|
|
||||||||
by Nitric Oxide in Monocytes/Macrophages Down-Regulates p47phox and Attenuates the Respiratory Burst1
Institute of Cell Biology, University of Kaiserslautern, Kaiserslautern, Germany
| Abstract |
|---|
|
|
|---|
. NO-releasing
compounds (100 µM S-nitrosoglutathione or 50 µM
spermine-NONOate) as well as inducible NO synthase induction provoked
activation of PPAR
. This was proven by EMSAs, with the notion that
supershift analysis pointed to the involvement of PPAR
. PCR analysis
ruled out induction of PPAR
mRNA as a result of NO supplementation.
Reporter assays, with a construct containing a triple PPAR response
element in front of a thymidine kinase minimal promoter driving the
luciferase gene, were positive in response to NO delivery. DNA binding
capacity as well as the transactivating capability of PPAR
were
attenuated by addition of the antioxidant
N-acetyl-cysteine or in the presence of the NO scavenger
2-phenyl-4,4,5,6-tetramethyl-imidazoline-1-oxyl 3-oxide. Having
established that NO but not lipophilic cyclic GMP analogs activated
PPAR
, we verified potential anti-inflammatory consequences. The
oxidative burst of macrophages, evoked by phorbol ester, was attenuated
in association with NO-elicited PPAR
activation. A cause-effect
relationship was demonstrated when PPAR response element decoy
oligonucleotides, supplied in front of NO delivery, allowed to regain
an oxidative response. PPAR
-mediated down-regulation of p47
phagocyte oxidase, a component of the NAD(P)H oxidase system, was
identified as one molecular mechanism causing inhibition of superoxide
radical formation. We conclude that NO participates in controlling the
pro- vs anti-inflammatory phenotype of macrophages by modulating
PPAR
. | Introduction |
|---|
|
|
|---|
B or AP-1 (4, 5, 6). As a consequence, the
expression of cytokines, apoptotic proteins, or immediate early genes
such as cyclooxygenase-2 are modulated, thus stressing the function of
NO as a messenger molecule (7, 8).
The anti-inflammatory properties of the nuclear hormone receptor
family known as peroxisome proliferator-activated receptors
(PPARs)3 were recently
established (9). Three subtypes, PPAR
, PPAR
(also
known as PPAR
), and PPAR
have been described so far, originally
found in association with obesity, diabetes, and atherosclerosis
(10). All of them act as ligand-dependent transcription
factors which, upon heterodimerization with the 9-cis
retinoic acid receptor (RXR), bind to the PPAR response element (PPRE)
to modulate target gene expression (11). PPAR
has been
shown to be activated by natural agonists such as
15-deoxy-
12,14-PGJ2
(15d-PGJ2) or synthetic antidiabetic
thiazolidinediones, i.e., ciglitazone, with the outcome to reduce
proinflammatory cytokine as well as reactive nitrogen species
production in monocytes/macrophages (12, 13). In addition,
activation may be achieved by oxidized low-density lipoprotein via the
CD36 scavenger receptor (14, 15), which has been linked to
the development of atherosclerosis. Experiments performed with cells
derived from murine embryonic stem cells that were homozygous for a
null mutation in the PPAR
gene questioned the anti-inflammatory
properties of PPAR
(16) but verified its role in CD36
expression (17).
Considering the properties of NO as a messenger molecule during
innate and adaptive immunity, we sought to correlate NO actions to an
anti-inflammatory macrophage phenotype. Therefore, we asked whether
NO may activate PPAR
. We demonstrate activation of PPAR
in
macrophages by chemically distinct NO donors as well as endogenously
synthesized NO by inducible NO synthase (iNOS) induction and link an
active PPAR
with an attenuated oxidative burst. Inhibition of
superoxide radical formation was due to PPAR
-mediated
down-regulation of p47 phagocyte oxidase
(p47phox), one important component of the
NAD(P)H oxidase enzyme complex. We conclude that anti-inflammatory
properties of NO may be transmitted by gene regulation affected by
PPAR
activation.
| Materials and Methods |
|---|
|
|
|---|
PMA, N-acetyl-cysteine (NAC),
2-phenyl-4,4,5,6-tetramethyl-imidazoline-1-oxyl 3-oxide (PTIO), LPS,
and 8-bromo-cGMP were purchased from Sigma (Deisenhofen, Germany).
Spermine-NONOate (spermine-NO) was obtained from Bio-Trend (Cologne,
Germany). Hydroethidine (HE) was from Molecular Probes (Leiden, The
Netherlands). The polyclonal anti-PPAR
2 Ab and
L-NG-nitroarginine
methyl ester (L-NAME) were from Alexis
(Grünberg, Germany). The polyclonal anti-PPAR
and
anti-c-Jun Abs were obtained from Santa Cruz Biotechnology
(Heidelberg, Germany). Culture supplements and FCS were ordered from
Biochrom (Berlin, Germany). 15d-PGJ2 and
ciglitazone were bought from Biomol (Hamburg, Germany). Murine rIFN-
was from Roche Diagnostics (Mannheim, Germany). The luciferase assay
kit was obtained from Promega (Mannheim, Germany) and the
-galactosidase detection kit was from Tropix (Mannheim, Germany).
Oligonucleotides were ordered from Eurogentec (Seraing, Belgium). All
other chemicals were of the highest grade of purity and commercially
available.
GSNO synthesis
S-nitrosoglutathione (GSNO) was synthesized and characterized as previously described (18).
Cell culture
The mouse monocyte/macrophage cell line RAW 264.7 and the premonocytic human cell lines U937 and THP1 were maintained in RPMI 1640 supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin, and 10% heat-inactivated FCS (complete RPMI). All experiments were performed using complete RPMI.
Flow cytometry of oxygen radical production (HE assay)
Cells were cultured under nonadherent conditions. Following a prestimulation regime, 5 x 105 cells were incubated for 30 min with 1 µM PMA. Thereafter, 3 µM HE was added and incubations went on for 30 min. Cells were harvested, washed with PBS, and resuspended in 200 µl PBS. Flow cytometry analysis was performed using a Coulter Epics XL flow cytometer (Beckman Coulter, Krefeld, Germany) and HE was measured through a 630-nm long pass filter (FL3). Data from 10,000 cells were collected to reach significance.
Nuclear protein extraction
Preparation of crude nuclear extract was basically as described (19). Briefly, following cell activation for the times indicated, 4 x 106 cells were washed in 1 ml of ice-cold PBS, centrifuged at 1,000 x g for 5 min, resuspended in 400 µl ice-cold hypotonic buffer (10 mM HEPES/KOH, 2 mM MgCl2, 0.1 mM EDTA, 10 mM KCl, 1 mM DTT, 0.5 mM PMSF, pH 7.9), left on ice for 10 min, vortexed, and centrifuged at 15,000 x g for 30 s. Sedimented nuclei were resuspended in 50 µl ice-cold saline buffer (50 mM HEPES/KOH, 50 mM KCl, 300 mM NaCl, 0.1 mM EDTA, 10% glycerol, 1 mM DTT, 0.5 mM PMSF, pH 7.9), left on ice for 20 min, vortexed, and centrifuged at 15,000 x g for 5 min at 4°C. Aliquots of the supernatant, containing nuclear proteins, were frozen in liquid nitrogen and stored at -70°C. Protein was determined using a Bio-Rad II kit (Bio-Rad, Hercules, CA).
EMSAs
An established EMSA method, with slight modifications, was used
(20). Nuclear protein (20 µg) was incubated for 20 min
at room temperature with 20 µg BSA, 2 µg poly(dI-dC) (from Amersham
Biosciences, Freiburg, Germany), 2 µl buffer D (20 mM
HEPES/KOH, 20% glycerol, 100 mM KCl, 0.5 mM EDTA, 0.25% Nonidet P-40,
2 mM DTT, 0.5 mM PMSF, pH 7.9), 4 µl buffer F (20% Ficoll-400, 100
mM HEPES/KOH, 300 mM KCl, 10 mM DTT, 0.5 mM PMSF, pH 7.9), and 20,000
cpm of a 32P-labeled oligonucleotide in a final
volume of 20 µl. Supershift Abs (2 µg) were added as indicated.
DNA-protein complexes were resolved at 180 V for 4 h in a
taurine-buffered, native 6% polyacrylamide gel (4% for supershifts),
dried, and visualized (autoradiography using a Fuji x-ray film).
Oligonucleotide probes were labeled by a filling reaction using the
Klenow fragment (Roche Diagnostics). A total of 1 pmol oligonucleotide
was labeled with 50 µCi of [
-32P]dCTP
(3,000 Ci/mmol; Amersham, Braunschweig, Germany) and cold nucleotides
(dATP, dTTP, dGTP; Life Technologies, Eggenstein, Germany),
purified on a CHROMA SPIN-10 column (Clontech Laboratories, Heidelberg,
Germany), and stored at -20°C until use. Oligonucleotides with the
consensus PPRE site (bold letters) were used (21):
5'-GGTAAAGGTCAAAGGTCAAT-3' and
3'-ATTTCCAGTTTCCAGTTAGCCG-5'.
PPRE reporter gene assay
The plasmid J3TK pGL3, containing three copies of the human
apoAII gene promoter PPRE-containing J site cloned upstream of the
thymidine kinase promoter in the pGL3 luciferase expression vector, was
kindly provided by B. Staels (Institut National de la Santé et de
la Recherche Médicale, Unité 325, Institute Pasteur, Lille,
France) (22). Macrophages were transiently transfected
using the DEAE-dextran method as previously described
(23). Cell selection was unnecessary because the
expression of a macrophage-unrelated protein was analyzed. Briefly, 1
day before transfection, cells were seeded in suspension at a density
of 1 x 106 cells/ml. A total of 1 x
107 cells were harvested, washed twice with PBS,
and incubated for 3 h at 37°C in 1 ml RPMI 1640 supplemented
with 50 mM Tris-HCl (pH 7.3), 400 µg DEAE-dextran, 20 µg luciferase
reporter construct (J3TK pGL3), and 5 µg CMV-
-galactosidase
plasmid as an internal control. To discard the DNA/DEAE-dextran
mixture, cells were washed twice with PBS, seeded at a density of
1 x 106 cells/ml, and cultured for 24
h. Afterward cells were stimulated for 15 h with NO donors or
15d-PGJ2. Cell extracts were assayed for
luciferase and
-galactosidase activity. For calculations, luciferase
activity was normalized for
-galactosidase by using the following
formula: luciferase activity/
-gal activity.
RNA extraction and semiquantitative RT-PCR
RNA was extracted using peqGOLD RNAPure (Peqlab, Erlangen,
Germany) according to the distributors manual. Reverse transcription
reactions and PCR for murine and human PPAR
and GAPDH were performed
using the Advantage RT-for-PCR kit and the Advantage 2 Polymerase
Mix (Clontech Laboratories). The sequences of the primers were as
follows: murine PPAR
4801228(4801228) (24),
TA = 63°C: 5'
3',
ATGGCCATTGAGTGCCGAGTCTG; 3'
5', GGCTTTTGAGGAACTCCCTGGTCA. Murine
GAPDH 471048(471048) (25), TA =
63°C: 5'
3', ATGGTGAAGGTCGGTGTGAACGG; 3'
5',
TTACTCCTTGGAGGCCATGTAGGGC.
Annealing temperatures were calculated using the primer design program
Oligo (MBI, St. Leon-Rot, Germany). The number of amplification
cycles (25 for GAPDH and 30 for PPAR
) was necessary to achieve
exponential amplification where product formation is proportional to
starting DNA. Products were run on a 1% agarose gel and were ethidium
bromide stained. Controls of isolated RNA omitting reverse
transcription were used during PCR to guarantee genomic DNA-free RNA
preparations (data not shown).
Decoy approach
Cells were exposed to an oligonucleotide containing a PPRE consensus site as specified for the EMSA. Cells were seeded at a density of 1 x 106 cells/well into six-well plates. Oligonucleotides (3 µM) were added 24 h before cell stimulation. Cell stimulation was performed as indicated. Oligonucleotide sequences were identical to those used for EMSA. To guarantee oligonucleotide stability within the cells, oligonucleotides containing a phosphorothioate backbone were applied. For control reasons oligonucleotides with a mutated PPRE site were used (mutated sites in bold letters): 5'-GGTAAAGAACAAAGAACAAT-3' and 3'-ATTTCTTGTTTCTTGTTAGCCG-5'.
Griess assay
To this end, nitrite, a stable end product of NO metabolism, was
determined in the supernatant of RAW 264.7 cells. Cells were seeded in
six-well plates at a density of 1 x 106
cells/well. After incubations for 24 h, cells were exposed to 100
µM GSNO, 3 µM ciglitazone, and 1 µM
15-dPGJ2, or remained as controls. After 2 h
medium was changed and cells were directly stimulated with 1 µg/ml
LPS in combination with 10 U/ml IFN-
for 15 h. The amount of
nitrite was determined spectrophotometrically by the Griess assay
(Promega, Heidelberg, Germany) according to the manufacturers
instructions. Nitrite concentrations in the supernatants were
calculated by comparison with standard concentrations of
NaNO2 dissolved in culture medium. Unless
otherwise stated, the reported values are the mean (±SD) of three
separate experiments, each performed in triplicate.
Northern blot
Total RNA was extracted using peqGOLD RNAPure (Peqlab) according
to the distributors manual. Twenty micrograms of total RNA was used
for Northern blotting. The probes for p22phox
and p47phox were generated using the human
GenBank sequences. The used primer sequences were as follows: Human
p22phox 31605(31605) (26),
TA = 63°C: 5'
3',
GGGGCAGATCGAGTGGGCC; 3'
5', CGTCGGTCACCGGGATGGG. Human
p47phox 131871(131871) (27),
TA = 63°C: 5'
3',
TCTACCGGCGCTTCACCGAGA; 3'
5', CGTCTTGCCCCGACTTTTGCA.
Subsequently, cDNA was cloned into a pDrive cloning vector (Qiagen,
Hilden, Germany). After EcoRI (Roche Diagnostics)
restriction cleavage and gel extraction, probes were radiolabeled with
[
-32P]dCTP using the Rediprime II random
prime labeling system (Amersham). Blots were also probed with a 28S RNA
probe to assess equal loading.
Statistical analysis
Each experiment was performed at least three times and statistical analysis was performed using the two-tailed Student t test. Otherwise representative data are shown.
| Results |
|---|
|
|
|---|
by NO-releasing compounds and iNOS induction
In a first set of experiments we evaluated activation of PPAR
by gel shift analysis. Experimentally, monocytes/macrophages were
dose-dependently exposed to chemically distinct NO donors. As shown in
Fig. 1
A, GSNO stimulated
binding of PPAR
to radioactively labeled oligonucleotides in U937
cells. Activation was pronounced at 100 µM, somewhat lower at 200
µM, and virtually absent at doses of 50 µM as well as
concentrations at or above 500 µM GSNO. Controls show minor or no
PPAR
activation. To exclude any cell type artifact we repeated these
studies in THP1 cells (Fig. 1
B). In THP1 monocytes GSNO, at
a concentration of 100 µM, evoked PPAR
activation, with lower or
higher doses being inactive.
|
as well, with the notion
that 50 µM was the most effective concentration (data not shown).
Similar results were obtained using the murine macrophage-like cell
line RAW 264.7 (data not shown). It appeared that activation of PPAR
was achieved at low concentrations of NO donors that elicited neither
necrosis nor an apoptotic phenotype.
We went on to verify the identity of the PPAR-oligonucleotide complex
by supershift analysis (Fig. 1
C). This was achieved by
adding PPAR
vs PPAR
Abs to the binding assay followed by EMSA
analysis. Specificity was further verified using an unrelated
anti-c-Jun Ab in parallel. While the PPAR
antiserum shifted the
protein-oligonucleotide complex to a higher m.w., the PPAR
Ab did
not. The c-Jun Ab was ineffective as well. Conclusively, the
-isoform of PPARs is activated in response to NO.
The biological significance shown for NO donor-mediated effects was
verified in experiments using RAW 264.7 macrophages (Fig. 1
D). After LPS/IFN-
treatment, an established
iNOS-inducing regimen in these cells, activation of PPAR
was clearly
visible by EMSA analysis (Fig. 1
D, lane 3).
Interestingly, inhibition of iNOS by L-NAME
markedly reduced activation of PPAR
(Fig. 1
D, lane
2), thus pointing to the involvement of endogenously generated NO
in PPAR
activation.
In the following set of experiments we looked for the time-dependent
activation of PPAR
by exposing U937 cells to GSNO or spermine-NO
(Fig. 2
A) and RAW 264.7
macrophages to spermine-NO (Fig. 2
B). With 100 µM GSNO we
elicited an immediate onset of the PPAR
response after 30 min. The
strongest activation was achieved after 12 h, with a decreased
responsiveness after 4 h.
|
activation after 30 min and promoted the
strongest response after 1 h, with a declining responsiveness
toward the control level at 2 and 4 h as shown for U937 (Fig. 2
activation we conducted costimulation experiments with
the PPAR
agonists ciglitazone and 15d-PGJ2 in
combination with the NO donor GSNO. As shown for U937 cells in Fig. 2
activation. This was significantly increased with the
simultaneous addition of 100 µM GSNO. Similar results were obtained
using 15d-PGJ2 in combination with GSNO (data not
shown). A well-established signal transduction pathway for NO is activation of the soluble guanylyl cyclase with the formation and action of cGMP (28, 29).
To analyze for the potential involvement of cGMP in conferring
activation of PPAR
in our system, we exposed THP1 as well as
RAW 264.7 cells to the lipophilic cyclic GMP analog 8-bromo-cGMP
(1 mM) for 30 min up to 4 h (Fig. 3
). Unlike NO, 8-bromo-cGMP did not
reproduce PPAR
activation, thus pointing to a cGMP-independent NO
signaling mechanism.
|
transactivation, besides enhancing DNA binding. We used the luciferase
reporter assay to demonstrate transcriptional activation of PPAR
in
response to NO donors and 15d-PGJ2, which
represents a commonly accepted control activator (Fig. 4
4-fold increase of
luciferase activity. The response toward NO and
15d-PGJ2 was determined 15 h after cell
stimulation.
|
to the DNA and
concomitantly caused transactivation of a PPAR-responsive reporter
system. Specificity of the NO response
Considering the possibility that PPAR
is transcriptionally
regulated by NO we analyzed the mRNA level by RT-PCR in RAW 264.7
macrophages (Fig. 5
). Neither GSNO (100
µM) nor spermine-NO (50 µM), both supplied up to 4 h, revealed
any variations in the mRNA content of PPAR
after normalization with
the GAPDH standard.
|
in response to NO
delivery, we assumed a direct activation mechanism to be more likely.
Along that line we asked whether antioxidants such as NAC may interfere
with PPAR
activation. This was tested by preincubating RAW 264.7
cells for 1 h with 1 mM NAC before the addition of 100 µM GSNO
or 50 µM spermine-NO, supplied for 1 h (Fig. 6
by GSNO
and spermine-NO was largely attenuated in the presence of the
antioxidant. Moreover, NAC suppressed the transactivation capacity of
PPAR
(Fig. 6
|
activation. It was our further
intention to pinpoint NO as the molecule setting into motion the
activation cascade that culminated in PPAR
activation. Therefore, we
used the NO scavenger PTIO (Fig. 6
-evoked luciferase activity in response to GSNO and spermine-NO.
Control determinations showed no interference of PTIO or NAC on the
basal PPAR
response.
NO attenuated the oxidative burst in macrophages via activation of
PPAR
Decoy oligonucleotides can be used to scavenge and thereby to
inactivate transcription factors (30, 31). Using this
experimental approach we provided evidence that NO donors
attenuated reactive oxygen species (ROS) formation via PPAR
activation (Fig. 7
). As shown in Fig. 7
A, oxidation of HE was elicited in response to 1 µM PMA
in RAW 264.7 macrophages. This was measured by flow cytometry and is
shown by the rightward shift of the HE signal (Fig. 7
A).
Prestimulation with 100 µM GSNO (Fig. 7
B) or 50 µM
spermine-NO (Fig. 7
C) for 15 h eradicated ROS formation
because NO donors attenuated the HE shift in response to PMA.
|
(Fig. 3
We conclude that NO, delivered by the breakdown of GSNO or spermine-NO,
activates PPAR
by a cGMP-independent mechanism that in turn
attenuates the proinflammatory signal of the macrophage oxidative
burst.
NO-mediated inhibition of superoxide radical production is due to
PPAR
-dependent down-regulation of p47phox
Modulation of gene expression in response to PPAR
activation is
known and associated with, e.g., inhibition of iNOS expression
(13). To verify our system we used RAW 264.7 macrophages,
known to express iNOS in response to LPS/IFN-
treatment. To
establish that NO-activated PPAR
may attenuate iNOS expression, we
treated cells for 2 h with 100 µM GSNO, changed medium, and
stimulated macrophages with 1 µg/ml LPS in combination with 10 U/ml
IFN-
for 15 h. Thereafter nitrite was determined by the Griess
assay as the metabolic end-product of iNOS-generated NO. Prestimulation
of the cells with GSNO attenuated nitrite production by 50% compared
with cells treated with LPS/IFN-
only (27 ± 9 vs 14 ± 7
µM nitrite). To make the contribution of PPAR
more likely, PPAR
agonists such as 15d-PGJ2 or ciglitazone were
used. Prestimulation for 2 h with either
15d-PGJ2 or ciglitazone decreased
LPS/IFN-
-mediated NO production by
70% (27 ± 9 vs 9
± 5 µM nitrite for 15d-PGJ2 or 11 ± 7
µM nitrite for ciglitazone).
We now focused on components of the NAD(P)H oxidase system, known to be
involved in the superoxide radical formation, to identify the molecular
mechanism responsible for attenuating the oxidative burst. We analyzed
the expression pattern of different members of this multifactor complex
on RNA levels by Northern blotting. Using this experimental system we
demonstrate as depicted for U937 cells that NO-mediated PPAR
activation leads to p47phox down-regulation. As
shown in Fig. 8
, upper panel,
transcription of p47phox was clearly reduced in
response to 50 and 100 µM GSNO. To verify the role of PPAR
activation concerning this effect, we applied
15d-PGJ2 and ciglitazone, two known specific
PPAR
agonists, to the cells with a similar outcome. Expression of
p47phox was significantly diminished.
p22phox, another component of the NAD(P)H
oxidase system, was not altered by NO exposure or by PPAR
agonist
addition compared with untreated controls (Fig. 8
, lower
panel). To assess equal loading, filters were hybridized with a
28S RNA probe (data not shown).
|
activation leads to attenuation of
at least p47phox expression, one necessary
component of the NAD(P)H oxidase, responsible for oxidative burst
generation. | Discussion |
|---|
|
|
|---|
and concomitantly attenuated the oxidative burst in
monocytes/macrophages, likely due to down-regulated
p47phox expression. Activation of PPAR
was
confirmed by gel shift analysis, reporter gene assays, and a decoy
oligonucleotide approach. The involvement of NO was substantiated by
using the NO scavenger PTIO and the antioxidant NAC with the notion
that lipophilic cGMP analogs were unable to reduce superoxide
formation. Attenuation of p47phox expression was
shown by Northern blotting. To verify the biological significance of
these results obtained with NO donors, RAW 264.7 macrophages were
stimulated with LPS/IFN-
to endogenously produce NO as a result of
iNOS induction. As shown by gel shift analysis, PPAR
was activated
in response to endogenously synthesized NO, because blocking iNOS
significantly attenuated PPAR
activation. We conclude that
iNOS-generated NO suffices in provoking DNA binding of PPAR
. Taking
the lipid-soluble nature of NO into account, it appears attractive to
hypothesize that cells in the direct neighborhood to NO-producing cells
are affected with the outcome of an impaired proinflammatory signaling
cascade in those target cells. Reactive oxygen- and nitrogen-derived species are implicated as effector molecules in the immune system, serving major functions during immunological host defense, mainly as a result of macrophage and neutrophil activation (32). However, reactive oxygen and nitrogen species operate as modulators of signal transducing pathways as well, thus characterizing them as intra- and intercellular messenger molecules (33). In line, redox-controlled transcription factors, oxidative susceptible thiol groups, or redox-sensitive phosphorylation events allow to channel the action of reactive species into established intracellular communication systems (2, 34).
The observation that NO-provoked PPAR
-activation is unrelated to
cGMP signaling appears in line with several recent reports on direct
NO/target interactions. For example, activation of c-Ha-Ras (p21) via
nitrosylation of cysteine 118 has recently been shown by using
electrospray ionization mass spectrometry (34),
up-regulation of transcription factors such as NF-
B has been noted
in a NO-dependent manner in a murine model of hemorrhagic shock
(6), and protein tyrosine phosphorylation is achieved by
NO. Moreover, the transcription factor HIF1
turned out to be NO
responsive (35), and NO is needed to activate tyrosine
kinase 2 and to tyrosine phosphorylate STAT4 (36).
In this work we show, by using chemically distinct NO donors, that
PPAR
is activated by NO. This is substantiated by using a NO
scavenger to attenuate PPAR
activation. The use of NAC to abrogate
the NO signal may aim toward its NO scavenging ability or its
antioxidant properties. In any case, the interference of NAC
appears rational. Although our studies excluded cGMP to activate
PPAR
, molecular details on NO action remain unknown so far. In this
respect, extending examinations are needed to address various
possibilities, such as a direct interaction of NO with PPAR
,
phosphorylation events, or NO-evoked generation of a PPAR
activator.
Of note, DNA binding of PPAR
appeared fast and was noticed 12 h
after the addition of NO. The rapid response points to activation of a
preformed transcription factor rather than a mechanism involving
enhanced PPAR
expression. This assumption is strengthened by our
observation that mRNA of PPAR
remained unchanged in response to
NO.
Activation of PPAR
by NO is contrasted by inhibition seen at higher
concentrations of NO donors. An attenuated DNA binding ability of
PPAR
at higher doses of GSNO appears in some agreement with studies
of Kröncke et al. (37). They observed reduced DNA
binding activities of zinc finger transcription factors, among them the
RXR, at high doses of NO donors (
0.5 mM). Taking into consideration
that PPAR
heterodimerizes with RXR before DNA binding, one may
envision an attenuated promoter binding activity of PPAR
at elevated
NO concentrations. The importance of RXR in transcription factor
complex activation/inhibition will be an important issue of future
experiments. As seen in our study, at concentrations >200 µM GSNO we
lost the ability of NO to stimulate DNA binding or to cause
transactivation of PPAR
(data not shown).
Activation of PPAR
by NO results in desensitization of macrophages
with the consequence of an attenuated oxidative burst. A cause-effect
relationship is established by the successful use of a decoy
oligonucleotide approach that allowed to regain an oxidative signal
despite the presence of NO. Decoy oligonucleotide approaches have been
shown to block transcriptional activity with high efficacy by
scavenging active transcription factors (31). PPAR
is
known for its anti-inflammatory properties and is reported to exert
a negative effect on proinflammatory cytokine and/or iNOS expression in
macrophages, such as RAW cells (12, 13). The identified
anti-inflammatory property of PPAR
is in contrast to the work of
Chawla et al. (16), who showed in macrophages derived from
murine embryonic stem cells that were homozygous for a null mutation in
the PPAR
gene, that inhibitory effects on cytokine production and
inflammation may be receptor independent. Concerning this data we
assume a concentration-dependent, PPAR
-independent effect, which
might not occur using lower doses of the applied PPAR
-specific and
unspecific agonists.
On a molecular basis PPAR
has recently been shown to antagonize
coactivators such as the CREB-binding protein from interacting with its
cognate target gene, thereby attenuating up-regulation of, e.g.,
iNOS (13), or blocking TNF-
formation
(12). Having these reports in mind, our decoy approach may
imply either that transactivation of PPAR
with concomitant formation
of a PPAR
-responsive gene product interferes with the oxidative
burst or that active PPAR
complexes and thereby removes another
factor that presumably is required to express constituents of
the NAD(P)H oxidase. In any case, PPAR
decoy oligonucleotides will
interfere with gene expression with the limitation that unknown
transcription factors/coactivators, distinct from PPAR
, may be
targeted by this approach. Taking advantage of published data that iNOS
expression is inhibited by PPAR
activation (13), we
provided evidence that our system is in line with published results.
Prestimulation for 2 h with GSNO inhibits LPS/IFN-
-mediated
nitrite production by
50%. However, complete inhibition was not
achieved and control experiments performed with specific PPAR
agonists revealed
70% inhibition. This may depend on the presence
of IFN-
, which antagonizes PPAR
-provoked inhibitory mechanisms
(38). Having demonstrated that PPAR
targets established
systems, e.g., NO formation, we provided further evidence on
PPAR
in attenuating ROS formation. Results came from Northern
blotting experiments, showing inhibition of
p47phox expression in response to NO-releasing
compounds as well as PPAR
-specific agonists; we assume that
attenuated p47phox expression as one component
of the NAD(P)H oxidase system accounts for reduced ROS formation
(39). These observations are in some analogy with the
results of Inoue et al. (40), demonstrating inhibition of
p22phox expression in response to PPAR
agonists in primary endothelial cells. Regulation of NAD(P)H oxidase
components has been described in human cultured monocytes, where
decreased gp91phox,
p22phox, and p47phox
expression in response to diminished binding of the transcription
factor PU.1 to the corresponding promoter sites reduced the ability to
produce microbicidal oxidants (41). Endogenous production
of NO seems insufficient to down-regulate
p47phox (data not shown). Rather, up-regulation
of p47phox upon LPS/IFN-
stimulation was
shown (42). PPAR
-mediated effects are counter-regulated
by IFN-
(38). Further studies will need to analyze the
involvement of p47phox promoter regions in
conferring this opposing effect of LPS/IFN-
vs NO.
Inhibition of the oxidative burst by NO has been known for some time.
In neutrophils NO blocked O2-
formation with some indication that assembly of the NAD(P)H oxidase is
affected (43). Along that line, NO attenuated the
oxidative burst in murine microglia as well (44). In
analogy to our studies, this was unrelated to cGMP signaling or a
simple scavenging of O2-, thus
implying activation of PPAR
as a rational explanation for these
observations.
Macrophages are key players during the innate immune response.
Immunological activation of macrophages is achieved by cytokines and
bacterial components (45). Cell activation results in the
release of various proinflammatory cytokines and reactive nitrogen as
well as oxygen species (46). The excessive release of
these mediators results in the development of whole body inflammation,
which is closely related to the clinical symptoms of sepsis or septic
shock (47). During sepsis the early hyperinflammatory
phase is counterbalanced by an anti-inflammatory response,
characterized by monocyte deactivation (48). It appears
attractive to hypothesize whether the formation of NO in macrophages
not only represents an early cytotoxic signal but also shifts the
balance toward an anti-inflammatory response via activation of
PPAR
, which would be in line with recent reports describing NO as an
inhibitor of proinflammatory cytokine expression (7, 49, 50). In further studies it will be essential to compare the
cytokine profile of activated macrophages to that of a deactivated
macrophage phenotype, to study the impact of NO on this cytokine
balance, and to elucidate the role of PPAR
during this
activation-deactivation transition.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Bernhard Brüne, Institute of Cell Biology, University of Kaiserslautern, Erwin-Schroedinger-Strasse, 67663 Kaiserslautern, Germany. E-mail address: bruene{at}rhrk.uni-kl.de ![]()
3 Abbreviations used in this paper: PPAR, peroxisome proliferator-activated receptor; p47phox, p47 phagocyte oxidase; GSNO, S-nitrosoglutathione; spermine-NO, spermine-NONOate; PPRE, PPAR response element; NAC, N-acetyl-cysteine; PTIO, 2-phenyl-4,4,5,6-tetramethyl-imidazoline-1-oxyl 3-oxide; L-NAME, L-NG-nitroarginine methyl ester; 15d-PGJ2, 15-deoxy-
12,14-PGJ2; HE, hydroethidine; RXR, retinoic acid receptor; iNOS, inducible NO synthase; ROS, reactive oxygen species. ![]()
Received for publication February 1, 2002. Accepted for publication June 28, 2002.
| References |
|---|
|
|
|---|
B and AP-1 activation by nitric oxide attenuated apoptotic cell death in RAW 264.7 macrophages. Mol. Biol. Cell 10:361.
B implies a physiological self-amplifying mechanism. Eur. J. Immunol. 28:2276.[Medline]
/RXR
crystal structure reveals the molecular basis of heterodimerization among nuclear receptors. Mol. Cell 5:545.[Medline]
agonists inhibit production of monocyte inflammatory cytokines. Nature 391:82.[Medline]
-dependent repression of the inducible nitric oxide synthase gene. Mol. Cell. Biol. 20:4699.
. Cell 93:229.[Medline]
. J. Immunol. 168:2828.
dependent and independent effects on macrophage-gene expression in lipid metabolism and inflammation. Nat. Med. 7:48.[Medline]
in macrophage differentiation and cholesterol uptake. Nat. Med. 7:41.[Medline]
B transcription factor in a T-lymphocytic cell line by hypochlorous acid. Biochem. J. 321:777.
B is activated by arachidonic acid but not by eicosapentaenoic acid. Biochem. Biophys. Res. Commun. 229:643.[Medline]
(PPAR
) heterodimers: intermolecular synergy requires only the PPAR
hormone-dependent activation function. Mol. Cell. Biol. 18:3483.
under the influence of nitric oxide. Blood 97:1009.
: counter-regulatory activity by IFN-
. J. Leukocyte Biol. 71:677.
(PPAR
) and PPAR
increase Cu2+, Zn2+-superoxide dismutase and decrease p22phox message expressions in primary endothelial cells. Metabolism 50:3.[Medline]
, in vitro and in vivo, on mRNA levels of phagocyte oxidase components. J. Leukocyte Biol. 60:716.[Abstract]
treatment. Nat. Med. 3:678.[Medline]
This article has been cited by other articles:
![]() |
L. Klotz, S. Hucke, D. Thimm, S. Classen, A. Gaarz, J. Schultze, F. Edenhofer, C. Kurts, T. Klockgether, A. Limmer, et al. Increased Antigen Cross-Presentation but Impaired Cross-Priming after Activation of Peroxisome Proliferator-Activated Receptor {gamma} Is Mediated by Up-Regulation of B7H1 J. Immunol., July 1, 2009; 183(1): 129 - 136. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Schroder, K. Wandzioch, I. Helmcke, and R. P. Brandes Nox4 Acts as a Switch Between Differentiation and Proliferation in Preadipocytes Arterioscler Thromb Vasc Biol, February 1, 2009; 29(2): 239 - 245. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sato, T. Shimosato, W. G. Alvord, and D. M. Klinman Suppressive Oligodeoxynucleotides Inhibit Silica-Induced Pulmonary Inflammation J. Immunol., June 1, 2008; 180(11): 7648 - 7654. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Beyer, G. L. Baumbach, C. M. Halabi, M. L. Modrick, C. M. Lynch, T. D. Gerhold, S. M. Ghoneim, W. J. de Lange, H. L. Keen, Y.-S. Tsai, et al. Interference With PPAR{gamma} Signaling Causes Cerebral Vascular Dysfunction, Hypertrophy, and Remodeling Hypertension, April 1, 2008; 51(4): 867 - 871. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ceolotto, A. Gallo, I. Papparella, L. Franco, E. Murphy, E. Iori, E. Pagnin, G. P. Fadini, M. Albiero, A. Semplicini, et al. Rosiglitazone Reduces Glucose-Induced Oxidative Stress Mediated by NAD(P)H Oxidase via AMPK-Dependent Mechanism Arterioscler Thromb Vasc Biol, December 1, 2007; 27(12): 2627 - 2633. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Dhakshinamoorthy, S. R. Sridharan, L. Li, P. Y. Ng, L. M. Boxer, and A. G. Porter Protein/DNA arrays identify nitric oxide-regulated cis-element and trans-factor activities some of which govern neuroblastoma cell viability Nucleic Acids Res., August 15, 2007; (2007) gkm594v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ptasinska, S. Wang, J. Zhang, R. A. Wesley, and R. L. Danner Nitric oxide activation of peroxisome proliferator-activated receptor gamma through a p38 MAPK signaling pathway FASEB J, March 1, 2007; 21(3): 950 - 961. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. von Knethen, M. Soller, N. Tzieply, A. Weigert, A. M. Johann, C. Jennewein, R. Kohl, and B. Brune PPAR{gamma}1 attenuates cytosol to membrane translocation of PKC{alpha} to desensitize monocytes/macrophages J. Cell Biol., February 26, 2007; 176(5): 681 - 694. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Klotz, I. Dani, F. Edenhofer, L. Nolden, B. Evert, B. Paul, W. Kolanus, T. Klockgether, P. Knolle, and L. Diehl Peroxisome Proliferator-Activated Receptor {gamma} Control of Dendritic Cell Function Contributes to Development of CD4+ T Cell Anergy J. Immunol., February 15, 2007; 178(4): 2122 - 2131. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Motiwala, H. K. Janagama, M. L. Paustian, X. Zhu, J. P. Bannantine, V. Kapur, and S. Sreevatsan Comparative Transcriptional Analysis of Human Macrophages Exposed to Animal and Human Isolates of Mycobacterium avium Subspecies paratuberculosis with Diverse Genotypes. Infect. Immun., November 1, 2006; 74(11): 6046 - 6056. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-H. Liu, J. Qu, and X. Shen Thioredoxin-mediated Negative Autoregulation of Peroxisome Proliferator-activated Receptor {alpha} Transcriptional Activity Mol. Biol. Cell, April 1, 2006; 17(4): 1822 - 1833. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Soller, A. Tautenhahn, B. Brune, K. Zacharowski, S. John, H. Link, and A. von Knethen Peroxisome proliferator-activated receptor {gamma} contributes to T lymphocyte apoptosis during sepsis J. Leukoc. Biol., January 1, 2006; 79(1): 235 - 243. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Klotz, M. Schmidt, T. Giese, M. Sastre, P. Knolle, T. Klockgether, and M. T. Heneka Proinflammatory Stimulation and Pioglitazone Treatment Regulate Peroxisome Proliferator-Activated Receptor {gamma} Levels in Peripheral Blood Mononuclear Cells from Healthy Controls and Multiple Sclerosis Patients J. Immunol., October 15, 2005; 175(8): 4948 - 4955. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. J. Schopfer, Y. Lin, P. R. S. Baker, T. Cui, M. Garcia-Barrio, J. Zhang, K. Chen, Y. E. Chen, and B. A. Freeman Nitrolinoleic acid: An endogenous peroxisome proliferator-activated receptor {gamma} ligand PNAS, February 15, 2005; 102(7): 2340 - 2345. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Teissier, A. Nohara, G. Chinetti, R. Paumelle, B. Cariou, J.-C. Fruchart, R. P. Brandes, A. Shah, and B. Staels Peroxisome Proliferator-Activated Receptor {alpha} Induces NADPH Oxidase Activity in Macrophages, Leading to the Generation of LDL with PPAR-{alpha} Activation Properties Circ. Res., December 10, 2004; 95(12): 1174 - 1182. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Ma, X. Cui, S. Wang, J. Zhang, E. V. Nishanian, W. Wang, R. A. Wesley, and R. L. Danner Nitric oxide post-transcriptionally up-regulates LPS-induced IL-8 expression through p38 MAPK activation J. Leukoc. Biol., July 1, 2004; 76(1): 278 - 287. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Reddy, V. G. Keshamouni, S. H. Jaigirdar, X. Zeng, T. Leff, V. J. Thannickal, and T. J. Standiford Deactivation of murine alveolar macrophages by peroxisome proliferator-activated receptor-{gamma} ligands Am J Physiol Lung Cell Mol Physiol, March 1, 2004; 286(3): L613 - L619. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Dobrian, S. D. Schriver, A. A. Khraibi, and R. L. Prewitt Pioglitazone Prevents Hypertension and Reduces Oxidative Stress in Diet-Induced Obesity Hypertension, January 1, 2004; 43(1): 48 - 56. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. B. Schini-Kerth Homocysteine, a Proinflammatory and Proatherosclerotic Factor: Role of Intracellular Reactive Oxygen Species Circ. Res., August 22, 2003; 93(4): 271 - 273. [Full Text] [PDF] |
||||
![]() |
J. Zhang, S. Wang, R. A. Wesley, and R. L. Danner Adjacent Sequence Controls the Response Polarity of Nitric Oxide-sensitive Sp Factor Binding Sites J. Biol. Chem., August 1, 2003; 278(31): 29192 - 29200. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tautenhahn, B. Brune, and A. von Knethen Activation-induced PPAR{gamma} expression sensitizes primary human T cells toward apoptosis J. Leukoc. Biol., May 1, 2003; 73(5): 665 - 672. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |