelle, F. W., K. Shimoda, W. Thierfelder, C. Fischer, A. Kim, S. M. Ruben, J. L. Cleveland, J. H. Pierce, A. D. Keegan, K. Nelms, et al 1995. Cloning of murine Stat6 and human Stat6, Stat proteins that are tyrosine phosphorylated in response to IL-4 and IL-3 but are not required for mitogenesis. Mol. Cell. Biol. 15:3336.[Abstract]
  38. Luo, C., K. T. Shaw, A. Raghavan, J. Aramburu, F. García-Cozar, B. A. Perrino, P. G. Hogan, A. Rao. 1996. Interaction of calcineurin with a domain of the transcription factor NFAT1 that controls nuclear import. Proc. Natl. Acad. Sci. USA 93:8907.[Abstract/Free Full Text]
  39. Stallcup, M. R., L. D. Washington. 1983. Region-specific initiation of mouse mammary tumor virus RNA synthesis by endogenous RNA polymerase II in preparations of cell nuclei. J. Biol. Chem. 258:2802.[Abstract/Free Full Text]
  40. Balmain, A., R. Krumlauf, J. K. Vass, G. D. Birnie. 1982. Cloning and characterization of the abundant cytoplasmic 7S RNA from mouse cells. Nucleic Acids Res. 10:4259.[Abstract/Free Full Text]
  41. Masuda, E. S., Y. Naito, H. Tokumitsu, D. Campbell, F. Saito, C. Hannum, K. Arai, N. Arai. 1995. NFATx, a novel member of the nuclear factor of activated T cells family that is expressed predominantly in the thymus. Mol. Cell. Biol. 15:2697.[Abstract]
  42. Adachi, S., Y. Amasaki, S. Miyatake, N. Arai, M. Iwata. 2000. Successive expression and activation of NFAT family members during thymocyte differentiation. J. Biol. Chem. 275:14708.[Abstract/Free Full Text]
  43. Hou, J., U. Schindler, W. J. Henzel, T. C. Ho, M. Brasseur, S. L. McKnight. 1994. An interleukin-4-induced transcription factor: IL4 Stat. Science 265:1701.[Abstract/Free Full Text]
  44. Lyakh, L., P. Ghosh, N. R. Rice. 1997. Expression of NFAT-family proteins in normal human T cells. Mol. Cell. Biol. 17:2475.[Abstract]
  45. Rincón, M., R. A. Flavell. 1997. Transcription mediated by NFAT is highly inducible in effector CD4+ T helper 2 (Th2) cells but not in Th1 cells. Mol. Cell. Biol. 17:1522.[Abstract]
  46. Ho, S. N., D. J. Thomas, L. A. Timmerman, X. Li, U. Francke, G. R. Crabtree. 1995. NFATc3, a lymphoid-specific NFATc family member that is calcium-regulated and exhibits distinct DNA binding specificity. J. Biol. Chem. 270:19898.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
L. Cameron, R. B. Webster, J. M. Strempel, P. Kiesler, M. Kabesch, H. Ramachandran, L. Yu, D. A. Stern, P. E. Graves, I. C. Lohman, et al.
Th2 Cell-Selective Enhancement of Human IL13 Transcription by IL13-1112C>T, a Polymorphism Associated with Allergic Inflammation
J. Immunol., December 15, 2006; 177(12): 8633 - 8642.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Q. Lan, T. Zheng, N. Rothman, Y. Zhang, S. S. Wang, M. Shen, S. I. Berndt, S. H. Zahm, T. R. Holford, B. Leaderer, et al.
Cytokine polymorphisms in the Th1/Th2 pathway and susceptibility to non-Hodgkin lymphoma
Blood, May 15, 2006; 107(10): 4101 - 4108.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
S. N. Georas, J. Guo, U. De Fanis, and V. Casolaro
T-helper cell type-2 regulation in allergic disease
Eur. Respir. J., December 1, 2005; 26(6): 1119 - 1137.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dorado, B.
Right arrow Articles by Ballester, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dorado, B.
Right arrow Articles by Ballester, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS