|
|
||||||||

,
Departments of
* Microbiology and Immunology and
Environmental Medicine and
James P. Wilmot Cancer Center, University of Rochester, Rochester, NY 14642; and
Medical Research Council, Reproduction Biology Unit, Center for Reproductive Biology, Edinburgh, United Kingdom
| Abstract |
|---|
|
|
|---|
B. 3O-C12-HSL also stimulated an increase in
the newly discovered inducible membrane-associated PGE synthase but had
no effect on the expression of the cytosolic PGE synthase. We also
demonstrate that 3O-C12-HSL stimulated the production of
PGE2. PGE2 is known to induce mucus secretion,
vasodilation, and edema, and acts as an immunomodulatory lipid
mediator. We propose that 3O-C12-HSL induction of Cox-2,
membrane-associated PGE synthase, and PGE2 likely
contributes to the inflammation and lung pathology induced by P.
aeruginosa infections in the lung. These studies further
reinforce the concept that bacterial AHLs not only regulate bacterial
virulence but also stimulate the activities of eukaryotic cells
important for inflammation and immune defenses. | Introduction |
|---|
|
|
|---|
Recently, it has become apparent that 3O-C12-HSL
is not only important in the regulation of bacterial virulence genes
but can also interact with eukaryotic cells and stimulate an immune
response. 3O-C12-HSL stimulation of human lung
structural cells, such as fibroblasts and bronchial epithelial cells,
induces production of the chemokine IL-8 (9, 10). This
induction of IL-8 is regulated by the activation of a mitogen-activated
protein kinase pathway that subsequently leads to the induction of the
transcription factor NF-
B (10). When human lung cells
were stimulated with other AHLs there was no induction in IL-8,
indicating that this induction was structurally specific (9, 10). 3O-C12-HSL also activates classic
immune cells. For example, when LPS-activated mouse peritoneal exudate
cells were cultured with 3O-C12-HSL, there was a
significant inhibition in the production of the cytokine IL-12
(11). 3O-C12-HSL was also recently
shown to directly stimulate T cells to produce the cytokine IFN-
(12). These data demonstrate that
3O-C12-HSL is a potent activator of multiple
different eukaryotic cells and that the production of
3O-C12-HSL by P. aeruginosa may
greatly affect its ability to cause disease.
The initial steps in PG production involve the release of arachidonic
acid from the plasma membrane of cells by phospholipases. Arachidonic
acid is then converted to PGH2 by the enzyme
cyclooxygenase (Cox), also called PGH synthase. There are two known
isoforms of Cox, Cox-1 and Cox-2 (13). Cox-1 is
constitutively expressed in most tissues and is thought to be
responsible for physiological functions such as platelet aggregation
and renal function (14, 15). Cox-2 is usually only
expressed when induced by bacterial products or cytokines. The
induction of Cox-2 production is an early hallmark of inflammation. The
overexpression of Cox-2 leads to the enhanced production of PGs.
Inhibition of Cox-2 with selective inhibitors reduces inflammation,
fever, pain, and possibly certain cancers (16).
PGH2 produced by Cox is further converted to one
of many prostanoids by specific synthases. PGE synthase (PGES) is the
terminal step in the conversion of PGH2 to
PGE2. There are two known isoforms of PGES, a
constitutive cytosolic PGES (cPGES) and an inducible
membrane-associated PGES (mPGES) (17). Recent evidence
indicates that the mPGES is linked to the Cox-2 enzyme and that the
cPGES is linked to the Cox-1 enzyme (18, 19). These data
support the concept that induction of Cox-2 leads to increased
production of PGE2. PGE2
has been shown to cause fever and permeability of vascular endothelium,
enhance mucus secretion, and induce pain (20).
PGE2 also synergizes with IL-8 to enhance
neutrophil migration (21). It also acts as an
immunoregulator by inhibiting IL-12 production, a cytokine that
stimulates T cells to produce IFN-
. Therefore, the production of
PGE2 skews the immune response by promoting
type-2 responses (e.g., IL-4 production) at the expense of type-1
responses (e.g., IFN-
production) (22).
PGE2 also has anti-inflammatory effects in
the lung. In asthmatic patients PGE2 inhibits the
release of mediators from mast cells and migration of eosinophils and
induces bronchodilation (23). These data indicate that
PGE2 is a potent molecule that affects multiple
functions in the body and thus its production may have substantial
effects on the pathogenesis of P. aeruginosa.
The ability of 3O-C12-HSL to regulate Cox-2 and PGs in human cells is the focus of this study. In mouse pneumonia and thermal injury models, it has been demonstrated that P. aeruginosa are potent inducers of PGE2 (24, 25). In this manuscript we demonstrate that the P. aeruginosa quorum sensing molecule 3O-C12-HSL is a potent inducer of Cox-2 and PGE2 production in human lung fibroblasts.
| Materials and Methods |
|---|
|
|
|---|
3O-C12-HSL and
C4-HSL are organically synthesized in our
laboratory as previously described (3, 4). These molecules
are structurally and functionally identical to the natural molecule
produced by P. aeruginosa. Each lot of
3O-C12-HSL and C4-HSL is
shown to be pure by HPLC. No detectable levels of endotoxin were found
in preparations of AHLs using a Limulus amebocyte lysate
assay (Cape Cod Associates, Falmouth, MA). SC58125, a Cox-2 selective
inhibitor (26), was a gift from Dr. P. Isakson (Searle,
Skokie, IL). Indomethacin, a general Cox inhibitor, was obtained from
Sigma-Aldrich (St. Louis, MO). SN50, a NF-
B inhibitor peptide, and
SN50 M, a mutated control peptide, were obtained from Biomol (Plymouth
Meeting, PA).
Cell culture
L828s are a normal, nontransformed human lung fibroblast strain previously isolated in our laboratory (27). These cells were maintained in MEM (Life Technologies, Gaithersburg, MD) supplemented with 10% FBS (HyClone Laboratories, Logan, UT) and 50 U/ml gentamicin (Life Technologies). Cells were passaged every 45 days using 0.05% trypsin with 0.1% EDTA to dissociate adherent cells. Fibroblasts were used between passages 5 and 15.
RNA isolation and quantification
L828 cells were grown in six-well plates until confluent
(
5 x 105 cells/well). Cells were serum
starved for 18 h before stimulation with a titration of
3O-C12-HSL. Cells were stimulated for various
times and RNA was extracted with TriReagent (Molecular Research Center,
Cincinnati, OH) as per manufacturers procedures. cDNA was prepared
from RNA using reverse transcriptase and random hexamers (PE Applied
Biosystems, Foster City, CA). Cox-1 primers (forward,
TGTTCGGTGTCCAGTTCCAATA; reverse, ACCTTGAAGGAGTCAGGCATGAG) and probe
CGCAACCGCATTGCCATGGAGT, and the Cox-2 primers (forward,
GTGTTGACATCCAGATCACATTTGA; reverse, GAGAAGGCTTCCCAGCTTTTGTA)
and probe TGACAGTCCACCAACTTACAATGCTGACTATGG were used to amplify DNA
templates in a TaqMan 7700 (PE Applied Biosystems) using
FAM/TAMRA dyes for the probes. The probe for cox-2 spans the
junction between exons 3 and 4 of the cox-2 gene
(i.e., it straddles the third intron); therefore, there is no chance
that there was any interference from genomic DNA. Ribosomal (18S) RNA
was amplified and used as a control. After 40 cycles the
Ct (related to the cycle number at
which signal appears) for the cox RNA (FAM signal) and the
18S were recorded. The absolute relative quantitation was achieved
using the formula 2-DDCt, which relates the amount of Cox cDNA to the
18S internal control and a standard cox reference cDNA
derived from U937 monocytes.
Protein isolation and Western blot analysis
Cells were cultured as described above and then extracted with cold lysis buffer (150 mM NaCl, 50 mM Tris (pH 8), 1 mM EDTA, 1% IGEPAL (Sigma-Aldrich), and 10% protease inhibitor mixture (Sigma-Aldrich)). Protein extracts were quantified using the bicinchoninic acid assay (Pierce, Rockford, IL). Total protein was resolved on 10% SDS-PAGE gels and transferred to nitrocellulose membranes (Amersham Pharmacia Biotech, Piscataway, NJ). Nonspecific binding was blocked by incubating the blots with 10% skim milk in PBS with 0.1% Tween 20 for 2 h at room temperature. Immunoreactive proteins were detected by incubating the blots with mouse anti-human Cox-1 or Cox-2 Abs or with rabbit anti-human PGES Abs (Cayman Chemical, Ann Arbor, MI) overnight at 4°C. Between each step the nitrocellulose was washed three times for 5 min with PBS/0.1% Tween 20. Bound Abs were detected with an anti-mouse IgG or anti-rabbit IgG conjugated to HRP (Santa Cruz Biotechnology, Santa Cruz, CA). Specific bands were visualized when nitrocellulose blots were incubated with ECL reagents (Amersham Pharmacia Biotech) and exposed to Kodak X-OMAT film (Kodak, Rochester, NY).
Immunocytochemistry
L828 fibroblasts were grown in eight-well Permanox chamber
slides (Nalge Nunc, Naperville, IL) at a density of 2 x
104 cells per well. Cells were serum starved for
24 h before incubation with medium only or with a titration of
3O-C12-HSL for 24 h. Cells were washed twice
with PBS plus 0.05% Tween 20 and endogenous peroxidase activity was
quenched by incubation with 3%
H2O2 for 10 min. Cells were
blocked with 5% horse serum for 1 h at room temperature before
overnight incubation at 4°C with 10 µg/ml mouse anti-human
Cox-1 or Cox-2 Abs or an isotype control mouse IgG2b or IgG1 Ab (Caltag
Laboratories, Burlingame, CA). Between each step cells were washed
three times with PBS containing 0.05% Tween 20. Cells were incubated
at room temperature for 1 h with a 1/200 dilution of a
biotin-labeled anti-mouse IgG secondary Ab (Vector Laboratories,
Burlingame, CA). Streptavidin HRP (Jackson ImmunoResearch Laboratories,
West Grove, PA), at a 1/1000 dilution in PBS, was incubated with cells
for 1 h at room temperature. Aminoethyl carbazole (Zymed
Laboratories, South San Francisco, CA), which reacts with the bound HRP
to form a red precipitate that can be visualized in the cells, was
added for 30 min at room temperature. Cells were counterstained with
hematoxylin and mounted with Immunomount (Sigma-Aldrich). In
experiments examining the role of NF-
B, cells were incubated with 50
µM SN50 (NF-
B inhibitor) or SN50 M (mutant inhibitor) for 1 h
before stimulation with 100 µM 3O-C12-HSL. For
NF-
B mobilization studies cells were stimulated for 2 h with
100 µM 3O-C12-HSL and then stained with 2
µg/ml of an anti-NF-
B p65 Ab (Santa Cruz Biotechnology) as
previously described (10).
PGE2 measurements
L828 cells were grown in 96-well plates at 2 x 104 cells/well. After 2 days of culture, at which point the cells were confluent, they were serum starved for 24 h. Cells were then stimulated for 24 h with a titration of 3O-C12-HSL. Culture supernatants were collected and assayed for PGE2 content by an enzyme immunoassay (Cayman Chemical). Some wells were cocultured with 20 µM indomethacin or 5 µM SC58125.
Statistics
A Wilcoxon signed rank test was used to determine statistical significance. Error bars indicate the SD of the mean.
| Results |
|---|
|
|
|---|
L828 fibroblasts were stimulated with 1100 µM
3O-C12-HSL and RNA extracts were examined using
real-time RT-PCR. Increases in steady-state Cox-2 mRNA levels occurred
as early as 4 h after stimulation with a maximal induction at
8 h. This maximal induction was 8-fold over that found in
nonstimulated fibroblasts (Fig. 1
). After
8 h of stimulation, Cox-2 mRNA levels decreased and returned to
that of nonstimulated cells. The optimal concentration of
3O-C12-HSL that consistently induced significant
Cox-2 mRNA expression was 100 µM. 3O-C12-HSL
stimulation had no significant effect on the level of Cox-1 mRNA, which
was constitutively expressed at very low levels in these cells
(Fig. 1
).
|
Production of Cox-1 protein in L828 lung fibroblasts was found to
be constitutive in nonstimulated cells and, when cells were cultured
with increasing amounts of 3O-C12-HSL, there was
no significant change in the amount of Cox-1 protein expressed (Fig. 2
). In contrast, Western blots for Cox-2
protein demonstrated that there was no expression in nonstimulated
fibroblasts; however, when they were stimulated with
3O-C12-HSL there was a significant induction in
Cox-2 protein. Stimulation with 110 µM
3O-C12-HSL induced a 2- to 5-fold increase in
Cox-2 protein, whereas stimulation with 100 µM led to a 35-fold
induction (Fig. 2
). Cells were also stimulated with
3O-C12-HSL and then stained with anti-human
Cox Abs to demonstrate Cox-1 and Cox-2 expression in individual
fibroblasts. Similar to what was observed in Western blot experiments,
nonstimulated L828 fibroblasts constitutively expressed Cox-1 and this
expression was unaffected by 3O-C12-HSL (Fig. 3
). When fibroblasts were stained with an
anti-Cox-2 Ab there was no Cox-2 expression in nonstimulated cells,
but with increasing concentrations of 3O-C12-HSL
the amount of Cox-2 staining also increased. Faint staining for Cox-2
was observed in cells stimulated with 1 µM
3O-C12-HSL, with maximal staining in cells
stimulated with 10 or 100 µM (Fig. 3
). A similar induction in Cox-2
protein expression was found with other human lung fibroblast strains
and with a human bronchial epithelial cell line (data not shown). To
determine whether other AHLs could similarly stimulate an induction of
Cox-2, fibroblasts were cultured with C4-HSL, a
second AHL produced by P. aeruginosa. When 100 µM
C4-HSL was added to L828 fibroblasts there was
only a slight induction in Cox-2 expression, while Cox-1 was
constitutively expressed, even in nonstimulated cells (Fig. 3
). Other
concentrations of C4-HSL were unable to induce
any expression of Cox-2 protein (data not shown). These data indicate
that 3O-C12-HSL induces Cox-2 expression and that
another AHL produced by P. aeruginosa was unable to activate
human lung fibroblasts as effectively.
|
|
B is essential for 3O-C12-HSL induction of Cox-2
The human cox-2 gene contains consensus sequences for
the binding of the transcription factors NF-
B, NF-IL-6, and cAMP
response element (28). In human lung epithelial cells,
Cox-2 induction is primarily mediated by the transcription factor
NF-
B (29). We previously demonstrated that
3O-C12-HSL stimulation of human bronchial
epithelial cells induces NF-
B, which subsequently leads to the
production of the chemokine IL-8 (10). To determine
whether NF-
B also regulates 3O-C12-HSL
induction of Cox-2, specific inhibitors for NF-
B translocation were
used. In nonstimulated lung fibroblasts NF-
B is found sequestered in
the cytoplasm in an inactive state by the I
B inhibitory proteins.
When cells become activated by an inflammatory signal, I
B proteins
are phosphorylated and degraded, allowing the translocation of NF-
B
to the nucleus and gene transcription. A cell-permeable peptide (SN50)
that contains the nuclear translocation sequence for NF-
B was used
to inhibit NF-
B activity. This peptide has been shown to
specifically inhibit nuclear translocation of NF-
B and thus inhibit
its ability to induce the transcription of genes (30, 31).
In nonstimulated L828 fibroblasts, NF-
B staining was found only in
the cytoplasm, but when the fibroblasts were stimulated with
3O-C12-HSL, NF-
B staining was also found in
the nucleus (Fig. 4
). The addition of the
peptide inhibitor SN50 to cultures blocked
3O-C12-HSL-induced translocation, but when SN50M,
a peptide that contains a mutation in the nuclear translocation
sequence, was added to 3O-C12-HSL-stimulated
cultures there was no effect on NF-
B translocation (Fig. 4
). Having
shown that 3O-C12-HSL induced the translocation
of NF-
B in these cells and that SN50 inhibited this induction, we
next wanted to examine what effect this induction had on Cox-2
production. When SN50 was added with 3O-C12-HSL
to L828 cultures and the cells were stained with an anti-Cox-2 Ab,
it was observed that there was a substantial decrease in expression of
Cox-2 protein. The addition of the mutant peptide SN50 M to cultures
stimulated with 3O-C12-HSL resulted in no effect
on Cox-2 induction (Fig. 4
). As a control, fibroblasts were also
cultured with SN50 or SN50 M, and in the absence of stimulation there
was no effect on NF-
B or Cox-2 expression (data not shown). These
data indicate that the induction of NF-
B by
3O-C12-HSL is essential for the production of
Cox-2 in these cells.
|
PGH2 produced by Cox is converted to various
PGs by specific PG synthases. There are two forms of PGES, a cytosolic
(cPGES) and a microsomal (mPGES) synthase. Recent data have
demonstrated that, in human lung epithelial cells stimulated with IL-1,
Cox-2 and mPGES were coordinately regulated (32). To
determine whether 3O-C12-HSL up-regulates the
expression of PGES, L828 fibroblasts were stimulated with 100 µM
3O-C12-HSL for varying times, and Western blots
for Cox-2, cPGES, or mPGES were done. These experiments demonstrated
that mPGES was not expressed in nonstimulated cells but was induced as
early as 8 h after 3O-C12-HSL stimulation.
Expression of mPGES continued to increase even after 96 h
of stimulation. When these samples were examined for Cox-2 expression,
it was observed that Cox-2 was induced earlier than mPGES. As
previously shown, Cox-2 protein was not expressed in nonstimulated
cells but induction occurred after 4 h of stimulation with
3O-C12-HSL and maximal expression occurred after
8 h. By 48 h Cox-2 expression had returned to background
levels (Fig. 5
). Although mPGES was
induced with 3O-C12-HSL stimulation, cPGES was
constitutively expressed in L828 fibroblasts and was not significantly
affected by stimulation with 3O-C12-HSL
(Fig. 5
).
|
Having demonstrated that 3O-C12-HSL
increased the expression of both Cox-2 and mPGES, we next wanted to
determine whether PGE2 levels were also
increased. When L828 lung fibroblasts were cultured with a titration of
3O-C12-HSL, a significant amount of
PGE2 could be measured in culture supernatants.
Although 50 µM 3O-C12-HSL stimulated a
statistically significant induction in PGE2, the
100 µM concentration induced an 8-fold induction over that of
untreated cells (Fig. 6
A). The
addition of exogenous arachidonic acid, the substrate for Cox
production of PGH2, to cultures did not enhance
the production of PGE2 with
3O-C12-HSL stimulation (data not shown). These
data indicate that the availability of arachidonic acid in L828
fibroblasts is not a limiting step in the production of
PGE2 with 3O-C12-HSL
stimulation. When cells were cocultured with 20 µM indomethacin, an
inhibitor of both Cox-1 and 2 activities, or 5 µM SC58125, a Cox-2
selective inhibitor, the amount of PGE2 produced
was reduced to background levels (Fig. 6
B). Because the
inhibition found with the Cox-2 selective inhibitor was similar to that
found with the general Cox inhibitor, indomethacin, these data indicate
that the production of PGE2 with
3O-C12-HSL stimulation occurs through the
induction of Cox-2.
|
| Discussion |
|---|
|
|
|---|
Sputum from P. aeruginosa-colonized patients contains
transcripts for quorum sensing genes as well as quorum sensing
regulated genes (35, 36). More recently it was shown that
3O-C12-HSL and C4-HSL could
be detected in the sputum of CF patients colonized with P.
aeruginosa (36). These data indicate that P.
aeruginosa produces 3O-C12-HSL in vivo,
which actively regulates many bacterial virulence genes. Because
3O-C12-HSL is both diffused and pumped out of
P. aeruginosa, it directly interacts with surrounding
eukaryotic cells (5). In studies examining the
colonization of squid light organs with the bacteria Vibrio
fischeri, which produces an AHL similar to
3O-C12-HSL, it was observed that the AHL not only
was located around the bacteria but had penetrated into the epithelial
layer of the light organ (37). We propose that
3O-C12-HSL produced by P. aeruginosa
may have a similar interaction with the epithelium of the lung. Also
during chronic P. aeruginosa infections there is destruction
of the lung epithelium that exposes the underlying fibroblasts. These
data indicate that 3O-C12-HSL would be in direct
contact with fibroblasts during P. aeruginosa infections. It
has been shown that biofilms of P. aeruginosa grown in vitro
can produce
600 µM 3O-C12-HSL, a
concentration that is significantly higher than what has previously
been measured in planktonic cultures (15 µM) (38).
This level of 3O-C12-HSL production is well above
the concentrations needed to induce Cox-2 and
PGE2 expression in vitro (10100 µM).
One of the hallmarks of an aggressive infection in a CF patient is the
progressive inflammation that occurs. It is the overzealous induction
of this inflammatory response that leads to extensive tissue
destruction and ultimately pulmonary failure. Inflammation and
production of inflammatory mediators, such as IL-8, are directly
correlated to the presence of P. aeruginosa in the lungs of
CF patients (39). Sputum samples from P.
aeruginosa-colonized CF patients contain increased amounts of PGs
(40, 41). In this manuscript, we demonstrated that
3O-C12-HSL produced by P. aeruginosa
induced the expression of Cox-2 and mPGES and the production of
PGE2. PGE2 stimulates mucus
secretion and edema, characteristics commonly found in the CF lung
(20). It also synergizes with the chemokine IL-8 to
enhance migration of neutrophils (21). High numbers of
neutrophils in the lung of a CF patient are associated with excessive
inflammation and indicative of a poor prognosis.
PGE2 is a potent inhibitor of IL-12 and IFN-
production and thus stimulates a type-2 phenotype in T cells
(22). In studies with LPS-activated mouse peritoneal
exudate cells, 3O-C12-HSL inhibited the
production of IL-12 (11). Although these investigators did
not measure PGE2 production in their studies, we
speculate that the inhibition of IL-12 in these cells was due to
3O-C12-HSL induction of
PGE2.
In burn wounds, colonization with P. aeruginosa results in a significant increase in both Cox-2 and PGE2 production (25). Inhibition of PGE2 production with Cox-2 selective drugs prevented P. aeruginosa dissemination from the wound site and resulted in decreased sepsis and mortality (42). Additional studies using the burn wound model of P. aeruginosa infection in mice demonstrated that quorum sensing mutants that do not produce 3O-C12-HSL were unable to disseminate and cause mortality (43). These data support the conclusion that production of 3O-C12-HSL by P. aeruginosa and its subsequent induction of Cox-2 and PGE2 are essential for the bacteria to disseminate and cause mortality. When mice were given lung infections by exposing them to aerosolized P. aeruginosa, there was a significant induction of PGE2 and lung pathology. When these animals were treated with ibuprofen, a general Cox inhibitor, before infection, there was a decrease in both lung inflammation and PGE2 levels (24). A similar inhibition was observed in ibuprofen-treated rats that had chronic P. aeruginosa infections (44). Collectively these data indicate that infections with P. aeruginosa result in increases in Cox-2 and PGE2 expression and that when Cox inhibitors are used the pathogenesis of the organism is diminished.
In clinical trials, where CF patients were treated with ibuprofen (a general Cox-1 and Cox-2 inhibitor), the results were mixed. Although these patients showed some improvement in lung function, the ibuprofen treatments had no effect on the bacterial burden found in these patients (45, 46, 47). However, the improvements found with ibuprofen treatment warrant addition clinical trials with both general Cox inhibitors as well as new Cox-2 selective drugs (which would have fewer side effects, e.g., gastric irritation) with or without cotreatment with antibiotics.
A novel finding reported herein was that
3O-C12-HSL stimulation increased the expression
of mPGES in human lung fibroblasts (Fig. 5
). The sequential induction
of both Cox-2 and mPGES resulted in a significant increase in the
production of PGE2 found in concert with
3O-C12-HSL stimulation (Fig. 6
). The induction of
Cox-2 was found to occur more quickly and expression was more ephemeral
than that found with mPGES (Fig. 5
). This sequential regulation of
these enzymes is most likely a method of controlling the levels of
PGE2 production. Stimulation of orbital
fibroblasts with IL-1
also induced similar sequential expression of
Cox-2 and mPGES (48). We also demonstrated that cPGES and
Cox-1 were not induced with 3O-C12-HSL
stimulation. Recent data have demonstrated that cPGES is functionally
linked to Cox-1 while mPGES is associated with Cox-2 (18, 19). Although we do not discount the role of Cox-1 and cPGES in
the production of PGE2, our data would indicate
that 3O-C12-HSL induction of
PGE2 is acting predominately through the
induction of Cox-2 and mPGES. Having demonstrated that both Cox-2 and
mPGES are induced with 3O-C12-HSL stimulation,
inhibition of these enzymes may be important in regulating the
inflammation that occurs with P. aeruginosa infections.
Drugs that inhibit the various PG synthases are not yet available, but
are novel targets for therapeutics treating inflammation. The use of
such drugs in the future may be important in the regulation of P.
aeruginosa inflammation. We also demonstrated that
3O-C12-HSL induction of Cox-2 was regulated by
the activation of the transcription factor NF-
B (Fig. 4
).
Previously, we demonstrated that activation of NF-
B was essential
for 3O-C12-HSL induction of the chemokine IL-8
(10). Because NF-
B is pivotal in the production of both
IL-8 and PGE2 during P. aeruginosa
infections, this transcription factor should be an attractive target
for anti-inflammatory therapy. Blocking the activation of the
NF-
B transcription factor may prevent the early induction of IL-8
and PGE2 and thus decrease the inflammation
induced by P. aeruginosa infections.
In conclusion, 3O-C12-HSL is not only essential
in the regulation of several bacterial virulence factors but also
induces key early events in human inflammation, namely the induction of
Cox-2, mPGES, and PGE2. The Cox-2 product
PGE2 likely regulates aspects of innate immunity
(e.g., edema and neutrophil migration) and inducible immunity
(inhibition of IL-12 and IFN-
) that influence the immune response to
P. aeruginosa.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Richard P. Phipps, University of Rochester School of Medicine and Dentistry, Environmental Health Sciences Center, Box 850, 601 Elmwood Avenue, Rochester, NY 14642. E-mail address: richard_phipps{at}urmc.rochester.edu ![]()
3 Abbreviations used in this paper: CF, cystic fibrosis; AHL, acylated homoserine lactone; Cox, cyclooxygenase; 3O-C12-HSL, N-(3-oxododecanoyl) homoserine lactone; C4-HSL, butyryl homoserine lactone; PGES, PGE synthase; mPGES, membrane-associated PGES; cPGES, cytosolic PGES. ![]()
Received for publication January 4, 2002. Accepted for publication June 18, 2002.
| References |
|---|
|
|
|---|
factor RpoS. Mol. Microbiol. 21:1137.[Medline]
B and activator protein-2. J. Immunol. 167:366.
-induced cyclooxygenase-2 expression in human lung epithelial cells: involvement of the phospholipase C-
2, protein kinase C-
, tyrosine kinase, NF-
B-inducing kinase, and I-
B kinase 1/2 pathway. J. Immunol. 165:2719.
B by a synthetic peptide containing a cell membrane-permeable motif and nuclear localization sequence. J. Biol. Chem. 270:14255.
B in human fibroblasts: role in integrin
2 gene expression and tissue remodeling. J. Cell Biol. 140:709.
in human orbital fibroblasts involves coordinate induction of prostaglandin-endoperoxide H synthase-2 and glutathione-dependent prostaglandin E2 synthase expression. J. Biol. Chem. 277:16355.This article has been cited by other articles:
![]() |
M. D. P. Willcox, H. Zhu, T. C. R. Conibear, E. B. H. Hume, M. Givskov, S. Kjelleberg, and S. A. Rice Role of quorum sensing by Pseudomonas aeruginosa in microbial keratitis and cystic fibrosis Microbiology, August 1, 2008; 154(8): 2184 - 2194. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Jahoor, R. Patel, A. Bryan, C. Do, J. Krier, C. Watters, W. Wahli, G. Li, S. C. Williams, and K. P. Rumbaugh Peroxisome Proliferator-Activated Receptors Mediate Host Cell Proinflammatory Responses to Pseudomonas aeruginosa Autoinducer J. Bacteriol., July 1, 2008; 190(13): 4408 - 4415. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Teiber, S. Horke, D. C. Haines, P. K. Chowdhary, J. Xiao, G. L. Kramer, R. W. Haley, and D. I. Draganov Dominant Role of Paraoxonases in Inactivation of the Pseudomonas aeruginosa Quorum-Sensing Signal N-(3-Oxododecanoyl)-L-Homoserine Lactone Infect. Immun., June 1, 2008; 76(6): 2512 - 2519. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Williams Quorum sensing, communication and cross-kingdom signalling in the bacterial world Microbiology, December 1, 2007; 153(12): 3923 - 3938. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Williams, K. Winzer, W. C Chan, and M. Camara Look who's talking: communication and quorum sensing in the bacterial world Phil Trans R Soc B, July 29, 2007; 362(1483): 1119 - 1134. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Manefield and A. S Whiteley Acylated homoserine lactones in the environment: chameleons of bioactivity Phil Trans R Soc B, July 29, 2007; 362(1483): 1235 - 1240. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Stoltz, E. A. Ozer, C. J. Ng, J. M. Yu, S. T. Reddy, A. J. Lusis, N. Bourquard, M. R. Parsek, J. Zabner, and D. M. Shih Paraoxonase-2 deficiency enhances Pseudomonas aeruginosa quorum sensing in murine tracheal epithelia Am J Physiol Lung Cell Mol Physiol, April 1, 2007; 292(4): L852 - L860. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Woolard, J. E. Wilson, L. L. Hensley, L. A. Jania, T. H. Kawula, J. R. Drake, and J. A. Frelinger Francisella tularensis-Infected Macrophages Release Prostaglandin E2 that Blocks T Cell Proliferation and Promotes a Th2-Like Response J. Immunol., February 15, 2007; 178(4): 2065 - 2074. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Gomi, T. Kikuchi, Y. Tokue, S. Fujimura, A. Uehara, H. Takada, A. Watanabe, and T. Nukiwa Mouse and Human Cell Activation by N-Dodecanoyl-DL-Homoserine Lactone, a Chromobacterium violaceum Autoinducer Infect. Immun., December 1, 2006; 74(12): 7029 - 7031. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Miyairi, K. Tateda, E. T. Fuse, C. Ueda, H. Saito, T. Takabatake, Y. Ishii, M. Horikawa, M. Ishiguro, T. J. Standiford, et al. Immunization with 3-oxododecanoyl-L-homoserine lactone-protein conjugate protects mice from lethal Pseudomonas aeruginosa lung infection. J. Med. Microbiol., October 1, 2006; 55(Pt 10): 1381 - 1387. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. V. Kravchenko, G. F. Kaufmann, J. C. Mathison, D. A. Scott, A. Z. Katz, M. R. Wood, A. P. Brogan, M. Lehmann, J. M. Mee, K. Iwata, et al. N-(3-Oxo-acyl)homoserine Lactones Signal Cell Activation through a Mechanism distinct from the Canonical Pathogen-associated Molecular Pattern Recognition Receptor Pathways J. Biol. Chem., September 29, 2006; 281(39): 28822 - 28830. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Imamura, K. Yanagihara, K. Tomono, H. Ohno, Y. Higashiyama, Y. Miyazaki, Y. Hirakata, Y. Mizuta, J.-i. Kadota, K. Tsukamoto, et al. Role of Pseudomonas aeruginosa quorum-sensing systems in a mouse model of chronic respiratory infection J. Med. Microbiol., June 1, 2005; 54(6): 515 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Sadikot, T. S. Blackwell, J. W. Christman, and A. S. Prince Pathogen-Host Interactions in Pseudomonas aeruginosa Pneumonia Am. J. Respir. Crit. Care Med., June 1, 2005; 171(11): 1209 - 1223. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Ritchie, A. Jansson, J. Stallberg, P. Nilsson, P. Lysaght, and M. A. Cooley The Pseudomonas aeruginosa Quorum-Sensing Molecule N-3-(Oxododecanoyl)-L-Homoserine Lactone Inhibits T-Cell Differentiation and Cytokine Production by a Mechanism Involving an Early Step in T-Cell Activation Infect. Immun., March 1, 2005; 73(3): 1648 - 1655. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. B. Rasmussen, T. Bjarnsholt, M. E. Skindersoe, M. Hentzer, P. Kristoffersen, M. Kote, J. Nielsen, L. Eberl, and M. Givskov Screening for Quorum-Sensing Inhibitors (QSI) by Use of a Novel Genetic System, the QSI Selector J. Bacteriol., March 1, 2005; 187(5): 1799 - 1814. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Bjarnsholt, P. O. Jensen, M. Burmolle, M. Hentzer, J. A. J. Haagensen, H. P. Hougen, H. Calum, K. G. Madsen, C. Moser, S. Molin, et al. Pseudomonas aeruginosa tolerance to tobramycin, hydrogen peroxide and polymorphonuclear leukocytes is quorum-sensing dependent Microbiology, February 1, 2005; 151(2): 373 - 383. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Imamura, K. Yanagihara, Y. Mizuta, M. Seki, H. Ohno, Y. Higashiyama, Y. Miyazaki, K. Tsukamoto, Y. Hirakata, K. Tomono, et al. Azithromycin Inhibits MUC5AC Production Induced by the Pseudomonas aeruginosa Autoinducer N-(3-Oxododecanoyl) Homoserine Lactone in NCI-H292 Cells Antimicrob. Agents Chemother., September 1, 2004; 48(9): 3457 - 3461. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Williams, E. K. Patterson, N. L. Carty, J. A. Griswold, A. N. Hamood, and K. P. Rumbaugh Pseudomonas aeruginosa Autoinducer Enters and Functions in Mammalian Cells J. Bacteriol., April 15, 2004; 186(8): 2281 - 2287. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Chun, E. A. Ozer, M. J. Welsh, J. Zabner, and E. P. Greenberg From The Cover: Inactivation of a Pseudomonas aeruginosa quorum-sensing signal by human airway epithelia PNAS, March 9, 2004; 101(10): 3587 - 3590. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Wang, P. P. Cleary, H. Xu, and J.-D. Li Up-Regulation of Interleukin-8 by Novel Small Cytoplasmic Molecules of Nontypeable Haemophilus influenzae via p38 and Extracellular Signal-Regulated Kinase Pathways Infect. Immun., October 1, 2003; 71(10): 5523 - 5530. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tateda, Y. Ishii, M. Horikawa, T. Matsumoto, S. Miyairi, J. C. Pechere, T. J. Standiford, M. Ishiguro, and K. Yamaguchi The Pseudomonas aeruginosa Autoinducer N-3-Oxododecanoyl Homoserine Lactone Accelerates Apoptosis in Macrophages and Neutrophils Infect. Immun., October 1, 2003; 71(10): 5785 - 5793. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Ritchie, A. O. W. Yam, K. M. Tanabe, S. A. Rice, and M. A. Cooley Modification of In Vivo and In Vitro T- and B-Cell-Mediated Immune Responses by the Pseudomonas aeruginosa Quorum-Sensing Molecule N-(3-Oxododecanoyl)-L-Homoserine Lactone Infect. Immun., August 1, 2003; 71(8): 4421 - 4431. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |