The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, R. S.
Right arrow Articles by Phipps, R. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, R. S.
Right arrow Articles by Phipps, R. P.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*BUTYROLACTONE
The Journal of Immunology, 2002, 169: 2636-2642.
Copyright © 2002 by The American Association of Immunologists

The Pseudomonas Autoinducer N-(3-Oxododecanoyl) Homoserine Lactone Induces Cyclooxygenase-2 and Prostaglandin E2 Production in Human Lung Fibroblasts: Implications for Inflammation1

Roger S. Smith*, Rodney Kelly§, Barbara H. Iglewski* and Richard P. Phipps2,*,{dagger},{ddagger}

Departments of * Microbiology and Immunology and {dagger} Environmental Medicine and {ddagger} James P. Wilmot Cancer Center, University of Rochester, Rochester, NY 14642; and § Medical Research Council, Reproduction Biology Unit, Center for Reproductive Biology, Edinburgh, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pseudomonas aeruginosa causes lethal lung infections in immunocompromised individuals such as those with cystic fibrosis. The lethality of these infections is directly associated with inflammation and lung tissue destruction. P. aeruginosa produces several acylated homoserine lactones (AHL) that are important in the regulation of bacterial virulence factors. Little is known about the effects of AHLs on human cells. In this work we report that the AHL N-(3-oxododecanoyl) homoserine lactone (3O-C12-HSL) from P. aeruginosa induces cyclooxygenase (Cox)-2, a seminal proinflammatory enzyme. When primary normal human lung fibroblasts were exposed to 3O-C12-HSL, an 8-fold induction in mRNA and a 35-fold increase in protein for Cox-2 were observed. In contrast, there was no substantial change in the expression of Cox-1. We also demonstrated that the induction of Cox-2 was regulated by 3O-C12-HSL activation of the transcription factor NF-{kappa}B. 3O-C12-HSL also stimulated an increase in the newly discovered inducible membrane-associated PGE synthase but had no effect on the expression of the cytosolic PGE synthase. We also demonstrate that 3O-C12-HSL stimulated the production of PGE2. PGE2 is known to induce mucus secretion, vasodilation, and edema, and acts as an immunomodulatory lipid mediator. We propose that 3O-C12-HSL induction of Cox-2, membrane-associated PGE synthase, and PGE2 likely contributes to the inflammation and lung pathology induced by P. aeruginosa infections in the lung. These studies further reinforce the concept that bacterial AHLs not only regulate bacterial virulence but also stimulate the activities of eukaryotic cells important for inflammation and immune defenses.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The bacterium Pseudomonas aeruginosa causes many infections in humans with altered host defenses. The most prominent and deadly are the pulmonary infections. Patients with cystic fibrosis (CF)3 or HIV or those on mechanical ventilators have increased susceptibility to Pseudomonas lung infections (1). Due to its ubiquitous nature, exposure to P. aeruginosa in the hospital setting is also high, making it one of the more common nosocomial infections (2). Using a mechanism of gene regulation called quorum sensing, P. aeruginosa coordinately turns on and off genes that promote its ability to colonize the host and subvert immune surveillance. Quorum sensing uses the production of acylated homoserine lactones (AHL) to detect bacterial densities. P. aeruginosa predominately produces two AHLs, N-(3-oxododecanoyl) homoserine lactone (3O-C12-HSL; also referred to as PAI-1 or OdDHL) and butyryl homoserine lactone (C4-HSL, also referred to as PAI-2 or BHL) (3, 4). Although both of these AHLs are diffusible in and out of the bacteria, 3O-C12-HSL is also actively pumped out by the MexAB OprM efflux system (5). As the concentration of P. aeruginosa increases, the amount of AHLs in the environment will also increase. When a threshold concentration is reached, the AHLs bind to and activate transcriptional regulators that subsequently turn on and off genes important for virulence and also lead to the increased production of additional AHLs (6, 7). For a complete review of Pseudomonas quorum sensing and virulence see Ref. 8 .

Recently, it has become apparent that 3O-C12-HSL is not only important in the regulation of bacterial virulence genes but can also interact with eukaryotic cells and stimulate an immune response. 3O-C12-HSL stimulation of human lung structural cells, such as fibroblasts and bronchial epithelial cells, induces production of the chemokine IL-8 (9, 10). This induction of IL-8 is regulated by the activation of a mitogen-activated protein kinase pathway that subsequently leads to the induction of the transcription factor NF-{kappa}B (10). When human lung cells were stimulated with other AHLs there was no induction in IL-8, indicating that this induction was structurally specific (9, 10). 3O-C12-HSL also activates classic immune cells. For example, when LPS-activated mouse peritoneal exudate cells were cultured with 3O-C12-HSL, there was a significant inhibition in the production of the cytokine IL-12 (11). 3O-C12-HSL was also recently shown to directly stimulate T cells to produce the cytokine IFN-{gamma} (12). These data demonstrate that 3O-C12-HSL is a potent activator of multiple different eukaryotic cells and that the production of 3O-C12-HSL by P. aeruginosa may greatly affect its ability to cause disease.

The initial steps in PG production involve the release of arachidonic acid from the plasma membrane of cells by phospholipases. Arachidonic acid is then converted to PGH2 by the enzyme cyclooxygenase (Cox), also called PGH synthase. There are two known isoforms of Cox, Cox-1 and Cox-2 (13). Cox-1 is constitutively expressed in most tissues and is thought to be responsible for physiological functions such as platelet aggregation and renal function (14, 15). Cox-2 is usually only expressed when induced by bacterial products or cytokines. The induction of Cox-2 production is an early hallmark of inflammation. The overexpression of Cox-2 leads to the enhanced production of PGs. Inhibition of Cox-2 with selective inhibitors reduces inflammation, fever, pain, and possibly certain cancers (16). PGH2 produced by Cox is further converted to one of many prostanoids by specific synthases. PGE synthase (PGES) is the terminal step in the conversion of PGH2 to PGE2. There are two known isoforms of PGES, a constitutive cytosolic PGES (cPGES) and an inducible membrane-associated PGES (mPGES) (17). Recent evidence indicates that the mPGES is linked to the Cox-2 enzyme and that the cPGES is linked to the Cox-1 enzyme (18, 19). These data support the concept that induction of Cox-2 leads to increased production of PGE2. PGE2 has been shown to cause fever and permeability of vascular endothelium, enhance mucus secretion, and induce pain (20). PGE2 also synergizes with IL-8 to enhance neutrophil migration (21). It also acts as an immunoregulator by inhibiting IL-12 production, a cytokine that stimulates T cells to produce IFN-{gamma}. Therefore, the production of PGE2 skews the immune response by promoting type-2 responses (e.g., IL-4 production) at the expense of type-1 responses (e.g., IFN-{gamma} production) (22). PGE2 also has anti-inflammatory effects in the lung. In asthmatic patients PGE2 inhibits the release of mediators from mast cells and migration of eosinophils and induces bronchodilation (23). These data indicate that PGE2 is a potent molecule that affects multiple functions in the body and thus its production may have substantial effects on the pathogenesis of P. aeruginosa.

The ability of 3O-C12-HSL to regulate Cox-2 and PGs in human cells is the focus of this study. In mouse pneumonia and thermal injury models, it has been demonstrated that P. aeruginosa are potent inducers of PGE2 (24, 25). In this manuscript we demonstrate that the P. aeruginosa quorum sensing molecule 3O-C12-HSL is a potent inducer of Cox-2 and PGE2 production in human lung fibroblasts.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents

3O-C12-HSL and C4-HSL are organically synthesized in our laboratory as previously described (3, 4). These molecules are structurally and functionally identical to the natural molecule produced by P. aeruginosa. Each lot of 3O-C12-HSL and C4-HSL is shown to be pure by HPLC. No detectable levels of endotoxin were found in preparations of AHLs using a Limulus amebocyte lysate assay (Cape Cod Associates, Falmouth, MA). SC58125, a Cox-2 selective inhibitor (26), was a gift from Dr. P. Isakson (Searle, Skokie, IL). Indomethacin, a general Cox inhibitor, was obtained from Sigma-Aldrich (St. Louis, MO). SN50, a NF-{kappa}B inhibitor peptide, and SN50 M, a mutated control peptide, were obtained from Biomol (Plymouth Meeting, PA).

Cell culture

L828s are a normal, nontransformed human lung fibroblast strain previously isolated in our laboratory (27). These cells were maintained in MEM (Life Technologies, Gaithersburg, MD) supplemented with 10% FBS (HyClone Laboratories, Logan, UT) and 50 U/ml gentamicin (Life Technologies). Cells were passaged every 4–5 days using 0.05% trypsin with 0.1% EDTA to dissociate adherent cells. Fibroblasts were used between passages 5 and 15.

RNA isolation and quantification

L828 cells were grown in six-well plates until confluent (~5 x 105 cells/well). Cells were serum starved for 18 h before stimulation with a titration of 3O-C12-HSL. Cells were stimulated for various times and RNA was extracted with TriReagent (Molecular Research Center, Cincinnati, OH) as per manufacturer’s procedures. cDNA was prepared from RNA using reverse transcriptase and random hexamers (PE Applied Biosystems, Foster City, CA). Cox-1 primers (forward, TGTTCGGTGTCCAGTTCCAATA; reverse, ACCTTGAAGGAGTCAGGCATGAG) and probe CGCAACCGCATTGCCATGGAGT, and the Cox-2 primers (forward, GTGTTGACATCCAGATCACATTTGA; reverse, GAGAAGGCTTCCCAGCTTTTGTA) and probe TGACAGTCCACCAACTTACAATGCTGACTATGG were used to amplify DNA templates in a TaqMan 7700 (PE Applied Biosystems) using FAM/TAMRA dyes for the probes. The probe for cox-2 spans the junction between exons 3 and 4 of the cox-2 gene (i.e., it straddles the third intron); therefore, there is no chance that there was any interference from genomic DNA. Ribosomal (18S) RNA was amplified and used as a control. After 40 cycles the Ct (related to the cycle number at which signal appears) for the cox RNA (FAM signal) and the 18S were recorded. The absolute relative quantitation was achieved using the formula 2-DDCt, which relates the amount of Cox cDNA to the 18S internal control and a standard cox reference cDNA derived from U937 monocytes.

Protein isolation and Western blot analysis

Cells were cultured as described above and then extracted with cold lysis buffer (150 mM NaCl, 50 mM Tris (pH 8), 1 mM EDTA, 1% IGEPAL (Sigma-Aldrich), and 10% protease inhibitor mixture (Sigma-Aldrich)). Protein extracts were quantified using the bicinchoninic acid assay (Pierce, Rockford, IL). Total protein was resolved on 10% SDS-PAGE gels and transferred to nitrocellulose membranes (Amersham Pharmacia Biotech, Piscataway, NJ). Nonspecific binding was blocked by incubating the blots with 10% skim milk in PBS with 0.1% Tween 20 for 2 h at room temperature. Immunoreactive proteins were detected by incubating the blots with mouse anti-human Cox-1 or Cox-2 Abs or with rabbit anti-human PGES Abs (Cayman Chemical, Ann Arbor, MI) overnight at 4°C. Between each step the nitrocellulose was washed three times for 5 min with PBS/0.1% Tween 20. Bound Abs were detected with an anti-mouse IgG or anti-rabbit IgG conjugated to HRP (Santa Cruz Biotechnology, Santa Cruz, CA). Specific bands were visualized when nitrocellulose blots were incubated with ECL reagents (Amersham Pharmacia Biotech) and exposed to Kodak X-OMAT film (Kodak, Rochester, NY).

Immunocytochemistry

L828 fibroblasts were grown in eight-well Permanox chamber slides (Nalge Nunc, Naperville, IL) at a density of 2 x 104 cells per well. Cells were serum starved for 24 h before incubation with medium only or with a titration of 3O-C12-HSL for 24 h. Cells were washed twice with PBS plus 0.05% Tween 20 and endogenous peroxidase activity was quenched by incubation with 3% H2O2 for 10 min. Cells were blocked with 5% horse serum for 1 h at room temperature before overnight incubation at 4°C with 10 µg/ml mouse anti-human Cox-1 or Cox-2 Abs or an isotype control mouse IgG2b or IgG1 Ab (Caltag Laboratories, Burlingame, CA). Between each step cells were washed three times with PBS containing 0.05% Tween 20. Cells were incubated at room temperature for 1 h with a 1/200 dilution of a biotin-labeled anti-mouse IgG secondary Ab (Vector Laboratories, Burlingame, CA). Streptavidin HRP (Jackson ImmunoResearch Laboratories, West Grove, PA), at a 1/1000 dilution in PBS, was incubated with cells for 1 h at room temperature. Aminoethyl carbazole (Zymed Laboratories, South San Francisco, CA), which reacts with the bound HRP to form a red precipitate that can be visualized in the cells, was added for 30 min at room temperature. Cells were counterstained with hematoxylin and mounted with Immunomount (Sigma-Aldrich). In experiments examining the role of NF-{kappa}B, cells were incubated with 50 µM SN50 (NF-{kappa}B inhibitor) or SN50 M (mutant inhibitor) for 1 h before stimulation with 100 µM 3O-C12-HSL. For NF-{kappa}B mobilization studies cells were stimulated for 2 h with 100 µM 3O-C12-HSL and then stained with 2 µg/ml of an anti-NF-{kappa}B p65 Ab (Santa Cruz Biotechnology) as previously described (10).

PGE2 measurements

L828 cells were grown in 96-well plates at 2 x 104 cells/well. After 2 days of culture, at which point the cells were confluent, they were serum starved for 24 h. Cells were then stimulated for 24 h with a titration of 3O-C12-HSL. Culture supernatants were collected and assayed for PGE2 content by an enzyme immunoassay (Cayman Chemical). Some wells were cocultured with 20 µM indomethacin or 5 µM SC58125.

