The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ichikawa, H. T.
Right arrow Articles by Segal, B. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ichikawa, H. T.
Right arrow Articles by Segal, B. M.
The Journal of Immunology, 2002, 169: 2781-2787.
Copyright © 2002 by The American Association of Immunologists

Activation of APCs Through CD40 or Toll-Like Receptor 9 Overcomes Tolerance and Precipitates Autoimmune Disease1

Hiroshi T. Ichikawa*, Lucas P. Williams* and Benjamin M. Segal2,*,{dagger}

Departments of * Neurology and {dagger} Microbiology and Immunology, University of Rochester School of Medicine and Dentistry, Rochester, NY 14642


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Some autoreactive T cells normally escape thymic selection and persist in the periphery. This is true of myelin-reactive CD4+ T cells, the effectors of experimental autoimmune encephalomyelitis (EAE) in laboratory animals and the presumed mediators of multiple sclerosis in humans. Nonetheless, most individuals do not succumb to autoimmune disease. There is growing evidence that while peripheral APCs stimulate immune responses against foreign Ags in the setting of tissue destruction and "danger," they actually maintain tolerance against self Ags under steady state conditions. We hypothesized that tolerance against candidate autoantigens could be reversed by activation of APCs via CD40 or Toll-like receptor 9 signaling. Adult SJL mice injected i.p. with a peptide fragment of proteolipid protein (a candidate autoantigen in multiple sclerosis) emulsified in IFA fail to mount lymphoproliferative or cytokine responses and are protected from EAE upon subsequent challenge with the Ag combined with adjuvants. Here we report that tolerized proteolipid protein-specific lymph node cells regain the ability to divide, differentiate along a Th1 lineage, and transfer EAE when reactivated in the presence of agonistic Abs against CD40 or CpG oligonucleotides. The effects of both anti-CD40 and CpG oligonucleotides are dependent upon induction of IL-12. Our findings suggest two mechanisms to explain the well-documented association between infectious illnesses and flare-ups of multiple sclerosis. Microbial pathogens could 1) release molecules that bind Toll-like receptors, and/or 2) stimulate microbe-specific T cells to express CD40 ligand, thereby licensing APCs that bear both microbial and autoantigens to break tolerance.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Negative selection in the thymus is not a foolproof process. Autoreactive T cells regularly escape into the periphery. This includes CD4+ T cells specific for myelin Ags, the mediators of experimental autoimmune encephalomyelitis (EAE)3 and presumably of multiple sclerosis (MS) (1, 2, 3, 4, 5, 6). Furthermore, candidate autoantigens, including isoforms of myelin basic protein and proteolipid protein (PLP), have been detected in secondary lymphoid tissues, where they might be accessible for processing and presentation by professional APCs (7, 8, 9, 10, 11, 12). Nonetheless, autoimmune diseases, including MS, are relatively rare.

Such observations have lead to the conclusion that autoreactive T cells must be tightly regulated and/or inhibited from differentiating into autoimmune effector cells in the peripheral immune systems of healthy individuals (13). Several laboratories have recently demonstrated that mature T cells specific for nominal Ags enter a state of tolerance following cognate interactions with resting or unactivated dendritic cells (14, 15, 16, 17). A similar mechanism might be employed during homeostasis to maintain peripheral tolerance against self Ags. Bone marrow-derived APCs continually scavenge self Ags that are shed as a consequence of physiological cell turnover (18, 19, 20). Since these APCs remain in a resting state in the absence of danger signals (21), the cross-presentation of self peptides under steady state conditions could result in the generation of a subpopulation of tolerized autoreactive T cells within the normal T cell repertoire. The question then arises: what factors lead to the conversion of tolerized autoreactive T cells into autoimmune effector cells in patients with autoimmune diseases such as MS?

In the studies mentioned above the activation state of APCs was a pivotal factor in deciding the fate of the T cell population targeted for tolerization. In each case coadministration of an agonist Ab specific for the macrophage/dendritic cell receptor, CD40, subverted tolerance induction and resulted in T cell priming. Based on these findings we posed the hypothesis that APC-activating agents could disrupt endogenous immunoregulatory processes, thereby allowing tolerized autoreactive T cells to regain their biological functions and mediate autoimmune disease. This concept is intriguing in light of the fact that autoimmune diseases such as MS are more likely to relapse in the setting of infectious illness, which is typically associated with APC activation (22, 23, 24, 25, 26, 27, 28). According to our theory, APCs that bear autoantigenic peptides (or molecular mimics) and are activated by "danger signals" in the course of an infection could mediate the conversion of bystander autoreactive T cells from a tolerized into an effector phenotype. Consistent with this scenario, several researchers have found that peripheral T cell tolerance was inhibited by infection of laboratory animals with bacterial, parasitic, or viral agents (29, 30). Furthermore, pretreatment of mice with bacterially derived DNA exacerbates viral and autoimmune models of MS (31).

We were particularly interested in the role of ligands for CD40 and Toll-like receptors (TLRs) in reversing tolerance against self Ags. Microbial DNA, the ligand for TLR-9, is released during the course of infections and could result in widespread APC activation (32, 33). Furthermore, microbial exposures result in the expansion and activation of anti-microbial T cells that could license APCs via CD40-CD40 ligand interactions (34, 35, 36). Engagement of either CD40 or TLR-9 on macrophages and dendritic cells results in the production of IL-12 (37, 38, 39, 40, 41, 42), a cytokine that we as well as others have shown plays a critical role in autoimmune pathogenesis (43, 44, 45, 46, 47, 48, 49, 50). Therefore, we questioned whether CD40 or TLR-9 triggering in combination with antigenic challenge would restore the pathogenic functions of tolerized autoreactive T cells by an IL-12-dependent pathway.

To test our hypothesis we used a classic protocol for Ag-specific immunosuppression (51, 52). Naive SJL mice were injected with a peptide fragment of PLP (PLP139–151) by the i.p. route. Mice treated in this fashion are unable to mount proliferative or cytokine recall responses following subsequent challenge with a normally immunogenic form of PLP139–151 (i.e., a s.c. inoculum of peptide in CFA) and are protected from EAE. Here we report that that myelin-reactive T cells from tolerized donors are converted into pathogenic effector cells that proliferate, secrete cytokines, and transfer EAE following reactivation in the presence of agonist anti-CD40, but not control, Abs. Moreover, a CpG-containing oligonucleotide (ODN) that simulates bacterial DNA and binds TLR-9 was also effective in reversing tolerance. The disease-promoting activities of both anti-CD40 and CpG ODNs were at least partially dependent upon the induction of IL-12. Furthermore, stimulation of tolerized autoreactive T cells with IL-12 alone was sufficient to restore encephalitogenicity.

Our findings have important implications regarding the roles of environmental agents, including infectious microbes, in the pathogenesis of autoimmune diseases such as MS. Furthermore, they suggest that agents that block CD40 and TLR-9 and/or neutralize IL-12 might be useful in preventing autoimmune exacerbations triggered during infections or following other environmental exposures that result in APC activation.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice

Female SJL mice were obtained from the National Cancer Institute (Frederick, MD) at 6–8 wk of age and were housed in a pathogen-free facility. Mice were 8–12 wk of age when the experiments were initiated.

Peptides and oligonucleotides

PLP139–151 (HSLGKWLGHPDKF) was synthesized and purified by HPLC by Macromolecular Resources (Fort Collins, CO). ODN were purchased from Operon Technologies (Alameda, CA) and were phosphorothioate-modified to increase their resistance to nuclease degradation. The sequences were as follows: CpG ODN, ATAATCGACGTTCAAGCAAG; and control (non-CpG) ODN, ATAATAGAGCTTCAAGCAAG (53). The LPS content of the ODNs was <1 ng LPS/mg DNA as measured by a Limulus amebocyte assay.

Induction of tolerance and active immunization

For induction of Ag-specific tolerance, mice were injected i.p. with PLP139–151 (300 µg) emulsified in IFA (1/1). Control mice were mock-tolerized with PBS alone in IFA. Two weeks later all mice were challenged with PLP139–151 (100 µg) in CFA (with 5 mg/ml heat-killed mycobacteria) by s.c. injection at four sites over the flanks. In experiments involving active immunization, Bordetella pertussis toxin (List Laboratories, Campbell, CA) was injected i.p. (2 ng/mouse) on days 0 and 2 postchallenge. Animals were examined daily by a blinded examiner for signs of EAE and were rated for severity of clinical signs on a five-point scale as previously described (48).

Generation of PLP139–151-specific cell lines for cell transfer and cytokine analysis

Draining lymph nodes (LNs; inguinal and axillary) were removed 10–14 days following s.c. challenge of mock- or PLP139–151-tolerized mice and processed as previously described (48). Cells were resuspended in RPMI 1640 containing 10% FCS and standard supplements and were cultured in 24-well plates (2 ml/well) with or without PLP139–151 (50 µg/ml). Where specified, the following reagents were added: CpG ODN (100 nM), control ODN (100 nM), rIL-12 (20 ng/ml; gift from S. Wolf, Genetics Institute, Cambridge, MA), anti-CD40 mAb (hybridoma FGK45, (54); 10 µg/ml); anti-IL-12 mAb (C17.8; 10 µg/ml; gift from G. Trichieri, Wistar Institute, Philadelphia, PA), and Con A (2 µg/ml; Sigma-Aldrich, St. Louis, MO). The following mAbs were purchased from BD PharMingen (San Diego, CA) and added at 10 µg/ml where indicated: rat IgG2a, agonist anti-CD28, blocking anti-CTLA-4, and anti-CD3{epsilon}.

Supernatants were collected after 48 h of culture for cytokine quantification. At 96 h the cells were harvested, washed extensively, resuspended in PBS, and injected into naive syngeneic SJL mice (50 x 106 cells in 0.1 cc i.p.). Recipients were examined daily and rated for the severity of neurological deficits as described above.

Proliferation assays

LN cells (LNC; 4 x 105 in 0.2 ml) were cultured with or without PLP139–151 (50 µg/ml) in triplicate for 4 days in 96-well round-bottom plates (Costar, Cambridge, MA). Wells were pulsed for the final 16 h of culture with 1 µCi [3H]TdR (Amersham, Arlington Heights, IL), and incorporated radioactivity was measured using a Betaplate scintillation counter (Wallac, Gaithersburg, MD).

Cytokine ELISA

IFN-{gamma}, IL-4, and IL-10 were quantified using a sandwich ELISA technique based on noncompeting pairs of Abs as previously described (45).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Injection of mice with a high dose of PLP139–151 in IFA i.p. induces Ag-specific tolerance and resistance to EAE

Consistent with previous reports (51, 52), female SJL mice injected with high dose PLP139–151 in IFA i.p. were protected from EAE upon active immunization with the same peptide 2 wk later. In repeated experiments control mice experienced EAE at an incidence of 85–100%, compared with 0% of PLP-tolerized mice. Draining LNC from PLP-tolerized, as opposed to mock-tolerized, mice failed to mount lymphoproliferative or IFN-{gamma} recall responses to PLP ex vivo or to transfer EAE to naive syngeneic recipients (Table IGo). They also failed to produce detectable amounts of IL-10 and IL-4, indicating that they had not defaulted to a Tr1 or Th2 pathway (data not shown). Tolerance was selective for the PLP-specific subset, since the same LNC mounted robust proliferative and cytokine responses when stimulated with an agonist Ab against CD3 or Con A (Table IGo; our unpublished observations).


View this table:
[in this window]
[in a new window]
  		Table I. Lymphoproliferation, IFN-{gamma} production, and encephalitogenicity following tolerization and challenge with PLP139–151a

 
CD4+ T cells from tolerized mice do not regain biological functions following reactivation with immunocompetent APCs either alone or in combination with IL-2, {alpha}CD28 agonist mAbs, or {alpha}CTLA-4 blocking mAbs

Criss-cross experiments revealed that CD4+ T cells from PLP-tolerized donors fail to proliferate or produce cytokines even when stimulated with control T-depleted splenocytes. On the other hand, APCs from tolerized mice are competent in reactivating Ag-specific CD4+ T cells from control immunized mice (our unpublished observations). Hence, we concluded that tolerance to PLP represents an intrinsic property of the T cell population and is not secondary to a deficiency of immunocompetent APCs. In previous experiments we as well as others found that TCR transgenic T cells parked in syngeneic recipients are not clonally deleted consequent to i.p. injection of high doses of target Ag in IFA (our unpublished observations and Ref. 51). By analogy, we speculated that polyclonal PLP-specific T cells persisted in our tolerized mice, but were functionally inactive. We considered the possibility that introduction of Ag in the absence of microbial adjuvants resulted in Ag-specific T cell anergy as a consequence of underexpression of costimulatory molecules on APCs (55, 56, 57). However, lymph node cells from tolerized mice remained unresponsive when cultured with PLP139–151 in the presence of anti-CD28 agonist Abs or IL-2 (Fig. 1Go). Consistent with previous reports (58), ex vivo challenge of tolerized lymph node cells with Ag and a blocking Ab against the T cell inhibitory molecule, CTLA-4, also failed to restore proliferative or cytokine responses (Fig. 1Go).



View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 1. Reactivation of PLP-tolerized LNC in the presence of IL-2, anti-CD28 agonist mAbs, or anti-CTLA-4 blocking mAbs does not restore responsiveness. Female SJL mice were injected i.p. with PBS in IFA (control) or PLP139–151 in IFA (tolerized) 14 days before s.c. challenge with PLP139–151 in CFA. Draining LNs were removed 10 days postchallenge and separated into single-cell suspensions. A, Proliferative responses were measured after 96 h of culture. The data are representative of four experiments with similar results. Background levels (of LNC cultured without Ag) were subtracted to obtain the results shown. B, Supernatants were collected at 48 h for measurement of IFN-{gamma} levels by ELISA. Cytokine production was consistently below the limits of detection (12–24 pg/ml) in cultures without Ag. The data are representative of five experiments with similar results.

 
Reactivation of PLP-tolerized LNC in the presence of {alpha}CD40 agonist mAbs reverses tolerance and restores encephalitogenicity

Since T cell growth factors and costimulatory ligands did not restore the biological functions of tolerized PLP-specific T cells, we tested the ability of APC-activating agents to reverse tolerance. Other researchers had demonstrated that agonist anti-CD40 Abs prevent Ag-specific T cell tolerance against soluble peptides, apoptotic cells, and tumor Ags when administered simultaneously with the tolerogen (15, 16, 59). In the current manuscript we expand upon these findings by evaluating the role of anti-CD40 in reversing well-established tolerance against PLP, a candidate autoantigen in MS.

Naive SJL mice were pretreated with either PLP139–151 or vehicle in IFA i.p. before challenge with PLP139–151 in CFA s.c. On day 10 postchallenge draining LNs were harvested and pooled from each group, separated into single-cell suspensions, and cultured with either an agonist mAb against CD40 (FGK45) (54) or isotype-matched control rat IgG2a in the presence or the absence of Ag. PLP-tolerized LNC costimulated with FGK45, but not control IgG, exhibited PLP139–151-specific proliferation and IFN-{gamma} production that approximated that of mock-tolerized LNC (Fig. 2Go, A and B). More significantly, anti-CD40 stimulation converted the previously tolerized LNC into encephalitogenic effectors that transferred moderate to severe EAE to 100% of naive syngeneic recipients (Fig. 2GoC).



View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 2. LNC from PLP-tolerized mice proliferate, secrete IFN-{gamma}, and transfer EAE following culture with Ag and anti-CD40 agonist mAbs. LNC were resected from mock- or PLP-tolerized mice following s.c. challenge as described in Fig. 1Go. The cells were then cultured with or without PLP139–151 (50 µg/ml) and anti-CD40 agonist mAb (FGK45; 10 µg/ml) or isotype-matched control rat IgG (10 µg/ml). To assess whether proliferation, IFN-{gamma} production, and encephalitogenicity were IL-12 dependent, a neutralizing mAb against IL-12 (C17.8, 10 µg/ml) was added to some of the wells. A, Lymphoproliferation was measured after 96 h. B, Supernatants were collected at 48 h to measure IFN-{gamma} production. The data shown represent PLP-specific responses, calculated as the difference between cultures with and without Ag, respectively. Experiments were repeated five to eight times with similar results. *, p < 0.005 compared with the control by Student’s t test. C, Following 96 h of culture with PLP139–151 and the indicated Abs, LNC from each group were harvested, washed, and injected i.p. into naive syngeneic SJL mice (5 x 107 cells/mouse). Recipients were examined daily and rated for severity of disease on a five-point scale by a blinded examiner. The results are pooled from two experiments with 8–12 mice/group.

 
Stimulation of PLP-tolerized LNC with CpG ODNs also reverses tolerance and precipitates EAE

Dendritic cells and macrophages up-regulate MHC and costimulatory molecules and produce inflammatory/Th1-polarizing cytokines following exposure to CpG ODNs, which are known to act through a TLR-9 dependent pathway (32, 33, 46, 48, 53). We questioned whether APC activation through this alternative route would also be effective in reversing tolerance. PLP-tolerized LNC were challenged with or without Ag and either an immunostimulatory CpG-ODN or a control ODN. Similar to the results obtained with anti-CD40, tolerized LNC stimulated with CpG-ODN, but not control ODN, mounted robust PLP-specific proliferation and cytokine responses and transferred a severe form of EAE to naive mice (Fig. 3Go).



View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 3. Activation of APCs through TLR-9 reverses tolerance against PLP by an IL-12-dependent pathway. LNC from mice treated as described in Fig. 2Go were stimulated in vitro with or without PLP139–151 and either a CpG-containing ODN (100 nM) or a control ODN. A neutralizing Ab against IL-12 was added to some of the wells. Lymphoproliferation was measured at 96 h (A), and IFN-{gamma} production was determined at 48 h (B). The results represent Ag-specific responses (with background levels subtracted) and were repeated five times with similar results. *, p < 0.005 compared with the control by Student’s t test. C, Following 96 h of culture with PLP139–151 and the indicated reagents, LNC from each group were injected into naive syngeneic recipients (5 x 107 cells/mouse) to test their encephalitogenicity as described in Fig. 2Go. The results are pooled from two experiments with 6–12 mice/group.

 
IL-12 stimulation is sufficient to reverse tolerance

Reversal of tolerance was fully (FGK45) or partially (CpG ODN) dependent on the induction of IL-12 (Figs. 2Go and 3Go, respectively). Therefore, we questioned whether IL-12 stimulation itself would be sufficient to restore proliferative and cytokine capacities and encephalitogenicity. As demonstrated in Fig. 4Go, LNC from PLP-tolerized mice regained full biological activities upon reactivation with Ag and IL-12 alone.



View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 4. Stimulation of PLP-tolerized LNC with IL-12 restores proliferation, IFN-{gamma} production, and encephalitogencity. LNC from mice that were tolerized and challenged with PLP139–151 were cultured with Ag (50 µg/ml) in the absence or the presence of rIL-12 (20 ng/ml). LNC from mock-tolerized and PLP-challenged mice were cultured with Ag alone. PLP-specific proliferation (A) and IFN-{gamma} production (B) were measured after 96 and 48 h of culture, respectively, as described in Fig. 1Go. The results are representative of three experiments with similar results. *, p < 0.001 compared with the control. C, LNC from PLP-tolerized mice were harvested, washed, and injected i.p. into naive syngeneic recipients (5 x 107 cells/mouse) after 96 h of culture with PLP139–151 in the absence or the presence of rIL-12. Mice were examined daily and rated for disease severity. There were seven (-IL-12) and eight (+IL-12) recipients per group.

 
Activation of APCs in vivo via the CD40 pathway prevents tolerance induction and increases susceptibility to EAE

We next investigated the effects of APC-activating agents on tolerance against PLP peptide in vivo. Mice were injected i.p. with three doses of either FGK45 or isotype-matched control IgG between days 4–8 posttolerization. All mice were challenged with PLP in CFA on day 7. Some of the experimental animals were followed long term for disease course; other were sacrificed on day 17 for LN harvest and cytokine/proliferation assays.

LNC removed from PLP-tolerized mice treated with FGK45, but not those from mice treated with control IgG, proliferated and secreted substantial amounts of IL-3 and IFN-{gamma} in response to antigenic challenge in vitro (Fig. 5Go, A and B; our unpublished observations). Anti-CD40 treatment also resulted in a significant incidence of EAE in tolerized mice (Fig. 5GoC).



View larger version (15K):
[in this window]
[in a new window]
  		FIGURE 5. Systemic injections of {alpha}CD40 Abs reverse tolerance against myelin Ags in vivo. SJL mice were tolerized against PLP139–151 and injected i.p. with either FGK45 or isotype-matched control rat IgG (250 µg in 100 µl/mouse) on days 4, 6, and 8. Control mice were mock-tolerized with PBS in IFA and injected with rat IgG according to the same schedule. All mice were challenged with Ag in CFA on day 7 and either followed for clinical disease course or sacrificed on day 24 for LN harvest. A and B, LNC from each group were cultured with or without Ag. Supernatants were collected at 48 h to measure IFN-{gamma} (A) and IL-3 (B) by ELISA. Ag-specific responses are shown. The results were reproduced in two independent experiments. C, Mice were rated daily on a five-point scale for disease severity. For each group collective daily scores were summed over a 30-day observation period. There were eight mice in each group.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Myelin-reactive T cells are normally present within the peripheral T cell pools of healthy humans as well as laboratory animals (1, 2, 3, 4, 5, 6). Furthermore, myelin Ags are expressed in peripheral lymphoid tissues and are most likely accessible to local APCs for presentation to peripheral T cells (7, 8, 9, 10, 11, 12). Paradoxically, recent studies suggest that these conditions might serve to inhibit, rather than promote, the development of autoimmune demyelinating disease. Since there are no danger signals to activate APCs under steady state conditions (21, 60), the cross-presentation of myelin proteins during homeostasis could result in tolerization rather than priming of myelin-specific T cells (14, 15, 17). In this manuscript we posed the following question: what conditions are responsible (or sufficient) for the conversion of normally tolerized and quiescent autoreactive T cells into functional autoimmune effector cells in patients with autoimmune diseases such as MS?

Microbial infection is the environmental factor most strongly associated with exacerbations of MS as well as other autoimmune diseases (26, 61, 62, 63). Furthermore, mice that are transgenic for a myelin-specific TCR develop spontaneous EAE when housed in a nonsterile facility, but not in a sterile, specific pathogen-free facility (64). In this paper we demonstrate that activation of APCs via TLR-9 and CD40, events that are likely to occur during the course of an infection, reverses tolerance against myelin Ags and breaks resistance to EAE. We have found that the bacterial cell wall component, LPS, has a similar effect to CpG ODNs in our experimental system (our unpublished observations). This suggests that in the setting of infection, multiple TLR pathways could play a role in restoring autoimmune responses. Our experiments were designed to examine T cell tolerance and its reversal on a population level, which is most relevant regarding the clinical status of the host. In future experiments we will determine whether the restoration of biological functions by CpG ODN or FGK45 affects PLP-tolerized T cells uniformly or reflects the outgrowth of a subpopulation of T cells that possibly escaped tolerance induction in the first place.

In previous reports CD40 triggering prevented the induction of tolerance against viral, xenogenic, and tumor Ags cells (14, 15, 16, 17). In each case the combination of anti-CD40 with an otherwise tolerizing stimulus converted T cell tolerization into T cell priming. In other studies coadministration of IL-12 alone or in combination with anti-CTLA-4 prevented peripheral T cell tolerance induced by i.v. peptides (65, 66). Here we expand upon these findings by demonstrating that stimulation of LNC with either anti-CD40 or rIL-12 can reverse tolerance after it has been firmly established against a candidate autoantigen in adult wild-type mice. Furthermore, to our knowledge this paper constitutes the first report that engagement of TLR-9 with CpG ODNs can also reverse tolerance. Not surprisingly, the tolerance-breaking/disease-promoting effects of both anti-CD40 and CpG ODNs are IL-12 dependent (Figs. 2Go and 3Go).

While stimulation of tolerized LNC with CpG or FGK45 was sufficient to reverse tolerance, the introduction of Ag emulsified in CFA by the s.c. route was not. In addition, systemic administration of CpG ODNs at the time of either tolerization and/or challenge did not restore PLP-specific LNC responses or increase susceptibility to EAE. Similarly, substitution of CFA with CpG ODN in IFA during in vivo challenge did not overcome tolerance (our unpublished observations). These apparently inconsistent findings might be explained by differences in the efficiency with which bacterial DNA products are delivered to the relevant APC depending upon the route and mode of administration. For example, s.c. injected CFA or CpG ODN in IFA has a depot effect that could restrict the APC population exposed to Ag and microbial DNA products to Langerhans cells and dermal macrophages. In addition, the rate at which bacterial products and Ags are leaked from the depot might not be ideal for activating those APCs that are capable of breaking tolerance. On the other hand, the half-life of systemically injected CpG ODN and its distribution in various body compartments are unknown. By contrast, the in vitro culture system that we used in our studies optimizes T cell/APC interactions and TLR-9/CD40 signaling. We would argue that the latter experimental paradigm more closely simulates the microenvironment of secondary lymphoid tissues draining an infectious focus.

While our findings provide an alternative explanation for the association between infection and autoimmunity, they are not incompatible with the concept of molecular mimicry. Based on our theory, exacerbation of MS or EAE in the setting of infectious illness is dependent on the temporal and spatial concurrence of at least three events. 1) APCs, most likely dendritic cells, scavenge and process endogenous myelin Ags (that are normally expressed in secondary lymphoid tissues (7, 8, 9, 10, 11, 12)) or their molecular mimics (that are introduced during the course of the infection). 2) These APCs are activated by TLR ligands released by the invading pathogens or by CD40 ligand-expressing T cells generated in response to the microbes. 3) While still in an activated state, these APCs come into contact with tolerized myelin-reactive T cells present in the local microenvironment and mediate their conversion to functional autoimmune effector cells. Our results cast further light on the mechanisms linking autoimmune exacerbations with infectious illnesses. They also support the use of reagents that deactivate APCs and/or neutralize IL-12 for the treatment of MS disease activity, particularly in the setting of infectious or other immunostimulatory environmental exposures.


   Footnotes
 
1 This work was supported in part by grants from the National Multiple Sclerosis Society (JF2098A1/1) and the National Institutes of Health (NS41562). B.M.S. is a Harry Weaver Neuroscience Scholar of the National Multiple Sclerosis Society. Back

2 Address correspondence and reprint requests to Dr. Benjamin M. Segal, Department of Neurology/Neuroimmunology, University of Rochester School of Medicine, 601 Elmwood Avenue, Box 605, Rochester, NY 14642. E-mail address: benjamin_segal{at}urmc.rochester.edu Back

3 Abbreviations used in this paper: EAE, experimental autoimmune encephalomyelitis; LN, lymph node; LNC, LN cell; MS, multiple sclerosis; ODN, oligonucleotide; PLP, proteolipid protein; TLR, Toll-like receptor. Back

Received for publication May 22, 2002. Accepted for publication July 1, 2002.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Anderson, A. C., L. B. Nicholson, K. L. Legge, V. Turchin, H. Zaghouani, V. K. Kuchroo. 2000. High frequency of autoreactive myelin proteolipid protein-specific T cells in the periphery of naive mice: mechanisms of selection of the self-reactive repertoire. J. Exp. Med. 191:761.[Abstract/Free Full Text]
  2. Chou, Y. K., M. Vainiene, R. Whitham, D. Bourdette, C. H. Chou, G. Hashim, H. Offner, A. A. Vandenbark. 1989. Response of human T lymphocyte lines to myelin basic protein: association of dominant epitopes with HLA class II restriction molecules. J. Neurosci. Res. 23:207.[Medline]
  3. Martin, R., D. Jaraquemada, M. Flerlage, J. Richert, J. Whitaker, E. O. Long, D. E. McFarlin, H. F. McFarland. 1990. Fine specificity and HLA restriction of myelin basic protein-specific cytotoxic T cell lines from multiple sclerosis patients and healthy individuals. J. Immunol. 145:540.[Abstract]
  4. Pelfrey, C. M., L. R. Tranquill, A. B. Vogt, H. F. McFarland. 1996. T cell response to two immunodominant proteolipid protein (PLP) peptides in multiple sclerosis patients and healthy controls. Mult. Scler. 1:270.[Medline]
  5. Voskuhl, R. R., D. E. McFarlin, L. R. Tranquill, G. Deibler, R. Stone, H. Maloni, H. F. McFarland. 1993. A novel candidate autoantigen in a multiplex family with multiple sclerosis: prevalence of T-lymphocytes specific for an MBP epitope unique to myelination. J. Neuroimmunol. 46:137.[Medline]
  6. Jingwu, Z., R. Medaer, G. A. Hashim, Y. Chin, E. van den Berg-Loonen, J. C. Raus. 1992. Myelin basic protein-specific T lymphocytes in multiple sclerosis and controls: precursor frequency, fine specificity, and cytotoxicity. Ann. Neurol. 32:330.[Medline]
  7. Liu, H., A. J. MacKenzie-Graham, K. Palaszynski, S. Liva, R. R. Voskuhl. 2001. "Classic" myelin basic proteins are expressed in lymphoid tissue macrophages. J. Neuroimmunol. 116:83.[Medline]
  8. MacKenzie-Graham, A. J., T. M. Pribyl, S. Kim, V. R. Porter, A. T. Campagnoni, R. R. Voskuhl. 1997. Myelin protein expression is increased in lymph nodes of mice with relapsing experimental autoimmune encephalomyelitis. J. Immunol. 159:4602.[Abstract]
  9. Pribyl, T. M., C. W. Campagnoni, K. Kampf, T. Kashima, V. W. Handley, J. McMahon, A. T. Campagnoni. 1993. The human myelin basic protein gene is included within a 179-kilobase transcription unit: expression in the immune and central nervous systems. Proc. Natl. Acad. Sci. USA 90:10695.[Abstract/Free Full Text]
  10. Pribyl, T. M., C. W. Campagnoni, K. Kampf, T. Kashima, V. W. Handley, J. McMahon, A. T. Campagnoni. 1996. Expression of the myelin proteolipid protein gene in the human fetal thymus. J. Neuroimmunol. 67:125.[Medline]
  11. Mathisen, P. M., S. Pease, J. Garvey, L. Hood, C. Readhead. 1993. Identification of an embryonic isoform of myelin basic protein that is expressed widely in the mouse embryo. Proc. Natl. Acad. Sci. USA 90:10125.[Abstract/Free Full Text]
  12. Fritz, R. B., M. L. Zhao. 1996. Thymic expression of myelin basic protein (MBP): activation of MBP-specific T cells by thymic cells in the absence of exogenous MBP. J. Immunol. 157:5249.[Abstract]
  13. Holda, J. H., R. H. Swanborg. 1981. Regulation of experimental allergic encephalomyelitis. III. Demonstration of effector cells in tolerant rats. Eur. J. Immunol. 11:338.[Medline]
  14. Garza, K. M., S. M. Chan, R. Suri, L. T. Nguyen, B. Odermatt, S. P. Schoenberger, P. S. Ohashi. 2000. Role of antigen-presenting cells in mediating tolerance and autoimmunity. J. Exp. Med. 191:2021.[Abstract/Free Full Text]
  15. Hawiger, D., K. Inaba, Y. Dorsett, M. Guo, K. Mahnke, M. Rivera, J. V. Ravetch, R. M. Steinman, M. C. Nussenzweig. 2001. Dendritic cells induce peripheral T cell unresponsiveness under steady state conditions in vivo. J. Exp. Med. 194:769.[Abstract/Free Full Text]
  16. Sotomayor, E. M., I. Borrello, E. Tubb, F. M. Rattis, H. Bien, Z. Lu, S. Fein, S. Schoenberger, H. I. Levitsky. 1999. Conversion of tumor-specific CD4+ T-cell tolerance to T-cell priming through in vivo ligation of CD40. Nat. Med. 5:780.[Medline]
  17. Diehl, L., A. T. den Boer, S. P. Schoenberger, E. I. van der Voort, T. N. Schumacher, C. J. Melief, R. Offringa, R. E. Toes. 1999. CD40 activation in vivo overcomes peptide-induced peripheral cytotoxic T-lymphocyte tolerance and augments anti-tumor vaccine efficacy. Nat. Med. 5:774.[Medline]
  18. Huang, F. P., N. Platt, M. Wykes, J. R. Major, T. J. Powell, C. D. Jenkins, G. G. MacPherson. 2000. A discrete subpopulation of dendritic cells transports apoptotic intestinal epithelial cells to T cell areas of mesenteric lymph nodes. J. Exp. Med. 191:435.[Abstract/Free Full Text]
  19. Zhang, Y., B. O’Brien, J. Trudeau, R. Tan, P. Santamaria, J. P. Dutz. 2002. In situ {beta} cell death promotes priming of diabetogenic CD8 T lymphocytes. J. Immunol. 168:1466.[Abstract/Free Full Text]
  20. Kurts, C., W. R. Heath, F. R. Carbone, J. Allison, J. F. Miller, H. Kosaka. 1996. Constitutive class I-restricted exogenous presentation of self antigens in vivo. J. Exp. Med. 184:923.[Abstract/Free Full Text]
  21. Matzinger, P.. 2002. The danger model: a renewed sense of self. Science 296:301.[Abstract/Free Full Text]
  22. Panitch, H. S.. 1994. Influence of infection on exacerbations of multiple sclerosis. Ann. Neurol. 36:S25.
  23. Sriram, S., W. Mitchell, C. Stratton. 1998. Multiple sclerosis associated with Chlamydia pneumoniae infection of the CNS. Neurology 50:571.[Medline]
  24. Sibley, W. A., C. R. Bamford, K. Clark. 1985. Clinical viral infections and multiple sclerosis. Lancet 1:1313.[Medline]
  25. Gianani, R., N. Sarvetnick. 1996. Viruses, cytokines, antigens, and autoimmunity. Proc. Natl. Acad. Sci. USA 93:2257.[Abstract/Free Full Text]
  26. Gay, D., G. Dick, G. Upton. 1986. Multiple sclerosis associated with sinusitis: case-controlled study in general practice. Lancet 1:815.[Medline]
  27. Enders, U., H. Karch, K. V. Toyka, M. Michels, J. Zielasek, M. Pette, J. Heesemann, H. P. Hartung. 1993. The spectrum of immune responses to Campylobacter jejuni and glycoconjugates in Guillain-Barre syndrome and in other neuroimmunological disorders. Ann. Neurol. 34:136.[Medline]
  28. Compston, D. A., B. N. Vakarelis, E. Paul, W. I. McDonald, J. R. Batchelor, C. A. Mims. 1986. Viral infection in patients with multiple sclerosis and HLA-DR matched controls. Brain 109:325.[Abstract/Free Full Text]
  29. Ehl, S., J. Hombach, P. Aichele, T. Rulicke, B. Odermatt, H. Hengartner, R. Zinkernagel, H. Pircher. 1998. Viral and bacterial infections interfere with peripheral tolerance induction and activate CD8+ T cells to cause immunopathology. J. Exp. Med. 187:763.[Abstract/Free Full Text]
  30. Rocken, M., J. F. Urban, E. M. Shevach. 1992. Infection breaks T-cell tolerance. Nature 359:79.[Medline]
  31. Tsunoda, I., N. D. Tolley, D. J. Theil, J. L. Whitton, H. Kobayashi, R. S. Fujinami. 1999. Exacerbation of viral and autoimmune animal models for multiple sclerosis by bacterial DNA. Brain Pathol. 9:481.[Medline]
  32. Sparwasser, T., E. S. Koch, R. M. Vabulas, K. Heeg, G. B. Lipford, J. W. Ellwart, H. Wagner. 1998. Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur. J. Immunol. 28:2045.[Medline]
  33. Bauer, M., V. Redecke, J. W. Ellwart, B. Scherer, J. P. Kremer, H. Wagner, G. B. Lipford. 2001. Bacterial CpG-DNA triggers activation and maturation of human CD11c-CD123+ dendritic cells. J. Immunol. 166:5000.[Abstract/Free Full Text]
  34. Bennett, S. R., F. R. Carbone, F. Karamalis, R. A. Flavell, J. F. Miller, W. R. Heath. 1998. Help for cytotoxic-T-cell responses is mediated by CD40 signalling. Nature 393:478.[Medline]
  35. Ridge, J. P., F. Di Rosa, P. Matzinger. 1998. A conditioned dendritic cell can be a temporal bridge between a CD4+ T-helper and a T-killer cell. Nature 393:474.[Medline]
  36. Schoenberger, S. P., R. E. Toes, E. I. van der Voort, R. Offringa, C. J. Melief. 1998. T-cell help for cytotoxic T lymphocytes is mediated by CD40-CD40L interactions. Nature 393:480.[Medline]
  37. Chace, J. H., N. A. Hooker, K. L. Mildenstein, A. M. Krieg, J. S. Cowdery. 1997. Bacterial DNA-induced NK cell IFN-{gamma} production is dependent on macrophage secretion of IL-12. Clin. Immunol. Immunopathol. 84:185.[Medline]
  38. Cella, M., D. Scheidegger, K. Palmer-Lehmann, P. Lane, A. Lanzavecchia, G. Alber. 1996. Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation. J. Exp. Med. 184:747.[Abstract/Free Full Text]
  39. Halpern, M. D., R. J. Kurlander, D. S. Pisetsky. 1996. Bacterial DNA induces murine interferon-{gamma} production by stimulation of interleukin-12 and tumor necrosis factor-{alpha}. Cell Immunol. 167:72.[Medline]
  40. Koch, F., U. Stanzl, P. Jennewein, K. Janke, C. Heufler, E. Kampgen, N. Romani, G. Schuler. 1996. High level IL-12 production by murine dendritic cells: upregulation via MHC class II and CD40 molecules and downregulation by IL-4 and IL-10. J. Exp. Med. 184:741.[Abstract/Free Full Text]
  41. Klinman, D. M., A. K. Yi, S. L. Beaucage, J. Conover, A. M. Krieg. 1996. CpG motifs present in bacteria DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon {gamma}. Proc. Natl. Acad. Sci. USA 93:2879.[Abstract/Free Full Text]
  42. Shu, U., M. Kiniwa, C. Y. Wu, C. Maliszewski, N. Vezzio, J. Hakimi, M. Gately, G. Delespesse. 1995. Activated T cells induce interleukin-12 production by monocytes via CD40-CD40 ligand interaction. Eur. J. Immunol. 25:1125.[Medline]
  43. Constantinescu, C. S., B. Hilliard, M. Wysocka, E. S. Ventura, M. K. Bhopale, G. Trinchieri, A. M. Rostami. 1999. IL-12 reverses the suppressive effect of the CD40 ligand blockade on experimental autoimmune encephalomyelitis (EAE). J. Neurol. Sci. 171:60.[Medline]
  44. Leonard, J. P., K. E. Waldburger, S. J. Goldman. 1995. Prevention of experimental autoimmune encephalomyelitis by antibodies against interleukin 12. J. Exp. Med. 181:381.[Abstract/Free Full Text]
  45. Segal, B. M., E. M. Shevach. 1996. IL-12 unmasks latent autoimmune disease in resistant mice. J. Exp. Med. 184:771.[Abstract/Free Full Text]
  46. Segal, B. M., D. M. Klinman, E. M. Shevach. 1997. Microbial products induce autoimmune disease by an IL-12-dependent pathway. J. Immunol. 158:5087.[Abstract]
  47. Segal, B. M., B. K. Dwyer, E. M. Shevach. 1998. An interleukin (IL)-10/IL-12 immunoregulatory circuit controls susceptibility to autoimmune disease. J. Exp. Med. 187:537.[Abstract/Free Full Text]
  48. Segal, B. M., J. T. Chang, E. M. Shevach. 2000. CpG oligonucleotides are potent adjuvants for the activation of autoreactive encephalitogenic T cells in vivo. J. Immunol. 164:5683.[Abstract/Free Full Text]
  49. Trembleau, S., T. Germann, M. K. Gately, L. Adorini. 1995. The role of IL-12 in the induction of organ-specific autoimmune diseases. Immunol. Today 16:383.[Medline]
  50. Waldburger, K. E., R. C. Hastings, R. G. Schaub, S. J. Goldman, J. P. Leonard. 1996. Adoptive transfer of experimental allergic encephalomyelitis after in vitro treatment with recombinant murine interleukin-12: preferential expansion of interferon-{gamma}-producing cells and increased expression of macrophage-associated inducible nitric oxide synthase as immunomodulatory mechanisms. Am. J. Pathol. 148:375.[Abstract]
  51. Marusic, S., S. Tonegawa. 1997. Tolerance induction and autoimmune encephalomyelitis amelioration after administration of myelin basic protein-derived peptide. J. Exp. Med. 186:507.[Abstract/Free Full Text]
  52. Gaur, A., B. Wiers, A. Liu, J. Rothbard, C. G. Fathman. 1992. Amelioration of autoimmune encephalomyelitis by myelin basic protein synthetic peptide-induced anergy. Science 258:1491.[Abstract/Free Full Text]
  53. Chu, R. S., O. S. Targoni, A. M. Krieg, P. V. Lehmann, C. V. Harding. 1997. CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. J. Exp. Med. 186:1623.[Abstract/Free Full Text]
  54. Rolink, A., F. Melchers, J. Andersson. 1996. The SCID but not the RAG-2 gene product is required for Sµ-S{epsilon} heavy chain class switching. Immunity 5:319.[Medline]
  55. Miller, S. D., C. L. Vanderlugt, D. J. Lenschow, J. G. Pope, N. J. Karandikar, M. C. Dal Canto, J. A. Bluestone. 1995. Blockade of CD28/B7-1 interaction prevents epitope spreading and clinical relapses of murine EAE. Immunity 3:739.[Medline]
  56. Perrin, P. J., C. H. June, J. H. Maldonado, R. B. Ratts, M. K. Racke. 1999. Blockade of CD28 during in vitro activation of encephalitogenic T cells or after disease onset ameliorates experimental autoimmune encephalomyelitis. J. Immunol. 163:1704.[Abstract/Free Full Text]
  57. Lenschow, D. J., T. L. Walunas, J. A. Bluestone. 1996. CD28/B7 system of T cell costimulation. Annu. Rev. Immunol. 14:233.[Medline]
  58. Ratts, R. B., L. R. Arredondo, P. Bittner, P. J. Perrin, A. E. Lovett-Racke, M. K. Racke. 1999. The role of CTLA-4 in tolerance induction and T cell differentiation in experimental autoimmune encephalomyelitis: i.p. antigen administration. Int. Immunol. 11:1881.[Abstract/Free Full Text]
  59. Albert, M. L., M. Jegathesan, R. B. Darnell. 2001. Dendritic cell maturation is required for the cross-tolerization of CD8+ T cells. Nat. Immunol. 2:1010.[Medline]
  60. Matzinger, P.. 1994. Tolerance, danger, and the extended family. Annu. Rev. Immunol. 12:991.[Medline]
  61. Rapp, N. S., J. Gilroy, A. M. Lerner. 1995. Role of bacterial infection in exacerbation of multiple sclerosis. Am. J. Physiol. 74:415.
  62. Buljevac, D., H. Z. Flach, W. C. Hop, D. Hijdra, J. D. Laman, H. F. Savelkoul, F. G. van Der Meche, P. A. van Doorn, R. Q. Hintzen. 2002. Prospective study on the relationship between infections and multiple sclerosis exacerbations. Brain 125:952.[Abstract/Free Full Text]
  63. Edwards, S., M. Zvartau, H. Clarke, W. Irving, L. D. Blumhardt. 1998. Clinical relapses and disease activity on magnetic resonance imaging associated with viral upper respiratory tract infections in multiple sclerosis. J. Neurol. Neurosurg. Psychiatry 64:736.[Abstract/Free Full Text]
  64. Goverman, J., A. Woods, L. Larson, L. P. Weiner, L. Hood, D. M. Zaller. 1993. Transgenic mice that express a myelin basic protein-specific T cell receptor develop spontaneous autoimmunity. Cell 72:551.[Medline]
  65. Zhang, G. X., H. Xu, M. Kishi, D. Calida, A. Rostami. 2002. The role of IL-12 in the induction of intravenous tolerance in experimental autoimmune encephalomyelitis. J. Immunol. 168:2501.[Abstract/Free Full Text]
  66. Van Parijs, L., V. L. Perez, A. Biuckians, R. G. Maki, C. A. London, A. K. Abbas. 1997. Role of interleukin 12 and costimulators in T cell anergy in vivo. J. Exp. Med. 186:1119.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Exp. Med.Home page
M. A. Kroenke, T. J. Carlson, A. V. Andjelkovic, and B. M. Segal
IL-12- and IL-23-modulated T cells induce distinct types of EAE based on histology, CNS chemokine profile, and response to cytokine inhibition
J. Exp. Med., July 7, 2008; 205(7): 1535 - 1541.
[Abstract] [Full Text] [PDF]

Home page
 Proc Am Thorac SocHome page
A. M. Krieg
Antiinfective Applications of Toll-like Receptor 9 Agonists
Proceedings of the ATS, July 1, 2007; 4(3): 289 - 294.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. P. Sanderson, D. J. Naisbitt, J. Farrell, C. A. Ashby, M. J. Tucker, M. J. Rieder, M. Pirmohamed, S. E. Clarke, and B. K. Park
Sulfamethoxazole and Its Metabolite Nitroso Sulfamethoxazole Stimulate Dendritic Cell Costimulatory Signaling
J. Immunol., May 1, 2007; 178(9): 5533 - 5542.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C. Bartholdy, S. O. Kauffmann, J. P. Christensen, and A. R. Thomsen
Agonistic Anti-CD40 Antibody Profoundly Suppresses the Immune Response to Infection with Lymphocytic Choriomeningitis Virus
J. Immunol., February 1, 2007; 178(3): 1662 - 1670.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. E. Cabbage, E. S. Huseby, B. D. Sather, T. Brabb, D. Liggitt, and J. Goverman
Regulatory T Cells Maintain Long-Term Tolerance to Myelin Basic Protein by Inducing a Novel, Dynamic State of T Cell Tolerance
J. Immunol., January 15, 2007; 178(2): 887 - 896.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
L. Visser, M.-J. Melief, D. van Riel, M. van Meurs, E. A. Sick, S. Inamura, J. J. Bajramovic, S. Amor, R. Q. Hintzen, L. A. Boven, et al.
Phagocytes Containing a Disease-Promoting Toll-Like Receptor/Nod Ligand Are Present in the Brain during Demyelinating Disease in Primates
Am. J. Pathol., November 1, 2006; 169(5): 1671 - 1685.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
R. D. Pawar, P. S. Patole, M. Wornle, and H.-J. Anders
Microbial nucleic acids pay a Toll in kidney disease
Am J Physiol Renal Physiol, September 1, 2006; 291(3): F509 - F516.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
O. Saitoh and Y. Nagayama
Regulation of Graves' Hyperthyroidism with Naturally Occurring CD4+CD25+ Regulatory T Cells in a Mouse Model
Endocrinology, May 1, 2006; 147(5): 2417 - 2422.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
E. D. Ponomarev, L. P. Shriver, and B. N. Dittel
CD40 Expression by Microglial Cells Is Required for Their Completion of a Two-Step Activation Process during Central Nervous System Autoimmune Inflammation
J. Immunol., February 1, 2006; 176(3): 1402 - 1410.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Gregoire, A. S. Bergot, C. Feraudet, C. Carnaud, P. Aucouturier, and M. B. Rosset
The Murine B Cell Repertoire Is Severely Selected against Endogenous Cellular Prion Protein
J. Immunol., November 15, 2005; 175(10): 6443 - 6449.
[Abstract] [Full Text] [PDF]

Home page
 Ann Rheum DisHome page
T R D J Radstake, A W T van Lieshout, P L C M van Riel, W B van den Berg, and G J Adema
Dendritic cells, Fc{gamma} receptors, and Toll-like receptors: potential allies in the battle against rheumatoid arthritis
Ann Rheum Dis, November 1, 2005; 64(11): 1532 - 1538.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
M.-G. de Goer de Herve, D. Durali, T.-A. Tran, G. Maigne, F. Simonetta, P. Leclerc, J.-F. Delfraissy, and Y. Taoufik
Differential effect of agonistic anti-CD40 on human mature and immature dendritic cells: the Janus face of anti-CD40
Blood, October 15, 2005; 106(8): 2806 - 2814.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Nogai, V. Siffrin, K. Bonhagen, C. F. Pfueller, T. Hohnstein, R. Volkmer-Engert, W. Bruck, C. Stadelmann, and T. Kamradt
Lipopolysaccharide Injection Induces Relapses of Experimental Autoimmune Encephalomyelitis in Nontransgenic Mice via Bystander Activation of Autoreactive CD4+ Cells
J. Immunol., July 15, 2005; 175(2): 959 - 966.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
Y. Li, J. S. Heuser, S. D. Kosanke, M. Hemric, and M. W. Cunningham
Protection against Experimental Autoimmune Myocarditis Is Mediated by Interleukin-10-Producing T Cells that Are Controlled by Dendritic Cells
Am. J. Pathol., July 1, 2005; 167(1): 5 - 15.
[Abstract] [Full Text] [PDF]

Home page
 LupusHome page
H-J Anders
A Toll for lupus
Lupus, June 1, 2005; 14(6): 417 - 422.
[Abstract] [PDF]

Home page
 J. Immunol.