Statistics

A Wilcoxon signed rank test was used to determine statistical significance. Error bars indicate the SD of the mean.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Stimulation of human lung fibroblasts with 3O-C12-HSL induces Cox-2 mRNA

L828 fibroblasts were stimulated with 1–100 µM 3O-C12-HSL and RNA extracts were examined using real-time RT-PCR. Increases in steady-state Cox-2 mRNA levels occurred as early as 4 h after stimulation with a maximal induction at 8 h. This maximal induction was 8-fold over that found in nonstimulated fibroblasts (Fig. 1Go). After 8 h of stimulation, Cox-2 mRNA levels decreased and returned to that of nonstimulated cells. The optimal concentration of 3O-C12-HSL that consistently induced significant Cox-2 mRNA expression was 100 µM. 3O-C12-HSL stimulation had no significant effect on the level of Cox-1 mRNA, which was constitutively expressed at very low levels in these cells (Fig. 1Go).



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 1. Stimulation of L828 human lung fibroblasts with 3O-C12-HSL induces mRNA for Cox-2. Fibroblasts were stimulated with a titration of 3O-C12-HSL for various times. Cells were extracted and analyzed for Cox-1 and Cox-2 mRNA by real-time RT-PCR. Data are expressed as the relative induction of mRNA compared with nonstimulated cells. These data are the average of two separate experiments.

 
3O-C12-HSL stimulation of human lung fibroblasts increases the expression of Cox-2 protein but not Cox-1 protein

Production of Cox-1 protein in L828 lung fibroblasts was found to be constitutive in nonstimulated cells and, when cells were cultured with increasing amounts of 3O-C12-HSL, there was no significant change in the amount of Cox-1 protein expressed (Fig. 2Go). In contrast, Western blots for Cox-2 protein demonstrated that there was no expression in nonstimulated fibroblasts; however, when they were stimulated with 3O-C12-HSL there was a significant induction in Cox-2 protein. Stimulation with 1–10 µM 3O-C12-HSL induced a 2- to 5-fold increase in Cox-2 protein, whereas stimulation with 100 µM led to a 35-fold induction (Fig. 2Go). Cells were also stimulated with 3O-C12-HSL and then stained with anti-human Cox Abs to demonstrate Cox-1 and Cox-2 expression in individual fibroblasts. Similar to what was observed in Western blot experiments, nonstimulated L828 fibroblasts constitutively expressed Cox-1 and this expression was unaffected by 3O-C12-HSL (Fig. 3Go). When fibroblasts were stained with an anti-Cox-2 Ab there was no Cox-2 expression in nonstimulated cells, but with increasing concentrations of 3O-C12-HSL the amount of Cox-2 staining also increased. Faint staining for Cox-2 was observed in cells stimulated with 1 µM 3O-C12-HSL, with maximal staining in cells stimulated with 10 or 100 µM (Fig. 3Go). A similar induction in Cox-2 protein expression was found with other human lung fibroblast strains and with a human bronchial epithelial cell line (data not shown). To determine whether other AHLs could similarly stimulate an induction of Cox-2, fibroblasts were cultured with C4-HSL, a second AHL produced by P. aeruginosa. When 100 µM C4-HSL was added to L828 fibroblasts there was only a slight induction in Cox-2 expression, while Cox-1 was constitutively expressed, even in nonstimulated cells (Fig. 3Go). Other concentrations of C4-HSL were unable to induce any expression of Cox-2 protein (data not shown). These data indicate that 3O-C12-HSL induces Cox-2 expression and that another AHL produced by P. aeruginosa was unable to activate human lung fibroblasts as effectively.



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 2. Stimulation of human lung fibroblasts with a titration of 3O-C12-HSL induces Cox-2 protein expression. L828 fibroblasts were stimulated with 0–100 µM 3O-C12-HSL for 24 h. Protein extracts were analyzed by Western blot to demonstrate Cox-1 (upper panel) and Cox-2 (middle panel) expression. Densitometry of bands was graphed as fold induction over nonstimulated cells (lower panel). This experiment is representative of four separate experiments.

 


View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 3. 3O-C12-HSL, but not C4-HSL, induces Cox-2 in human lung fibroblasts. L828 fibroblasts were stimulated for 24 h and then stained with anti-Cox-1 or anti-Cox-2 Abs. Cells were counterstained with hematoxylin. As a control for specificity, cells were also stimulated with 100 µM C4-HSL and stained with anti-Cox Abs. These data are representative of three separate experiments.

 
NF-{kappa}B is essential for 3O-C12-HSL induction of Cox-2

The human cox-2 gene contains consensus sequences for the binding of the transcription factors NF-{kappa}B, NF-IL-6, and cAMP response element (28). In human lung epithelial cells, Cox-2 induction is primarily mediated by the transcription factor NF-{kappa}B (29). We previously demonstrated that 3O-C12-HSL stimulation of human bronchial epithelial cells induces NF-{kappa}B, which subsequently leads to the production of the chemokine IL-8 (10). To determine whether NF-{kappa}B also regulates 3O-C12-HSL induction of Cox-2, specific inhibitors for NF-{kappa}B translocation were used. In nonstimulated lung fibroblasts NF-{kappa}B is found sequestered in the cytoplasm in an inactive state by the I{kappa}B inhibitory proteins. When cells become activated by an inflammatory signal, I{kappa}B proteins are phosphorylated and degraded, allowing the translocation of NF-{kappa}B to the nucleus and gene transcription. A cell-permeable peptide (SN50) that contains the nuclear translocation sequence for NF-{kappa}B was used to inhibit NF-{kappa}B activity. This peptide has been shown to specifically inhibit nuclear translocation of NF-{kappa}B and thus inhibit its ability to induce the transcription of genes (30, 31). In nonstimulated L828 fibroblasts, NF-{kappa}B staining was found only in the cytoplasm, but when the fibroblasts were stimulated with 3O-C12-HSL, NF-{kappa}B staining was also found in the nucleus (Fig. 4Go). The addition of the peptide inhibitor SN50 to cultures blocked 3O-C12-HSL-induced translocation, but when SN50M, a peptide that contains a mutation in the nuclear translocation sequence, was added to 3O-C12-HSL-stimulated cultures there was no effect on NF-{kappa}B translocation (Fig. 4Go). Having shown that 3O-C12-HSL induced the translocation of NF-{kappa}B in these cells and that SN50 inhibited this induction, we next wanted to examine what effect this induction had on Cox-2 production. When SN50 was added with 3O-C12-HSL to L828 cultures and the cells were stained with an anti-Cox-2 Ab, it was observed that there was a substantial decrease in expression of Cox-2 protein. The addition of the mutant peptide SN50 M to cultures stimulated with 3O-C12-HSL resulted in no effect on Cox-2 induction (Fig. 4Go). As a control, fibroblasts were also cultured with SN50 or SN50 M, and in the absence of stimulation there was no effect on NF-{kappa}B or Cox-2 expression (data not shown). These data indicate that the induction of NF-{kappa}B by 3O-C12-HSL is essential for the production of Cox-2 in these cells.



View larger version (76K):
[in this window]
[in a new window]
 
FIGURE 4. Inhibition of NF-{kappa}B translocation prevents the induction of Cox-2 protein by 3O-C12-HSL. L828 fibroblasts were cocultured with SN50 (peptide inhibitor of NF-{kappa}B translocation) or SN50M (a mutant peptide that does not block NF-{kappa}B) and 100 µM 3O-C12-HSL and then stained with an anti-NF-{kappa}B (upper panels) or anti-Cox-2 (lower panels) Ab. Blue arrows show absence of nuclear staining and black arrows point out nuclear NF-{kappa}B. These data are representative of two separate experiments.

 
3O-C12-HSL induces the expression of PGES

PGH2 produced by Cox is converted to various PGs by specific PG synthases. There are two forms of PGES, a cytosolic (cPGES) and a microsomal (mPGES) synthase. Recent data have demonstrated that, in human lung epithelial cells stimulated with IL-1, Cox-2 and mPGES were coordinately regulated (32). To determine whether 3O-C12-HSL up-regulates the expression of PGES, L828 fibroblasts were stimulated with 100 µM 3O-C12-HSL for varying times, and Western blots for Cox-2, cPGES, or mPGES were done. These experiments demonstrated that mPGES was not expressed in nonstimulated cells but was induced as early as 8 h after 3O-C12-HSL stimulation. Expression of mPGES continued to increase even after 96 h of stimulation. When these samples were examined for Cox-2 expression, it was observed that Cox-2 was induced earlier than mPGES. As previously shown, Cox-2 protein was not expressed in nonstimulated cells but induction occurred after 4 h of stimulation with 3O-C12-HSL and maximal expression occurred after 8 h. By 48 h Cox-2 expression had returned to background levels (Fig. 5Go). Although mPGES was induced with 3O-C12-HSL stimulation, cPGES was constitutively expressed in L828 fibroblasts and was not significantly affected by stimulation with 3O-C12-HSL (Fig. 5Go).



View larger version (73K):
[in this window]
[in a new window]
 
FIGURE 5. 3O-C12-HSL stimulation induces the expression of mPGES. L828 fibroblasts were stimulated for various times with 100 µM 3O-C12-HSL. Protein extracts (top three panels) were analyzed for expression of Cox-2, mPGES, or cPGES by Western blot. Densitometry is graphed as the relative sum intensity of each band (bar graph). These data are representative of four separate experiments.

 
3O-C12-HSL stimulates the production of PGE2 in human lung fibroblasts

Having demonstrated that 3O-C12-HSL increased the expression of both Cox-2 and mPGES, we next wanted to determine whether PGE2 levels were also increased. When L828 lung fibroblasts were cultured with a titration of 3O-C12-HSL, a significant amount of PGE2 could be measured in culture supernatants. Although 50 µM 3O-C12-HSL stimulated a statistically significant induction in PGE2, the 100 µM concentration induced an 8-fold induction over that of untreated cells (Fig. 6GoA). The addition of exogenous arachidonic acid, the substrate for Cox production of PGH2, to cultures did not enhance the production of PGE2 with 3O-C12-HSL stimulation (data not shown). These data indicate that the availability of arachidonic acid in L828 fibroblasts is not a limiting step in the production of PGE2 with 3O-C12-HSL stimulation. When cells were cocultured with 20 µM indomethacin, an inhibitor of both Cox-1 and 2 activities, or 5 µM SC58125, a Cox-2 selective inhibitor, the amount of PGE2 produced was reduced to background levels (Fig. 6GoB). Because the inhibition found with the Cox-2 selective inhibitor was similar to that found with the general Cox inhibitor, indomethacin, these data indicate that the production of PGE2 with 3O-C12-HSL stimulation occurs through the induction of Cox-2.



View larger version (8K):
[in this window]
[in a new window]
 
FIGURE 6. Stimulation of L828 fibroblasts with 3O-C12-HSL induces production of PGE2. A, L828s were stimulated with a titration of 3O-C12-HSL for 24 h and PGE2 in the culture supernatant was quantified. These data are an average of six separate experiments. B, Fibroblasts were stimulated with 100 µM 3O-C12-HSL along with the addition of indomethacin or SC-58125. These data are an average of four separate experiments. *, p < 0.03.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
During the initial colonization of the lung by Pseudomonas, it is proposed that the bacteria bind to the ciliated bronchial epithelial surface or the overlying mucus layer. In an immunocompetent individual these bacteria would be cleared from the lung by ciliary movement, mucus flow out of the lung, phagocytosis, and epithelial internalization and desquamation (33). However, in patients that have defects in these innate functions, such as CF patients and patients on mechanical ventilators, these mechanisms are unable to clear the bacteria from the lung. In CF patients, mutations in the chloride channel known as the CF transmembrane conductance regulator result in high salt and thick mucus in the lungs. This environment is conducive to P. aeruginosa colonization and produces a niche in which the bacteria can grow. In the CF lung P. aeruginosa has been found to grow to very high densities (1 x 108 CFU/ml sputum) as biofilms, an organized structure consisting of bacteria and polysaccharide (34). A high concentration of bacteria in the lungs of CF patients has been correlated to increased inflammation and tissue destruction.

Sputum from P. aeruginosa-colonized patients contains transcripts for quorum sensing genes as well as quorum sensing regulated genes (35, 36). More recently it was shown that 3O-C12-HSL and C4-HSL could be detected in the sputum of CF patients colonized with P. aeruginosa (36). These data indicate that P. aeruginosa produces 3O-C12-HSL in vivo, which actively regulates many bacterial virulence genes. Because 3O-C12-HSL is both diffused and pumped out of P. aeruginosa, it directly interacts with surrounding eukaryotic cells (5). In studies examining the colonization of squid light organs with the bacteria Vibrio fischeri, which produces an AHL similar to 3O-C12-HSL, it was observed that the AHL not only was located around the bacteria but had penetrated into the epithelial layer of the light organ (37). We propose that 3O-C12-HSL produced by P. aeruginosa may have a similar interaction with the epithelium of the lung. Also during chronic P. aeruginosa infections there is destruction of the lung epithelium that exposes the underlying fibroblasts. These data indicate that 3O-C12-HSL would be in direct contact with fibroblasts during P. aeruginosa infections. It has been shown that biofilms of P. aeruginosa grown in vitro can produce ~600 µM 3O-C12-HSL, a concentration that is significantly higher than what has previously been measured in planktonic cultures (1–5 µM) (38). This level of 3O-C12-HSL production is well above the concentrations needed to induce Cox-2 and PGE2 expression in vitro (10–100 µM).

One of the hallmarks of an aggressive infection in a CF patient is the progressive inflammation that occurs. It is the overzealous induction of this inflammatory response that leads to extensive tissue destruction and ultimately pulmonary failure. Inflammation and production of inflammatory mediators, such as IL-8, are directly correlated to the presence of P. aeruginosa in the lungs of CF patients (39). Sputum samples from P. aeruginosa-colonized CF patients contain increased amounts of PGs (40, 41). In this manuscript, we demonstrated that 3O-C12-HSL produced by P. aeruginosa induced the expression of Cox-2 and mPGES and the production of PGE2. PGE2 stimulates mucus secretion and edema, characteristics commonly found in the CF lung (20). It also synergizes with the chemokine IL-8 to enhance migration of neutrophils (21). High numbers of neutrophils in the lung of a CF patient are associated with excessive inflammation and indicative of a poor prognosis. PGE2 is a potent inhibitor of IL-12 and IFN-{gamma} production and thus stimulates a type-2 phenotype in T cells (22). In studies with LPS-activated mouse peritoneal exudate cells, 3O-C12-HSL inhibited the production of IL-12 (11). Although these investigators did not measure PGE2 production in their studies, we speculate that the inhibition of IL-12 in these cells was due to 3O-C12-HSL induction of PGE2.

In burn wounds, colonization with P. aeruginosa results in a significant increase in both Cox-2 and PGE2 production (25). Inhibition of PGE2 production with Cox-2 selective drugs prevented P. aeruginosa dissemination from the wound site and resulted in decreased sepsis and mortality (42). Additional studies using the burn wound model of P. aeruginosa infection in mice demonstrated that quorum sensing mutants that do not produce 3O-C12-HSL were unable to disseminate and cause mortality (43). These data support the conclusion that production of 3O-C12-HSL by P. aeruginosa and its subsequent induction of Cox-2 and PGE2 are essential for the bacteria to disseminate and cause mortality. When mice were given lung infections by exposing them to aerosolized P. aeruginosa, there was a significant induction of PGE2 and lung pathology. When these animals were treated with ibuprofen, a general Cox inhibitor, before infection, there was a decrease in both lung inflammation and PGE2 levels (24). A similar inhibition was observed in ibuprofen-treated rats that had chronic P. aeruginosa infections (44). Collectively these data indicate that infections with P. aeruginosa result in increases in Cox-2 and PGE2 expression and that when Cox inhibitors are used the pathogenesis of the organism is diminished.

In clinical trials, where CF patients were treated with ibuprofen (a general Cox-1 and Cox-2 inhibitor), the results were mixed. Although these patients showed some improvement in lung function, the ibuprofen treatments had no effect on the bacterial burden found in these patients (45, 46, 47). However, the improvements found with ibuprofen treatment warrant addition clinical trials with both general Cox inhibitors as well as new Cox-2 selective drugs (which would have fewer side effects, e.g., gastric irritation) with or without cotreatment with antibiotics.

A novel finding reported herein was that 3O-C12-HSL stimulation increased the expression of mPGES in human lung fibroblasts (Fig. 5Go). The sequential induction of both Cox-2 and mPGES resulted in a significant increase in the production of PGE2 found in concert with 3O-C12-HSL stimulation (Fig. 6Go). The induction of Cox-2 was found to occur more quickly and expression was more ephemeral than that found with mPGES (Fig. 5Go). This sequential regulation of these enzymes is most likely a method of controlling the levels of PGE2 production. Stimulation of orbital fibroblasts with IL-1{beta} also induced similar sequential expression of Cox-2 and mPGES (48). We also demonstrated that cPGES and Cox-1 were not induced with 3O-C12-HSL stimulation. Recent data have demonstrated that cPGES is functionally linked to Cox-1 while mPGES is associated with Cox-2 (18, 19). Although we do not discount the role of Cox-1 and cPGES in the production of PGE2, our data would indicate that 3O-C12-HSL induction of PGE2 is acting predominately through the induction of Cox-2 and mPGES. Having demonstrated that both Cox-2 and mPGES are induced with 3O-C12-HSL stimulation, inhibition of these enzymes may be important in regulating the inflammation that occurs with P. aeruginosa infections. Drugs that inhibit the various PG synthases are not yet available, but are novel targets for therapeutics treating inflammation. The use of such drugs in the future may be important in the regulation of P. aeruginosa inflammation. We also demonstrated that 3O-C12-HSL induction of Cox-2 was regulated by the activation of the transcription factor NF-{kappa}B (Fig. 4Go). Previously, we demonstrated that activation of NF-{kappa}B was essential for 3O-C12-HSL induction of the chemokine IL-8 (10). Because NF-{kappa}B is pivotal in the production of both IL-8 and PGE2 during P. aeruginosa infections, this transcription factor should be an attractive target for anti-inflammatory therapy. Blocking the activation of the NF-{kappa}B transcription factor may prevent the early induction of IL-8 and PGE2 and thus decrease the inflammation induced by P. aeruginosa infections.

In conclusion, 3O-C12-HSL is not only essential in the regulation of several bacterial virulence factors but also induces key early events in human inflammation, namely the induction of Cox-2, mPGES, and PGE2. The Cox-2 product PGE2 likely regulates aspects of innate immunity (e.g., edema and neutrophil migration) and inducible immunity (inhibition of IL-12 and IFN-{gamma}) that influence the immune response to P. aeruginosa.


    Footnotes
 
1 This work was supported by U.S. Public Health Service Grants AI33713C, HL07216, HL56002, DE11390, ES01247, and T32 HL66988, and Cystic Fibrosis Foundation Grant 00Z0. Back

2 Address correspondence and reprint requests to Dr. Richard P. Phipps, University of Rochester School of Medicine and Dentistry, Environmental Health Sciences Center, Box 850, 601 Elmwood Avenue, Rochester, NY 14642. E-mail address: richard_phipps{at}urmc.rochester.edu Back

3 Abbreviations used in this paper: CF, cystic fibrosis; AHL, acylated homoserine lactone; Cox, cyclooxygenase; 3O-C12-HSL, N-(3-oxododecanoyl) homoserine lactone; C4-HSL, butyryl homoserine lactone; PGES, PGE synthase; mPGES, membrane-associated PGES; cPGES, cytosolic PGES. Back

Received for publication January 4, 2002. Accepted for publication June 18, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Jr Morrison, A. J., R. P. Wenzel. 1984. Epidemiology of infections due to Pseudomonas aeruginosa. Rev. Infect. Dis. 6:S627.
  2. Richards, M. J., J. R. Edwards, D. H. Culver, R. P. Gaynes. 1999. Nosocomial infections in medical intensive care units in the United States: National Nosocomial Infections Surveillance System. Crit. Care Med. 27:887.[Medline]
  3. Pearson, J. P., K. M. Gray, L. Passador, K. D. Tucker, A. Eberhard, B. H. Iglewski, E. P. Greenberg. 1994. Structure of the autoinducer required for expression of Pseudomonas aeruginosa virulence genes. Proc. Natl. Acad. Sci. USA 91:197.[Abstract/Free Full Text]
  4. Pearson, J. P., L. Passador, B. H. Iglewski, E. P. Greenberg. 1995. A second N-acylhomoserine lactone signal produced by Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 92:1490.[Abstract/Free Full Text]
  5. Pearson, J. P., C. Van Delden, B. H. Iglewski. 1999. Active efflux and diffusion are involved in transport of Pseudomonas aeruginosa cell-to-cell signals. J. Bacteriol. 181:1203.[Abstract/Free Full Text]
  6. Seed, P. C., L. Passador, B. H. Iglewski. 1995. Activation of the Pseudomonas aeruginosa lasI gene by LasR and the Pseudomonas autoinducer PAI: an autoinduction regulatory hierarchy. J. Bacteriol. 177:654.[Abstract/Free Full Text]
  7. Latifi, A., M. Foglino, K. Tanaka, P. Williams, A. Lazdunski. 1996. A hierarchical quorum-sensing cascade in Pseudomonas aeruginosa links the transcriptional activators LasR and RhIR (VsmR) to expression of the stationary-phase {sigma} factor RpoS. Mol. Microbiol. 21:1137.[Medline]
  8. de Kievit, T. R., B. H. Iglewski. 2000. Bacterial quorum sensing in pathogenic relationships. Infect. Immun. 68:4839.[Free Full Text]
  9. DiMango, E., H. J. Zar, R. Bryan, A. Prince. 1995. Diverse Pseudomonas aeruginosa gene products stimulate respiratory epithelial cells to produce interleukin-8. J. Clin. Invest. 96:2204.
  10. Smith, R. S., E. R. Fedyk, T. A. Springer, N. Mukaida, B. H. Iglewski, R. P. Phipps. 2001. IL-8 production in human lung fibroblasts and epithelial cells activated by the Pseudomonas autoinducer N-3-oxododecanoyl homoserine lactone is transcriptionally regulated by NF-{kappa}B and activator protein-2. J. Immunol. 167:366.[Abstract/Free Full Text]
  11. Telford, G., D. Wheeler, P. Williams, P. T. Tomkins, P. Appleby, H. Sewell, G. S. Stewart, B. W. Bycroft, D. I. Pritchard. 1998. The Pseudomonas aeruginosa quorum-sensing signal molecule N-(3-oxododecanoyl)-L-homoserine lactone has immunomodulatory activity. Infect. Immun. 66:36.[Abstract/Free Full Text]
  12. Smith, R. S., S. G. Harris, R. Phipps, B. Iglewski. 2002. The Pseudomonas aeruginosa quorum-sensing molecule N-(3-oxododecanoyl)homoserine lactone contributes to virulence and induces inflammation in vivo. J. Bacteriol. 184:1132.[Abstract/Free Full Text]
  13. Smith, W. L., R. M. Garavito, D. L. DeWitt. 1996. Prostaglandin endoperoxide H synthases (cyclooxygenases)-1 and -2. J. Biol. Chem. 271:33157.[Free Full Text]
  14. Funk, C. D., L. B. Funk, M. E. Kennedy, A. S. Pong, G. A. Fitzgerald. 1991. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment. FASEB J. 5:2304.[Abstract]
  15. Kam, P. C., A. U. See. 2000. Cyclo-oxygenase isoenzymes: physiological and pharmacological role. Anaesthesia 55:442.[Medline]
  16. Celotti, F., S. Laufer. 2001. Anti-inflammatory drugs: new multitarget compounds to face an old problem—the dual inhibition concept. Pharmacol. Res. 43:429.[Medline]
  17. Jakobsson, P. J., S. Thoren, R. Morgenstern, B. Samuelsson. 1999. Identification of human prostaglandin E synthase: a microsomal, glutathione-dependent, inducible enzyme, constituting a potential novel drug target. Proc. Natl. Acad. Sci. USA 96:7220.[Abstract/Free Full Text]
  18. Murakami, M., H. Naraba, T. Tanioka, N. Semmyo, Y. Nakatani, F. Kojima, T. Ikeda, M. Fueki, A. Ueno, S. Oh, I. Kudo. 2000. Regulation of prostaglandin E2 biosynthesis by inducible membrane-associated prostaglandin E2 synthase that acts in concert with cyclooxygenase-2. J. Biol. Chem. 275:32783.[Abstract/Free Full Text]
  19. Tanioka, T., Y. Nakatani, N. Semmyo, M. Murakami, I. Kudo. 2000. Molecular identification of cytosolic prostaglandin E2 synthase that is functionally coupled with cyclooxygenase-1 in immediate prostaglandin E2 biosynthesis. J. Biol. Chem. 275:32775.[Abstract/Free Full Text]
  20. Heller, A., T. Koch, J. Schmeck, K. van Ackern. 1998. Lipid mediators in inflammatory disorders. Drugs 55:487.[Medline]
  21. Colditz, I. G.. 1990. Effect of exogenous prostaglandin E2 and actinomycin D on plasma leakage induced by neutrophil-activating peptide-1/interleukin-8. Immunol. Cell Biol. 68:397.
  22. Phipps, R. P., S. H. Stein, R. L. Roper. 1991. A new view of prostaglandin E regulation of the immune response. Immunol. Today 12:349.[Medline]
  23. Pavord, I. D., A. E. Tattersfield. 1995. Bronchoprotective role for endogenous prostaglandin E2. Lancet 345:436.[Medline]
  24. Sordelli, D. O., M. C. Cerquetti, G. el-Tawil, P. W. Ramwell, A. M. Hooke, J. A. Bellanti. 1985. Ibuprofen modifies the inflammatory response of the murine lung to Pseudomonas aeruginosa. Eur. J. Respir. Dis. 67:118.[Medline]
  25. Hahn, E. L., H. H. Tai, L. K. He, R. L. Gamelli. 1999. Burn injury with infection alters prostaglandin E2 synthesis and metabolism. J. Trauma 47:1052.[Medline]
  26. Wu, K. K.. 1998. Biochemical pharmacology of nonsteroidal anti-inflammatory drugs. Biochem. Pharmacol. 55:543.[Medline]
  27. Sempowski, G. D., P. R. Chess, R. P. Phipps. 1997. CD40 is a functional activation antigen and B7-independent T cell costimulatory molecule on normal human lung fibroblasts. J. Immunol. 158:4670.[Abstract]
  28. Kosaka, T., A. Miyata, H. Ihara, S. Hara, T. Sugimoto, O. Takeda, E. Takahashi, T. Tanabe. 1994. Characterization of the human gene (PTGS2) encoding prostaglandin-endoperoxide synthase 2. Eur. J. Biochem. 221:889.[Medline]
  29. Chen, C. C., Y. T. Sun, J. J. Chen, K. T. Chiu. 2000. TNF-{alpha}-induced cyclooxygenase-2 expression in human lung epithelial cells: involvement of the phospholipase C-{gamma}2, protein kinase C-{alpha}, tyrosine kinase, NF-{kappa}B-inducing kinase, and I-{kappa}B kinase 1/2 pathway. J. Immunol. 165:2719.[Abstract/Free Full Text]
  30. Lin, Y. Z., S. Y. Yao, R. A. Veach, T. R. Torgerson, J. Hawiger. 1995. Inhibition of nuclear translocation of transcription factor NF-{kappa}B by a synthetic peptide containing a cell membrane-permeable motif and nuclear localization sequence. J. Biol. Chem. 270:14255.[Abstract/Free Full Text]
  31. Xu, J., M. M. Zutter, S. A. Santoro, R. A. Clark. 1998. A three-dimensional collagen lattice activates NF-{kappa}B in human fibroblasts: role in integrin {alpha}2 gene expression and tissue remodeling. J. Cell Biol. 140:709.[Abstract/Free Full Text]
  32. Thoren, S., P. J. Jakobsson. 2000. Coordinate up- and down-regulation of glutathione-dependent prostaglandin E synthase and cyclooxygenase-2 in A549 cells: inhibition by NS-398 and leukotriene C4. Eur. J. Biochem. 267:6428.[Medline]
  33. Pier, G. B., M. Grout, T. S. Zaidi. 1997. Cystic fibrosis transmembrane conductance regulator is an epithelial cell receptor for clearance of Pseudomonas aeruginosa from the lung. Proc. Natl. Acad. Sci. USA 94:12088.[Abstract/Free Full Text]
  34. Singh, P. K., A. L. Schaefer, M. R. Parsek, T. O. Moninger, M. J. Welsh, E. P. Greenberg. 2000. Quorum-sensing signals indicate that cystic fibrosis lungs are infected with bacterial biofilms. Nature 407:762.[Medline]
  35. Storey, D. G., E. E. Ujack, H. R. Rabin, I. Mitchell. 1998. Pseudomonas aeruginosa lasR transcription correlates with the transcription of lasA, lasB, and toxA in chronic lung infections associated with cystic fibrosis. Infect. Immun. 66:2521.[Abstract/Free Full Text]
  36. Erickson, D. L., R. Endersby, A. Kirkham, K. Stuber, D. D. Vollman, H. R. Rabin, I. Mitchell, D. G. Storey. 2002. Pseudomonas aeruginosa quorum-sensing systems may control virulence factor expression in the lungs of patients with cystic fibrosis. Infect. Immun. 70:1783.[Abstract/Free Full Text]
  37. Boettcher, K. J., E. G. Ruby. 1995. Detection and quantification of Vibrio fischeri autoinducer from symbiotic squid light organs. J. Bacteriol. 177:1053.[Abstract/Free Full Text]
  38. Charlton, T. S., R. de Nys, A. Netting, N. Kumar, M. Hentzer, M. Givskov, S. Kjelleberg. 2000. A novel and sensitive method for the quantification of N-3-oxoacyl homoserine lactones using gas chromatography-mass spectrometry: application to a model bacterial biofilm. Environ. Microbiol. 2:530.[Medline]
  39. Armstrong, D. S., K. Grimwood, J. B. Carlin, R. Carzino, J. P. Gutierrez, J. Hull, A. Olinsky, E. M. Phelan, C. F. Robertson, P. D. Phelan. 1997. Lower airway inflammation in infants and young children with cystic fibrosis. Am. J. Respir. Crit. Care Med. 156:1197.[Abstract/Free Full Text]
  40. Zakrzewski, J. T., N. C. Barnes, P. J. Piper, J. F. Costello. 1987. Detection of sputum eicosanoids in cystic fibrosis and in normal saliva by bioassay and radioimmunoassay. Br. J. Clin. Pharmacol. 23:19.[Medline]
  41. Konstan, M. W., R. W. Walenga, K. A. Hilliard, J. B. Hilliard. 1993. Leukotriene B4 markedly elevated in the epithelial lining fluid of patients with cystic fibrosis. Am. Rev. Respir. Dis. 148:896.[Medline]
  42. Shoup, M., L. K. He, H. Liu, R. Shankar, R. Gamelli. 1998. Cyclooxygenase-2 inhibitor NS-398 improves survival and restores leukocyte counts in burn infection. J. Trauma 45:215.[Medline]
  43. Rumbaugh, K. P., J. A. Griswold, B. H. Iglewski, A. N. Hamood. 1999. Contribution of quorum sensing to the virulence of Pseudomonas aeruginosa in burn wound infections. Infect. Immun. 67:5854.[Abstract/Free Full Text]
  44. Konstan, M. W., K. M. Vargo, P. B. Davis. 1990. Ibuprofen attenuates the inflammatory response to Pseudomonas aeruginosa in a rat model of chronic pulmonary infection: implications for antiinflammatory therapy in cystic fibrosis. Am. Rev. Respir. Dis. 141:186.[Medline]
  45. Konstan, M. W., C. L. Hoppel, B. L. Chai, P. B. Davis. 1991. Ibuprofen in children with cystic fibrosis: pharmacokinetics and adverse effects. J. Pediatr. 118:956.[Medline]
  46. Konstan, M. W., P. J. Byard, C. L. Hoppel, P. B. Davis. 1995. Effect of high-dose ibuprofen in patients with cystic fibrosis. N. Engl. J. Med. 332:848.[Abstract/Free Full Text]
  47. Dezateux, C., and A. Crighton. 2000. Oral non-steroidal anti-inflammatory drug therapy for cystic fibrosis. Cochrane Database Syst. Rev. 2.
  48. Han, R., S. Tsui, T. J. Smith. 2002. Up-regulation of prostaglandin E2 synthesis by interleukin-1{beta} in human orbital fibroblasts involves coordinate induction of prostaglandin-endoperoxide H synthase-2 and glutathione-dependent prostaglandin E2 synthase expression. J. Biol. Chem. 277:16355.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
MicrobiologyHome page
M. D. P. Willcox, H. Zhu, T. C. R. Conibear, E. B. H. Hume, M. Givskov, S. Kjelleberg, and S. A. Rice
Role of quorum sensing by Pseudomonas aeruginosa in microbial keratitis and cystic fibrosis
Microbiology, August 1, 2008; 154(8): 2184 - 2194.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
A. Jahoor, R. Patel, A. Bryan, C. Do, J. Krier, C. Watters, W. Wahli, G. Li, S. C. Williams, and K. P. Rumbaugh
Peroxisome Proliferator-Activated Receptors Mediate Host Cell Proinflammatory Responses to Pseudomonas aeruginosa Autoinducer
J. Bacteriol., July 1, 2008; 190(13): 4408 - 4415.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. F. Teiber, S. Horke, D. C. Haines, P. K. Chowdhary, J. Xiao, G. L. Kramer, R. W. Haley, and D. I. Draganov
Dominant Role of Paraoxonases in Inactivation of the Pseudomonas aeruginosa Quorum-Sensing Signal N-(3-Oxododecanoyl)-L-Homoserine Lactone
Infect. Immun., June 1, 2008; 76(6): 2512 - 2519.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
P. Williams
Quorum sensing, communication and cross-kingdom signalling in the bacterial world
Microbiology, December 1, 2007; 153(12): 3923 - 3938.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
P. Williams, K. Winzer, W. C Chan, and M. Camara
Look who's talking: communication and quorum sensing in the bacterial world
Phil Trans R Soc B, July 29, 2007; 362(1483): 1119 - 1134.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
M. Manefield and A. S Whiteley
Acylated homoserine lactones in the environment: chameleons of bioactivity
Phil Trans R Soc B, July 29, 2007; 362(1483): 1235 - 1240.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
D. A. Stoltz, E. A. Ozer, C. J. Ng, J. M. Yu, S. T. Reddy, A. J. Lusis, N. Bourquard, M. R. Parsek, J. Zabner, and D. M. Shih
Paraoxonase-2 deficiency enhances Pseudomonas aeruginosa quorum sensing in murine tracheal epithelia
Am J Physiol Lung Cell Mol Physiol, April 1, 2007; 292(4): L852 - L860.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. D. Woolard, J. E. Wilson, L. L. Hensley, L. A. Jania, T. H. Kawula, J. R. Drake, and J. A. Frelinger
Francisella tularensis-Infected Macrophages Release Prostaglandin E2 that Blocks T Cell Proliferation and Promotes a Th2-Like Response
J. Immunol., February 15, 2007; 178(4): 2065 - 2074.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. Gomi, T. Kikuchi, Y. Tokue, S. Fujimura, A. Uehara, H. Takada, A. Watanabe, and T. Nukiwa
Mouse and Human Cell Activation by N-Dodecanoyl-DL-Homoserine Lactone, a Chromobacterium violaceum Autoinducer
Infect. Immun., December 1, 2006; 74(12): 7029 - 7031.
[Abstract] [Full Text] [PDF]


Home page
J Med MicrobiolHome page
S. Miyairi, K. Tateda, E. T. Fuse, C. Ueda, H. Saito, T. Takabatake, Y. Ishii, M. Horikawa, M. Ishiguro, T. J. Standiford, et al.
Immunization with 3-oxododecanoyl-L-homoserine lactone-protein conjugate protects mice from lethal Pseudomonas aeruginosa lung infection.
J. Med. Microbiol., October 1, 2006; 55(Pt 10): 1381 - 1387.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. V. Kravchenko, G. F. Kaufmann, J. C. Mathison, D. A. Scott, A. Z. Katz, M. R. Wood, A. P. Brogan, M. Lehmann, J. M. Mee, K. Iwata, et al.
N-(3-Oxo-acyl)homoserine Lactones Signal Cell Activation through a Mechanism distinct from the Canonical Pathogen-associated Molecular Pattern Recognition Receptor Pathways
J. Biol. Chem., September 29, 2006; 281(39): 28822 - 28830.
[Abstract] [Full Text] [PDF]


Home page
J Med MicrobiolHome page
Y. Imamura, K. Yanagihara, K. Tomono, H. Ohno, Y. Higashiyama, Y. Miyazaki, Y. Hirakata, Y. Mizuta, J.-i. Kadota, K. Tsukamoto, et al.
Role of Pseudomonas aeruginosa quorum-sensing systems in a mouse model of chronic respiratory infection
J. Med. Microbiol., June 1, 2005; 54(6): 515 - 518.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
R. T. Sadikot, T. S. Blackwell, J. W. Christman, and A. S. Prince
Pathogen-Host Interactions in Pseudomonas aeruginosa Pneumonia
Am. J. Respir. Crit. Care Med., June 1, 2005; 171(11): 1209 - 1223.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. J. Ritchie, A. Jansson, J. Stallberg, P. Nilsson, P. Lysaght, and M. A. Cooley
The Pseudomonas aeruginosa Quorum-Sensing Molecule N-3-(Oxododecanoyl)-L-Homoserine Lactone Inhibits T-Cell Differentiation and Cytokine Production by a Mechanism Involving an Early Step in T-Cell Activation
Infect. Immun., March 1, 2005; 73(3): 1648 - 1655.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
T. B. Rasmussen, T. Bjarnsholt, M. E. Skindersoe, M. Hentzer, P. Kristoffersen, M. Kote, J. Nielsen, L. Eberl, and M. Givskov
Screening for Quorum-Sensing Inhibitors (QSI) by Use of a Novel Genetic System, the QSI Selector
J. Bacteriol., March 1, 2005; 187(5): 1799 - 1814.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
T. Bjarnsholt, P. O. Jensen, M. Burmolle, M. Hentzer, J. A. J. Haagensen, H. P. Hougen, H. Calum, K. G. Madsen, C. Moser, S. Molin, et al.
Pseudomonas aeruginosa tolerance to tobramycin, hydrogen peroxide and polymorphonuclear leukocytes is quorum-sensing dependent
Microbiology, February 1, 2005; 151(2): 373 - 383.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
Y. Imamura, K. Yanagihara, Y. Mizuta, M. Seki, H. Ohno, Y. Higashiyama, Y. Miyazaki, K. Tsukamoto, Y. Hirakata, K. Tomono, et al.
Azithromycin Inhibits MUC5AC Production Induced by the Pseudomonas aeruginosa Autoinducer N-(3-Oxododecanoyl) Homoserine Lactone in NCI-H292 Cells
Antimicrob. Agents Chemother., September 1, 2004; 48(9): 3457 - 3461.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
S. C. Williams, E. K. Patterson, N. L. Carty, J. A. Griswold, A. N. Hamood, and K. P. Rumbaugh
Pseudomonas aeruginosa Autoinducer Enters and Functions in Mammalian Cells
J. Bacteriol., April 15, 2004; 186(8): 2281 - 2287.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. K. Chun, E. A. Ozer, M. J. Welsh, J. Zabner, and E. P. Greenberg
From The Cover: Inactivation of a Pseudomonas aeruginosa quorum-sensing signal by human airway epithelia
PNAS, March 9, 2004; 101(10): 3587 - 3590.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
B. Wang, P. P. Cleary, H. Xu, and J.-D. Li
Up-Regulation of Interleukin-8 by Novel Small Cytoplasmic Molecules of Nontypeable Haemophilus influenzae via p38 and Extracellular Signal-Regulated Kinase Pathways
Infect. Immun., October 1, 2003; 71(10): 5523 - 5530.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. Tateda, Y. Ishii, M. Horikawa, T. Matsumoto, S. Miyairi, J. C. Pechere, T. J. Standiford, M. Ishiguro, and K. Yamaguchi
The Pseudomonas aeruginosa Autoinducer N-3-Oxododecanoyl Homoserine Lactone Accelerates Apoptosis in Macrophages and Neutrophils
Infect. Immun., October 1, 2003; 71(10): 5785 - 5793.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. J. Ritchie, A. O. W. Yam, K. M. Tanabe, S. A. Rice, and M. A. Cooley
Modification of In Vivo and In Vitro T- and B-Cell-Mediated Immune Responses by the Pseudomonas aeruginosa Quorum-Sensing Molecule N-(3-Oxododecanoyl)-L-Homoserine Lactone
Infect. Immun., August 1, 2003; 71(8): 4421 - 4431.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, R. S.
Right arrow Articles by Phipps, R. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, R. S.
Right arrow Articles by Phipps, R. P.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*BUTYROLACTONE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS