The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shi, G.-X.
Right arrow Articles by Kehrl, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shi, G.-X.
Right arrow Articles by Kehrl, J. H.
The Journal of Immunology, 2002, 169: 2507-2515.
Copyright © 2002 by The American Association of Immunologists

RGS13 Regulates Germinal Center B Lymphocytes Responsiveness to CXC Chemokine Ligand (CXCL)12 and CXCL13

Geng-Xian Shi, Kathleen Harrison, Gaye Lynn Wilson, Chantal Moratz and John H. Kehrl1

B Cell Molecular Immunology Section, Laboratory of Immunoregulation, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Normal lymphoid tissue development and function depend upon directed cell migration. Providing guideposts for cell movement and positioning within lymphoid tissues, chemokines signal through cell surface receptors that couple to heterotrimeric G proteins, which are in turn subject to regulation by regulator of G protein signaling (RGS) proteins. In this study, we report that germinal center B lymphocytes and thymic epithelial cells strongly express one of the RGS family members, RGS13. Located between Rgs1 and Rgs2, Rgs13 spans 42 kb on mouse chromosome 1. Rgs13 encodes a 157-aa protein that shares 82% amino acid identity with its 159-aa human counterpart. In situ hybridization with sense and antisense probes localized Rgs13 expression to the germinal center regions of mouse spleens and Peyer’s patches and to the thymus medulla. Affinity-purified RGS13 Abs detected RGS13-expressing cells in the light zone of the germinal center. RGS13 interacted with both Gi{alpha} and Gq{alpha} and strongly impaired signaling through Gi-linked signaling pathways, including signaling through the chemokine receptors CXCR4 and CXCR5. Prolonged CD40 signaling up-regulated RGS13 expression in human tonsil B lymphocytes. These results plus previous studies of RGS1 indicate the germinal center B cells use two RGS proteins, RGS1 and RGS13, to regulate their responsiveness to chemokines.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Many cellular stimuli elicit physiological responses in target cells by activating receptors that couple to heterotrimeric G proteins. Activated receptors trigger G{alpha} subunits to exchange GTP for GDP, which leads to the dissociation of G{alpha} subunits from {beta}{gamma} heterodimers. Both GTP-bound G{alpha} and free {beta}{gamma} subunits activate downstream effectors. However, G{alpha} subunits possess an intrinsic GTPase activity that limits the duration that they remain GTP bound and able to trigger signaling (reviewed in Refs. 1, 2). Also limiting the duration of GTP-G{alpha}, members of the regulator of G protein signaling (RGS)2 protein family dramatically increase the intrinsic GTPase activity of G{alpha} subunits, a property that defines them as GTPase-activating proteins (GAPs). Genetic studies in yeast, Caenorhabditis elegans, and Aspergillus nidulans first identified such proteins (3, 4, 5). Suggesting that they function by binding of G{alpha} subunits, a yeast two-hybrid screen with a G{alpha} subunit identified a mammalian RGS protein termed G{alpha}-interacting protein (6). Cementing the functional relationship between the yeast and mammalian proteins, human RGS1, RGS2, RGS3, and RGS4 substituted to varying degrees for Sst2p, a yeast protein involved in the desensitization of pheromone signaling (7). Rapidly thereafter several studies demonstrated that RGS proteins possessed GAP activity for Gi and Gq subfamily members (8, 9, 10). Coding regions for ~25 human RGS proteins have now been identified. Two Rho guanine nucleotide exchange factors, which have a divergent RGS domain, selectively act as GAPs for G12{alpha} and G13{alpha} and recently another subfamily of RGS proteins have been identified that act as GAPs for Gs{alpha} (11, 12).

Renowned for their roles in the positioning and migration of lymphocytes within lymphoid tissues, chemokines signal thorough G protein-coupled receptors (GPCRs) that use Gi and Gq, thereby suggesting that chemokine responses depend in part upon the number and levels of RGS proteins that lymphocytes express (reviewed in Refs. 13, 14). RGS proteins may establish thresholds for responsiveness, provide a stop signal for migration, and/or contribute to receptor desensitization. Experimentally, the introduction of expression vectors for RGS1, RGS3, and RGS4 into B lymphocyte cell lines dramatically impaired chemokine-induced cell migration (15, 16, 17). Among the known chemokines and their receptors, CXC chemokine ligand (CXCL)12 via CXCR4, CXCL13 via CXCR4, and CXCL19 and CXCL21 via CCR7 provide critical positioning cues for B lymphocytes during B cell development and/or B cell immune responses (18, 19, 20, 21, 22, 23, 24).

Located within lymphoid tissues, germinal centers are sites critical for the generation of B cells with high-affinity Ag receptors (reviewed in Ref. 25). During the establishment of germinal centers, activated B cells and select T cells must migrate into the germinal center region from the B cell follicle. The acquisition of high-affinity Ag receptors, i.e., the affinity maturation of the B cell Ab response, likely depends upon the recirculation of B lymphocytes between the dark and light zones of the germinal center (26). Finally, select B cells leave the germinal center region destined to become plasma or memory B cells. The retention and migratory signals that orchestrate the movements of germinal center B cells remain only partially understood, although CXCL12/CXCR4 may direct plasma cell precursors from the germinal center region (27).

Among the RGS proteins expressed in B lymphocytes, RGS1 shows a prominent expression in germinal center B cells, CD38+/IgD-, sorted from human tonsil, while similarly sorted mantle zone B cells, CD38-/IgD+, lacked detectable RGS1 by immunoblotting (16). Surprisingly, we find that germinal center B cells prominently express another RGS protein, RGS13. Although RGS1 can be found in many other tissues beside B cells, RGS13 possesses a very restricted range of tissue expression. Beside characterizing RGS13 in B cells and B cell lines, we have also examined what signals modulate its expression, determined its intracellular localization, and examined its ability to modulate signaling through a variety of GPCRs including CXCR4 and CXCR5.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmids and reagents

The coding region of mouse RGS13 was isolated by PCR from a cDNA clone with GenBank number AW495950 and then subcloned into EcoRI/BamHI of p3XFLAG-CMV-14 (Sigma-Aldrich, St. Louis, MO) or pEGFP-N1 (Clontech Laboratories, Palo Alto, CA). The coding region of human RGS13 was inserted into EcoRI/BamHI sites of p3XFLAG-CMV-14. Human RGS13 C-terminal tagged with green fluorescent protein (GFP) was prepared by inserting it into pcDNA3.1/CT-GFP-topoisomerase (Invitrogen, Carlsbad, CA) and subsequently into the EcoRI site of pAAV-MCS (Stratagene, La Jolla, CA). The coding region of CXCR5 was isolated by RT-PCR using RNA prepared from human serum (HS)-Sultan cells and subcloned into the EcoRI site of pAAV-MCS. Dr. S. Gutkind (National Institute of Dental Research, National Institutes of Health, Bethesda, MD) kindly provided the expression vectors for the activated G{alpha} subunits. Human RGS1 and RGS3 C-terminal tagged with Flag were described previously (7, 16). The Abs against the following were purchased: FLAG (Sigma-Aldrich), phospho-p42/44 mitogen-activated protein kinase (MAPK; Cell Signaling, Beverly, MA), p42/44 MAPK, G{alpha}i2, G{alpha}q/11 and G{alpha}s (Santa Cruz Biotechnology, Santa Cruz, CA), CD11c, CD40, CD95, CD4, CD8, CD21, CD23, CD43, GR-1, and B220 (BD PharMingen, San Diego, CA).

Cell lines and cell cultures

The CA46 (a human Burkitt’s B cell lymphoma), Ramos (a human Burkitt’s B cell chronic lymphoma), Raji (a human Burkitt’s B cell chronic lymphoma), HS-Sultan (a B lineage human plasmacytoma), HR1 (a mouse normal spleen line), KG-1 (a human acute myelogenous leukemia), HEL92.1.7 (a human erythroleukemia), K562 (a human chronic myelogenous leukemia), HL-60 (a human promyelocytic leukemia), Jurkat (a human acute T cell leukemia line), MOLT-4 (a human T lineage leukemia), U937 (a human histiocytic lymphoma), HeLa (a human epitheloid carcinoma), 293T (a T Ag-transformed primary embryonal kidney line with transformation of adenovirus type 5 DNA), Chinese hamster ovary (CHO)-K1, COS (a SV40-transformed fibroblast like kidney line) were obtained from the American Type Culture Collection (Manassas, VA). The human Burkitt’s lymphoma cell lines COMER and JDRB were kind gifts from Dr. I. Magrath (National Cancer Institute, National Institutes of Health), and the human B cell line BJAB.6 and BHM23 were kind gifts from Dr. T. Folkes (Center for Disease Control and Prevention, Atlanta, GA). All of the lymphoid cell lines and the CHO cells were maintained in RPMI 1640 (Life Technologies, Gaithersburg, MD) supplemented with 10% FCS (Life Technologies), whereas the other nonlymphoid cells were maintained in DMEM (Life Technologies) plus 10% FCS.

Generation of polyclonal antisera to RGS13 and immunohistochemistry staining

A peptide based on a region of RGS13 amino acid sequence likely to be highly antigenic, QPQSPREINIDSTT, was synthesized and conjugated to keyhole limpet hemocyanin before injection into rabbits for the generation of polyclonal Abs. The rabbit serum was affinity purified using the RGS13 peptide (Covance, Princeton, NJ). The Ab recognizes both RGS13-GFP and RGS13-Flag when they are expressed in COS or HEK293 cells. For immunohistochemistry, frozen sections of spleen and thymus tissue were prepared. The frozen slides were fixed in cold acetone for 2 min. Endogenous peroxidase was quenched with DAKO peroxidase blocking reagent (DAKO, Carpinteria, CA). Endogenous biotin in tissue was blocked with an avidin-biotin blocking kit (Vector Laboratories, Burlingame, CA). The sections were preincubated in 5% goat serum in PBS and then overnight with anti-RGS13 rabbit polyclonal Abs diluted 1/100 in PBS with 0.1% Triton X-100 and 1% goat serum. The slides were washed with PBS, incubated with goat anti-rabbit IgG (Vectastain Elite avidin-biotin complex kit; Vector Laboratories), and then developed with diaminobenzidine substrate kit for peroxidase (Vector Laboratories). The slides were counterstained with hematoxylin, dehydrated, cleared in ethanol and xylene, and permanently mounted using Permount (Fisher Scientific, Pittsburgh, PA).

Isolation of cells and their analysis by RT-PCR and Western blotting

The tonsil B and T cells were isolated from tonsil mononuclear cells by two rounds of SRBC rosetting as previously described (16). The purity of tonsil B cells was routinely >95%. A total of 1 x 107 of the purified B cells were stimulated with various reagents for 4, 24, 48 h in RPMI 1640 supplemented with 10% FCS, respectively, at final concentration of 100 ng/ml CXCL12 (R&D Systems, Minneapolis, MN), 1 µg/ml CXCL13 (R&D Systems), 1 µg/ml anti-CD40 or anti-CD95 mAb, 20 µmol/L 1-palmitoyl-2-hydroxy-sn-glycero-3-phosphocholine (16/0; Avanti, Alabaster, AL), 4 µl/ml anti-human IgM (µ-chain-specific) antiserum, 100 ng/ml PMA, or 30 µmol/L L-{alpha}-lysophosphatidic acid (Sigma-Aldrich). The stimulated tonsil B cells were harvested and the total RNA was isolated with TRIzol reagents (Life Technologies) and then 2 µg total RNA was subsequently used for reverse transcription (Omniscript; Qiagen, Cologne, Germany). The following PCR primers were used for the PCR: RGS13, ATGAGCAGGCGGAATTGTTGGA and GAAACTGTTGTTGGACTGCATA; RGS1, CCAGGAATGTTCTTCTCTGCTAACCCA and TCACTTTAGGCTATTAGCCTGCAGG; and {beta}-actin-GTTTGAGACCTTCAACACCC and ATACTCCTGCTTGCTGATCC.

Mouse bone marrow cells were isolated from femur bones. A sample was taken for RNA isolation and the rest was used to isolate B220+ bright or B220+ dim from the lymphocyte-gated population by cell sorting. Briefly, the cells were incubated with mAbs to B220 and CD43, washed with staining buffer (PBS without Ca2+/Mg2+ plus 1% BSA fraction V), and sorted on the FACStarPlus (BD Biosciences, Mountain View, CA). B cells from mesenteric lymph node, peripheral lymph nodes, and Peyer’s patches were isolated by negative depletion. A single-cell suspension was made and treated with biotinylated Abs to CD4, CD8, CD11c, and GR-1 for 15 min at 4°C rotating. After washing, the cells were resuspended with streptavidin-conjugated Dynabeads (Dynal, Lake Success, NY) for 15 min at 4°C. Cell bead complexes were removed with a Dynal magnetic particle concentrator. The B cell purity obtained with this depletion procedure was 90–95%. To obtain activated splenic B cells, mice were immunized i.p. with a 10% SRBC solution and the spleens were harvested 7 days later. The B cells were isolated as described above. The splenic B cell subpopulations were isolated by staining single-cell suspensions of splenic B cells with mAbs CD21, CD23, and B220 and cell sorting on a FACStarPlus (BD Biosciences). The populations collected were CD21+/B220+, CD21+/CD23+/B220+, and B220+/CD21dim/CD23-. RNA from each cell population was used to generate cDNAs using the Clontech Advantage RT-PCR kit (Clontech Laboratories), following kit methodology using the Rgs13-specific primers GAAAATTGCTTCACGAAGGGG and GCATGTTTGAGTGGGTTCACGAATG. In addition, tonsil T and B cells and mouse spleen cell lysates were prepared using a kinase lysis buffer (20 mM HEPES (pH 7.4), 2 mM EGTA, 50 mM {beta}-glycerophosphate, 1% Triton X-100, 1 mM sodium orthovanadate, and 10% glycerol plus protease inhibitors). Thirty-microgram proteins of human tonsil T and B cells and mouse spleen lysates was fractionated by SDS-PAGE and transferred to pure nitrocellulose. The membrane was immunoblotted as below using a 1/500 diluted affinity-purified rabbit anti-mRGS13 polyclonal Ab.

Northern blots and in situ hybridization

For detecting human RGS13 expression, 20 µg total RNA was isolated from 19 cell lines using TRIzol reagents. The RNAs were size fractionated and transferred to nitrocellulose. The membranes were hybridized with a 480-bp RGS13 cDNA fragment labeled with [{alpha}-32P]dCTP using Prime-It RmT Random Primer Labeling kit (Stratagene, La Jolla, CA) as a probe. {beta}-actin expression was used as a control. Hybridization was performed at 68°C for 2 h using QuikHyb (Stratagene), washed three times in 2x SSC/0.1% SDS for 15 min each at room temperature, and then in 0.1x SSC/0.1% SDS at 60°C for 30 min. For detecting mouse Rgs13 expression, mouse tissue and embryo blots were purchased (Clontech Laboratories). The membranes were hybridized and processed similar to the human blots with the exception that a 480-bp Rgs13 cDNA fragment was used. For in situ hybridization, a 1076-bp fragment of the Rgs13 cDNA was subcloned into PCR 4-topoisomerase (Invitrogen). Antisense and sense RGS13 riboprobes were transcribed with T3 and T7 RNA polymerases in the presence of 35S-labeled UTP (Amersham Pharmacia Biotech, Piscataway, NJ). Mouse embryo sections of various developmental ages and sections of adult mouse organs were prepared at Molecular Histology Laboratories (Gaithersburg, MD). In situ hybridization was performed as previously described (28).

Intracellular localization of RGS13

Cells (HeLa, 293T, COS, CHO) grown in chamber slides (80% confluent) were transfected with constructs expressing RGS13-GFP or GFP using SuperFect (Qiagen) according to the manufacturer’s instruction, and the isolated and purified tonsil B cells were transfected with RGS13-GPF or GFP using a human B cell Nuleofector kit (Amaxa Biosystems, Koln, Germany) according to the user manual. The translocation experiments were performed in HeLa cells transfected with constructs expressing RGS13-GFP or GFP plus constructs that express different GTPase-deficient G{alpha} subunits. The slides were observed with an Olympus BX-60 microscope equipped with a BX-FLA fluorescent attachment or a laser confocal microscope (National Institute of Allergy and Infectious Diseases Imaging Unit, Dr. O. Schwartz).

Immunoblotting and immunoprecipitations

Cell lysates were prepared using an appropriate lysis buffer plus protease inhibitors for 20 min on ice. The detergent-insoluble materials were removed by microcentrifugation for 10 min at 4°C. Equal amounts of proteins from each sample were fractionated by 10% SDS-PAGE and transferred to pure nitrocellulose. Membranes were blocked with 5% BSA in Tween 20 plus Tris-buffered saline (TTBS) for 1 h and then incubated with an appropriate dilution of the primary Ab in 5% BSA in TTBS for 2 h or overnight. The blots were washed three times with TTBS before the addition of a biotinylated Ab (DAKO) diluted 1/5,000 in TTBS containing 5% BSA for 1 h and then incubated with streptavidin conjugated to HRP (DAKO) diluted 1/10,000 in TTBS containing 5% BSA for 1 h. The signal was detected by ECL according to the manufacturer’s instruction (Amersham Pharmacia Biotech). The coimmunoprecipitation of RGS13 and G{alpha} subunits was conducted in 293T cells transfected with C-terminal FLAG-tagged constructs of RGS13 or RGS3. Briefly, 293T cells were cultured in 100-mm plates and then transfected with 10 µg RGS constructs using SuperFect (Qiagen). After a 36-h incubation in DMEM, 293T cells were incubated in the presence or absence of aluminum fluoride (30 µM AlCl3, 10 mM NaF, and 10 mM MgCl2 in PBS) for 30 min on ice. The cells were lysed in kinase lysis buffer and anti-FLAG mAb was added, and the immunoprecipitates were collected with antimouse Ig-conjugated magnetic beads (Dynal). They were washed four times in lysis buffer, twice in lysis buffer with 0.5 M NaCl, twice again in lysis buffer, and then fractionated by SDS-PAGE and analyzed by immunoblotting with appropriate anti-G protein Ab. The efficiency of immunoprecipitation was verified by immunoblotting with anti-FLAG mAb.

MAPK assay

COS cells were transfected with appropriate receptor expression constructs (0.5 µg, respectively) in the presence or absence of RGS13, RGS1, or RGS3 (2.0 µg, respectively) using SuperFect. After starving the cells using fresh medium without FCS for 6 h, cells were stimulated with CXCL12 (100 ng/ml) or CXCL13 (250 ng/ml) for varying durations and then lysed with 300 µl lysis buffer. MAPK activation was detected by immunoblotting with anti-phospho-p42/44 MAPK mAb using detergent-soluble fractions of lysates after fractionation by SDS-PAGE.

Migration assay

CHO cells in six-well plates were transfected with or without constructs expressing CXCR4 plus or not RGS13-GFP or RGS1-GFP for 36 h and then harvested. The cells were loaded into the insert (8-µm pore size) of a Boyden chamber (Costar, Cambridge, MA) and fibronectin-coated bottom chamber (BD PharMingen), and the CXCL12 was added into the bottom chamber at a final concentration of 100 ng/ml. After a 6-h incubation at 37°C in a 5% CO2 incubator, the migrated cells were harvested and resuspended in 300 µl FACS buffer. The GFP-positive cells (included both weak and strongly positive cells) were counted using a FACS (BD PharMingen), and distribution of GFP expression in the loaded cells, migrated, and nonmigrated cells was determined. The percentage of migrating cells was calculated by dividing the number of GFP-positive cells in the migrated sample by the total number of GFP-positive cells loaded in the upper chamber.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of an Rgs13 cDNA and mapping the Rgs13 locus

Based on the known DNA sequence of a RGS13 cDNA (GenBank accession number AF030107), we screened the murine expressed sequence tag (EST) database at the National Center for Biotechnology Information and identified several likely ESTs derived from Rgs13. Complete nucleotide sequencing of a mouse B cell cDNA clone (GenBank accession number AW495950) revealed a 1262-bp cDNA predicted to encode a 157-aa protein 83% identical to human RGS13 (GenBank accession number AF498319, Fig. 1Go). We used the Rgs13 cDNA to construct a murine RGS13 expression vector and amplified the coding region for human RGS13 from reverse-transcribed human B cell mRNA to construct a human RGS13 expression vector. Human and mouse RGS13 are among the smallest of the RGS proteins composed largely of a RGS domain. Both human and mouse RGS13 have three cysteines in a configuration of CXXCXXC beginning at amino acid position 6.



View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 1. Genomic structure of Rgs13 and amino acid comparison of mouse RGS13, RGS1, and RGS2 and human RGS13. Exons are denoted by solid boxes and introns by solid lines. Introns drawn according to their relative sizes. The coding exons are indicated by their contribution to the RGS13 protein.

 
Using the mouse genome sequencing consortium database, we determined the chromosomal location and genomic structure of Rgs13. Composed of six exons, Rgs13 spans 42 kb on mouse chromosome 1. A surprisingly large intron of 29 kb separates exon 4 from exon 5. Four of the six Rgs13 exons are coding, the last three of which encode the RGS domain plus some flanking amino acid sequence (Fig. 1Go). Similar to RGS13, which sits between RGS1 and RGS2 on human chromosome 1, Rgs13 resides between Rgs1 and Rgs2 on mouse chromosome 1 (29).

Expression of Rgs13 mRNA and RGS13 protein

As a first check of Rgs13 expression, we searched the murine EST database using the Rgs13 cDNA sequence. We found Rgs13 expressed sequence tags from murine B cells (accession number AW495950), thymus (accession number BG089493), gallbladder (accession number BB871265), and neonatal cerebellum (accession number BB257313). Next, we examined Rgs13 expression in a variety of mouse tissues and RGS13 expression in human lymphoid and nonlymphoid cell lines by Northern blot analysis and RT-PCR and RGS13 expression in cell lysates from mouse spleen cells, human tonsil B cells, and from HS-Sultan cells by immunoblotting. Among the murine tissues tested, we found Rgs13 expressed in spleen, stomach, small intestine, and thymus as well in later stage mouse embryos. The Rgs13 mRNA transcripts ran as a single band of ~1.6 kb, suggesting that Rgs13 does not generate alternative mRNA transcripts (Fig. 2Go). Northern blot analysis of human cell lines revealed a restriction of RGS13 expression to B cell lines. Eight of the 19 cell lines tested were of B cell origin and all of them expressed RGS13. BJA-B and several of the Burkitt lymphoma cells lines expressed the highest levels of RGS13. In contrast, other hemopoietic cell lines, including T cell lines and nonhemopoietic cell lines, failed to express detectable levels of RGS13 mRNA (Fig. 2Go). To determine Rgs13 expression during B cell development and in different B cell populations, we used RT-PCR. We purified total bone marrow cells, bone marrow B220+ cells, newly formed splenic B cells, splenic marginal zone B cells, splenic follicular B cells, and B cells from immunized spleens, Peyer’s patches, mesenteric lymph nodes, or peripheral lymph nodes. The analysis revealed very weak Rgs13 expression in total bone marrow cells, but not in B220+ bone marrow cells. Because of the lack of Rgs13 in the B220+ cells in the bone marrow, we did not examine Rgs13 expression in finer detail during B cell development. Among the other cell fractions, we found the highest levels of Rgs13 expression in B cells purified from immunized mouse spleens and from Peyer’s patches (Fig. 2Go).



View larger version (48K):
[in this window]
[in a new window]
 
FIGURE 2. Analysis of Rgs13, and RGS13, and RGS13 expression. A–C, Northern blots of Rgs13 expression in indicated tissues and mouse embryos. Tissues indicated as well as age of embryos. Blot rehybridized with a {beta}-actin probe to verify equal loading. D, Northern blot of RGS13 expression in human cell lines. Cell lines analyzed are shown above the blot. {beta}-actin levels shown below. E, RT-PCR analysis of Rgs13 expression in purified cell populations from spleen and bone marrow. Spleen B cell populations were sorted into newly formed (NF), follicular (Fol), and mantle zone (MZ) on the basis of B220, CD21, and CD23 expression. Follicular cells are from two separate experiments. Total B cells were prepared from the spleen of a 7-day immunized mouse by negative selection (IB). Peripheral lymph node B cells (PLN), mesenteric lymph node B cells (MLN), and Peyer’s patch B cells were prepared by negative selection. Bone marrow cells were either unfractionated or sorted on the basis of B220 expression. The RNAs were analyzed for both Rgs13 and {beta}-actin expression. F, Immunoblot of protein lysates using affinity-purified anti-RGS13 peptide-specific Abs. Cell lysates were prepared from mouse spleen (postimmunization), human tonsil B cells, human tonsil T cells, a HS-Sultan cell subline that expresses high levels of endogenous RGS13, and COS cells transfected or not with a construct that expresses RGS13-GFP.

 
We raised and affinity-purified Abs against an RGS13 internal peptide conserved between human and mouse. The affinity-purified Abs recognized a 19-kDa band present in lysates prepared from human tonsil B cells, an HS-Sultan cell line, immunized mouse spleen, but not in a lysate from human tonsil T cells. The RGS13 Abs readily recognized a RGS13-GFP expressed in HEK293 cells as well as FLAG-tagged RGS13 (Fig. 2Go and data not shown).

Although Northern blot analysis detected Rgs13 expression in RNA prepared from developing mouse embryos, we did not visualize any Rgs13 expression by in situ hybridization upon examining sagittal sections prepared from e12.5, e14.5, e17.5, and newbornmice (data not shown). Apparently, there is insufficient Rgs13 expression in embryonic tissues to allow detection by a standard in situ hybridization protocol. Nevertheless, we readily detected Rgs13 expression by in situ hybridization using sections prepared from mouse spleen, ileum in the regions of Peyer’s patches, and thymus (Fig. 3Go). The spleen and thymus sections derived from nonimmunized, day 9, or day 14 postimmunized mice. We verified the development of germinal center in the B cell zones of the mouse spleens by detecting peanut agglutinin (PNA) staining within lymphoid follicles. Although we did not detect an Rgs13 hybridization signal in spleens from unimmunized mice, we found a strong signal in the germinal center regions of spleens from immunized mice. We also detected Rgs13 expression in mouse Peyer’s patches in the germinal center regions. Beside its expression in germinal centers, a very localized Rgs13 in situ signal overlaid the epithelial cells in the medullary region of the thymus, which occurred independent of the immunization status of the mice. Immunohistochemistry with affinity-purified RGS13 anti-peptide Abs also detected RGS13 expression in the germinal center region and the thymic medullary region (Fig. 3Go). The germinal center cells that reacted with the RGS13 Ab predominantly localized within the light zone region.



View larger version (123K):
[in this window]
[in a new window]
 
FIGURE 3. Analysis of Rgs13 expression by in situ hybridization and mouse RGS13 expression by immunohistochemistry. A, PNA staining of a spleen section from an unimmunized mouse (original magnification, x400). B, PNA staining of a spleen section from a day 9-immunized mouse showing germinal center (GC) development (original magnification, x400). C–E, Rgs13 expression in unimmunized, day 9, and day 14 postimmunization spleen sections (original magnification, x100, dark field). Germinal centers indicated by arrows. F, Sense probe applied to day 9-immunized spleen section (original magnification, x100). G, Rgs13 in germinal center (original magnification, x1000, bright field). H, Sense probe applied to day 9-immunized spleen section (original magnification, x1000, bright field). I, RGS13 expression mouse spleen germinal center. Brown staining is observed in a portion of the germinal center closest to the marginal zone (original magnification, x1000). J, Rgs13 expression in Peyer’s patches (PP) from mouse ileum (original magnification, x200, dark field). Arrow indicated hybridization signal. K, Rgs13 expression in Peyer’s patches from mouse ileum (original magnification, x1000, bright field). L, Rgs13 expression mouse thymus medulla (M) (original magnification, x200, dark field). M, Rgs13 expression in mouse thymus (original magnification, x1000, bright field). Thymus medulla (M) and cortex (C) indicated. N, Sense probe in mouse thymus (original magnification, x1000, bright field). O, RGS13 expression in mouse thymus by immunocytochemistry (original magnification, x400). P, Control Ab staining of mouse thymus (original magnification, x400). In the dark field photographs shown, the hybridization signal is observed as reflected silver grains (white) while in the bright field photographs the hybridization signal is visualized as dark grains.

 
Analysis of inductive stimuli for RGS13 expression

Next, we examined RGS13 expression in tonsil B cells stimulated with a variety of stimuli and compared the results to RGS1 expression levels. We prepared RNA from purified B cells stimulated with CXCL12, CXCL13, anti-CD40, anti-µ, PMA, L-{alpha}-lysophosphatidic acid, anti-Fas, or 1-palmitoyl-2-hydroxy-sn-glycero-3-phosphocholine for 4, 24, and 48 h and subjected the RNA to RT-PCR using either RGS13- or RGS1-specific primers. We observed that either CD40 or PMA augmented RGS13 expression at each of the time points while only PMA enhanced RGS1 expression at all three time points, although anti-µ enhanced RGS1 expression at 4 h (Fig. 4Go). CD40 stimulation had little effect on RGS1 expression as previously reported for Rgs1 (17). None of the other inductive stimuli significantly altered either RGS13 or RGS1 expression. Thus, RGS1 and RGS13 expression may respond to different stimuli, CD40 stimulation augments RGS13 while engagement of the B cell Ag receptor acts to enhance RGS1 expression.



View larger version (56K):
[in this window]
[in a new window]
 
FIGURE 4. Analysis of RGS13 and RGS1 expression in human tonsil B cells. Purified tonsil B cells were stimulated or not with the indicated reagents for 4, 24, and 48 h. Purified RNA was subjected to RT-PCR using RGS1, RGS13, and actin specific primers. Non-reverse transcriptase control shown (lane 11). Positive control was the appropriate plasmid DNA (lane 12). One-kilobase ladder run in lanes adjacent to lanes 1 and 12. PCR products are visualized by ethidium staining.

 
Intracellular localization of RGS13-GFP depends upon the cell type examined

The intracellular location of RGS proteins varies among the particular family members that have been examined. Constitutive plasma membrane, intracellular vesicle, cytoplasm, and intranuclear expression have all been documented as well as the recruitment from the cytosol to plasma membranes upon cell activation (30, 31, 32, 33). To examine RGS13 expression, we prepared expression vectors for human and murine RGS13 fused to GFP. We found in HEK293T cells and in COS cells that mouse RGS13-GFP predominantly resided within the nucleus although we also observed some plasma membrane expression, whereas in HeLa cells RGS13-GFP predominated in the cytoplasm (Fig. 5Go). Expression of GFP alone resulted in cytosolic expression in all of the cell types (data not shown). Coexpression of different GTPase-deficient G{alpha} subunits altered RGS13-GFP localization in HeLa cells (Fig. 5Go), although they failed to significantly alter the intracellular localization of GFP (data not shown). Coexpression with an active form of Gi{alpha} caused RGS13-GFP to accumulate at intracellular junctions; coexpression with an active form of Gq{alpha} altered the morphology of the HeLa cells, but did not substantially change the localization of RGS13-GFP; surprisingly, the coexpression with an active form of Gs{alpha} shifted RGS13-GFP from the cytoplasm to the nucleus; and coexpression with an active form of Go{alpha} resulted in a perinuclear accumulation of RGS13-GFP. To examine RGS13-GFP in human B cells, we introduced either human or mouse RGS13-GFP into purified human B cells and examined its intracellular location by confocal imaging. Like the results with HeLa cells RGS13-GFP localized predominantly in the cytoplasm of primary human B cells (Fig. 5Go).



View larger version (141K):
[in this window]
[in a new window]
 
FIGURE 5. Analysis of RGS13-GFP expression in various cell types. Constructs expressing RGS13-GFP were transfected into 293T cells (A), COS cells (B), HeLa (C–G), or human tonsil B lymphocytes (H and I). Cells were cotransfected with expression vectors for constitutively active forms of G{alpha}i (D), G{alpha}q (E), G{alpha}s (F), or Go{alpha} (G). A construct expressing mouse RGS13-GFP was used with the exception of the cell shown in I where a construct expressing human RGS13-GFP was used instead. H and I, Confocal images.

 
Interaction with G proteins and regulation of GPCR signaling by RGS13

Comparison of the RGS13 amino acid sequence with that of RGS proteins reveals that RGS13 has a number of substitutions in amino acids conserved among other family members. Among the 120-aa RGS domain 40 aa are strongly conserved between the RGS proteins that possess Gi and/or Gq GAP activity. Substitutions occur in 7 of those 40 aa in RGS13 while 0 substitutions occur in RGS1 and only 3 in RGS2. However, G{alpha} pull-down and functional signaling experiments indicate that RGS13 affects Gi{alpha} and Gq{alpha} signaling in a manner similar to that of other RGS proteins. Pull-down experiments using the FLAG Ab to immunoprecipitate either FLAG-RGS13 or a control RGS protein, FLAG-RGS3, expressed in HEK293T cells demonstrated the interaction of RGS13 with both Gi{alpha} and Gq{alpha} (Fig. 6Go). As previously shown with other RGS proteins, demonstration of that interaction depends upon the prior treatment of the cell lysates with aluminum fluoride (8, 9). When expressed in cells we found that the mouse RGS13-FLAG routinely ran as a doublet while human RGS13 ran as a single band on SDS-PAGE.



View larger version (95K):
[in this window]
[in a new window]
 
FIGURE 6. Interaction of RGS13 with endogenous G{alpha} subunits. HEK293T cells were transfected with expression vectors for RGS3-Flag (lanes 2 and 6), mouse RGS13-Flag (lanes 3 and 7), or human RGS13-Flag (lanes 4 and 8). The cell lysates were either not treated (lanes 1–4) or treated with AlF4- (lanes 5–8). Flag immunoprecipitates (IP) were isolated. Abs specific for G{alpha}i2, G{alpha}q/11, G{alpha}s, or Flag were used to immunoblot the immunoprecipitates and the cell lysates.

 
Next, we examined the effect of RGS13 on signaling through a number of different GPCRs using either COS or HEK293T transfected with an expression vector for an individual GPCR in the presence or absence of expression vectors for human RGS13, mouse RGS13, or human RGS3. Following exposure to the appropriate ligand, we measured either the production of inositol triphosphates, the production of cAMP, the activation of a NF-{kappa}B reporter gene, the activation of a serum-response element-dependent reporter gene, or the phosphorylation of endogenous p42 MAPK. RGS13 had no effect on {beta}-adrenergic receptor-mediated cAMP production (Gs dependent); it inhibited angiotensin receptor-induced p42 MAPK phosphorylation (Gq dependent) by ~60% at 5, 10, and 15 min following stimulation; it inhibited M1 muscarinic receptor-induced inositol triphosphate production (Gq dependent) by ~40%, and it partially inhibited M1 muscarinic receptor-mediated serum-response element and NF-{kappa}B activation (Gq and G12/13 dependent) by 35 and 60%, respectively. In each instance, human and murine RGS13 performed similarly, although in each case RGS3 expression provided a greater degree of inhibition than did RGS13 (data not shown). Expression of RGS13 also very modestly inhibited the activation of the serum-response element reporter following stimulation with activated forms of G12{alpha} or G13{alpha}; however, whether this represents a significant effect on G12 and G13 signaling need further investigation (data not shown).

Because of the likely importance of RGS13 in modulating the response of germinal center B cells to chemokines, we also compared the effect of RGS3 and RGS13 on signaling through the CXCR4 and CXCR5 receptors. We transfected COS cells with either the CXCR4 or CXCR5 receptors in the presence or absence of expression vectors for human RGS13, mouse RGS13, or human RGS3. We stimulated the cells with either CXCL12 or CXCL13 and measured the phosphorylation of endogenous p42 MAPK (Fig. 7Go). We found that both human and mouse RGS13 potently inhibited the production of phosphorylated p42 MAPK following exposure to CXCL12 (equivalent or even superior to RGS3) or CXCL13 (nearly equivalent to RGS3). Because germinal center B cells can express either or potentially both RGS13 and RGS1, we directly compared RGS1 and RGS13 on CXCR4 and CXCR5 signaling. At equivalent levels of expression RGS13 proved superior to RGS1 in its ability to inhibit CXCR4 and CXCR5 signaling to p42 MAPK activation 5 min poststimulation (Fig. 7Go). We observed similar results at 2 and 10 min following exposure to ligand (data not shown). Pertussis toxin, an inhibitor of Gi{alpha} signaling, also potently inhibited CXCR4 and CXCR5 induced p42 MAPK phosphorylation consistent with the know importance of Gi{alpha} in chemokine signaling (34, 35).



View larger version (48K):
[in this window]
[in a new window]
 
FIGURE 7. RGS13 inhibits CXCL12 and CXCL13 signaling. A, Inhibition of CXCL12-induced phosphorylated MAPK. COS cells were transfected with an expression vector for CXCR4 (lanes 1–16) in the presence or absence of expression vectors for human RGS3 (hRGS3, lanes 4, 8, 12, and 16), human RGS13 (hRGS13, lanes 2, 6, 10, and 14), or mouse RGS13 (mRGS13, lanes 3, 7, 11, and 15). The cells (lanes 5–16) were stimulated with CXCL12 for 2, 5, or 10 min. The amount of phosphorylated p42 MAPK (phospho-p42 MAPK) induced was detected with a specific Ab by immunoblotting. The levels of human RGS3, human RGS13, mouse RGS13, and p42/44 MAPK are shown. B, Inhibition of CXCL13-induced phospho-p42 MAPK. Similar experiment as shown in the first panel except the cells were transfected with CXCR5 rather than CXCR4. The cells were stimulated with CXCL13 for 5, 10, or 15 min. C, Comparison of RGS1 and RGS13 on chemokine signaling. Similar experimental design as first two panels. The cells were transfected with the indicated expression vectors and stimulated with CXCL12 or CXCL13 for 5 min. The levels of phospho-p42 MAPK, hRGS1, hRGS13, hRGS3, and p42/44 MAPK are shown.

 
Finally, we examined the ability of RGS13 to inhibit cell migration by using a transient transfection system and CHO cells. We transfected CHO cells with an expression vector for CXCR4 in the presence of an expression vector for either GFP, mouse RGS13-GFP, human RGS13-GFP, or human RGS1-GFP. We determined the number of GFP-positive cells loaded in the upper well of a chemotaxis chamber and the number of GFP-positive cells in the bottom chamber following a 6-h chemotaxis assay. We found that CHO cells transfected with the CXCR4R migrated in response to stimulation with CXCL12 and that the transfection of either mouse or human RGS13-GFP or human RGS1-GFP substantially inhibited CHO cell migration as compared with GFP alone (Fig. 8Go). Thus, the expression of RGS13 can inhibit cell migration in response to chemokine stimulation.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 8. RGS13 inhibits CXCL12-induced migration of CXCR4-expressing CHO cells. CHO cells were transfected with constructs expressing CXCR4 and either GFP, human RGS13-GFP (hRGS13-GFP), mouse RGS13-GFP (mRGS13-GFP), or human RGS1-GFP (hRGS1-GFP). The numbers of GFP-positive cells loaded into the upper portion of chemotaxis chambers were enumerated as well as the number of GPF-positive cells that migrated into the CXCL12-containing bottom well. The percentage of GFP-positive cells that migrated was calculated. The data are from one experiment of two performed. The controls are the mean ± SEM of six wells, while the others are the mean ± SEM of three wells.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this report, we describe the isolation of Rgs13 cDNAs and the mapping of the Rgs13 genomic locus on chromosome 1. We show that Rgs13 has a restricted range of tissue expression with B lymphocytes, one of the major sites of its expression. We document strong Rgs13 expression in the germinal center regions of mouse spleen, in Peyer’s patches, and in the thymus; however, not in thymic lymphocytes. Despite a number of nonconservative substitutions in its RGS domain, RGS13 potently inhibits signaling through GPCRs that couple to Gi{alpha} and to a lesser extent to those that couple to Gq{alpha}. A direct comparison with RGS1 indicates that at similar expression levels RGS13 more potently inhibits CXCL12 and CXCL13 signaling although RGS1 and RGS13 similarly inhibited the migration of CXCR4 transfected CHO cells. Based on the localization of a RGS13-GFP fusion protein, RGS13 largely resides in the cytoplasm of B lymphocytes. However, analysis of spleen sections from a recently immunized mouse suggested prominent membrane localization in germinal center B cells. We also show that CD40 signaling preferentially regulates RGS13 expression whereas signaling through the B cell Ag receptor preferentially regulates RGS1 expression.

Beside Rgs13, lymphocytes also express Rgs1 and Rgs2. Interestingly, these three genes are clustered together on chromosome 1, both in mice and humans (30). Rgs1 and Rgs13 are separated by 48 kb while Rgs13 and Rgs2 are located 139 kb apart. There are no known intervening genes between these loci. A search of the mouse EST database using the intervening DNA sequence between Rgs1 and Rgs13 failed to identify any novel coding regions (J. Kehrl, unpublished observation). Determining the DNA regulatory regions that control expression of these three genes should provide some insights into the mechanisms that account for their overlapping and restricted patterns of expression. The close juxtaposition of Rgs1, Rgs13, and Rgs2 complicates the creation of double or triple null animals, likely requiring independent targeting of each locus. Also, it may pose difficulties for the analysis of mice with targeted disruption of one of these loci because of potential effects on the adjacent loci or possible compensatory mechanisms.

RGS13 inhibited both the activation of MAPK in response to CXCR4 and CXCR5 signaling in COS cells and the migration of CXCR4 expressing CHO cells. In preliminary experiments, we have found that the introduction of RGS13 into a human B cell line as a GFP fusion protein reduces the migration of the derived cell lines to either CXCL12 or CXCL13 when compared with control cell lines. In addition, the introduction of an RGS13 cDNA in an antisense orientation into a RGS13-expressing B cell line enhances the migration of the derived cell lines to the same chemokines when compared with control cells (G.-X. Shi, unpublished observations). Thus, a major role for RGS13 may be to regulate the responsiveness of germinal center B cells to chemokines.

The major questions unanswered by this study are precisely what role Rgs13 plays in germinal B cell function and why should germinal center B cells use multiple RGS proteins. To begin to answer these questions, we need to unambiguously ascertain which germinal center B cells express Rgs13 and which Rgs1. The RGS13 Ab used in this study reacted with a limited number of cells in the light zone of the germinal center, yet the in situ hybridization study detected Rgs13 expression in a higher percentage of the germinal center cells. Varying sensitivities of the two methods or protein instability may account for the failure of the mRNA and protein to perfectly colocalize; however, additional studies are needed to resolve this inconsistency. Providing a possible mechanism to differentially express Rgs13 and Rgs1 during the recruitment and trafficking of B cells through the germinal center, CD40 and Ig stimulation distinctively regulated RGS1 and RGS13 expression. Current models of germinal center formation and maintenance suggest a temporal dissociation between these signals (36, 37, 38). Based on the known functions of RGS proteins and our current studies of RGS13, we can speculate on what functional roles RGS13 may have in germinal B cell function. Our current hypothesis based on both in vitro studies and ongoing studies of RGS1-/- mice (C. Moratz, manuscript in preparation) is that a major function of RGS proteins in lymphocytes is to help them negotiate a complex chemokine milieu. Since RGS proteins may exhibit some degree of receptor selectivity the simple expression of RGS13 could bias a cell to preferentially respond to one source of chemoattractant vs another. An intriguing idea is that RGS proteins may be asymmetrically expressed within the cell. Such intracellular localization of RGS13 could allow for directional migratory responses in response to conflicting chemotactic signals. Another possibility is that RGS proteins such as RGS13 participate in chemokine receptor desensitization, thereby allowing the cell to desensitize to a primary chemokine gradient and response to a second one. A likely site of conflicting chemoattractants gradients is the light zone of the germinal center, where B cells have several alternative fates. They may undergo apoptosis, re-enter the dark zone, or leave the germinal center. RGS13 may assist the B cells in making these decisions.

Our results differ slightly from those recently published that characterized human RGS13 (39). The expression data reported in that study agreed with our results although we have provided more detailed information and focused on Rgs13 expression. In contrast, to Johnson and Druey (39), we failed to detect any effect of RGS13 on either signaling through Gs-coupled receptors or G{alpha}qQL signaling, although we agree on the effect of RGS13 on Gi- and Gq-coupled receptors. In addition, we examined the effects of RGS13 on signaling through GPCRs used by B lymphocytes. We expressed both human and mouse RGS13 as Flag-tagged proteins, whereas Johnson and Druey (39) had difficulties in detecting a tagged version of human RGS13 and resorted to using a GPF fusion protein. Perhaps contributing to our success, we used a C-terminal triple Flag tag. The difference between RGS13-GFP and RGS13-Flag may account for some of the differences in signaling data. We have also repeated some of the signaling experiments expressing untagged versions of human and mouse RGS13 with similar results (G. Shi, unpublished data). Also in contradistinction to the Johnson and Druey study (39), we could detect endogenous RGS13 by immunoblotting. We made affinity-purified anti-peptide Abs against three RGS13 peptides: a C-terminal, N-terminal, and an internal peptide. Only those made against the internal RGS13 peptide proved useful for immunoblotting and immunohistochemistry. Finally, while similar to Johnson and Druey (39), we noted that some cell types express RGS13-GFP within their nuclei, and we found significant differences in its intracellular localization depending upon the cell line chosen and no evidence that B lymphocytes express RGS13 within their nuclei. Thus, the intracellular localization of an RGS-GFP fusion protein in heterologous cells may not help predict the intracellular location of the endogenous RGS proteins.

In conclusion, Rgs13 possesses one of the most limited patterns of expression of the known RGSs. Notable among the cell types that express Rgs13 are germinal center B lymphocytes. The complicated trafficking pattern that B cells undergo during their transit through the germinal center along with the known ability of RGS proteins to regulate chemokine receptor signaling implicates Rgs13 in the control of B cell migration within this microenvironment. Yet germinal center B cells do not rely on Rgs13 alone, but also express Rgs1 and likely other RGSs. Germinal center B cells likely employ these RGS proteins to provide stop signals, set thresholds for responses, and assist in chemokine desensitization, a likely requirement for cells to negotiate complex chemokine networks.


    Acknowledgments
 
We thank Mary Rust for her editorial assistance, Dr. Louis Staudt for disclosing array data that supported an up-regulation of RGS13 expression in germinal center B cells, and Dr. Anthony Fauci for his continued support.


    Footnotes
 
1 Address correspondence and reprint requests to Dr. John H. Kehrl, Building 10, Room 11B10, Laboratory of Immunoregulation, National Institute of Allergy and Infectious Diseases, National Institutes of Health, 9000 Rockville Pike, Bethesda, MD 20892-1876. E-mail address: jkehrl{at}niaid.nih.gov Back

2 Abbreviations used in this paper: RGS, regulator of G protein signaling; GAP, GTPase-activating protein; GPCR, G protein-coupled receptor; GFP, green fluorescent protein; HS, human serum; MAPK, mitogen-activated protein kinase; CHO, Chinese hamster ovary; EST, expressed sequence tag; PNA, peanut agglutinin; CXCL, CXC chemokine ligand. Back

Received for publication May 3, 2002. Accepted for publication June 26, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hepler, J. R., A. G. Gilman. 1992. G proteins. Trends Biochem. Sci. 17:383.[Medline]
  2. Neer, E. J.. 1995. Heterotrimeric G proteins: organizers of transmembrane signals. Cell 80:249.[Medline]
  3. Dietzel, C., J. Kurjan. 1987. Pheromonal regulation and sequence of the Saccharomyces cerevisiae SST2 gene: a model for desensitization to pheromone. Mol. Cell. Biol. 7:4169.[Abstract/Free Full Text]
  4. Koelle, M. R., H. R. Horvitz. 1996. EGL-10 regulates G protein signaling in the C. elegans nervous system and shares a conserved domain with many mammalian proteins. Cell 84:115.[Medline]
  5. Lee, B. N., T. H. Adams. 1994. Overexpression of flbA, an early regulator of Aspergillus asexual sporulation, leads to activation of brlA and premature initiation of development. Mol. Microbiol. 14:323.[Medline]
  6. De Vries, L., M. Mousli, A. Wurmser, M. G. Farquhar. 1995. GAIP, a protein that specifically interacts with the trimeric G protein G{alpha}i3, is a member of a protein family with a highly conserved core domain. Proc. Natl. Acad. Sci. USA 92:11916.[Abstract/Free Full Text]
  7. Druey, K. M., K. J. Blumer, V. H. Kang, J. H. Kehrl. 1996. Inhibition of G-protein-mediated MAP kinase activation by a new mammalian gene family. Nature 379:742.[Medline]
  8. Berman, D. M., T. M. Wilkie, A. G. Gilman. 1996. GAIP and RGS4 are GTPase-activating proteins for the Gi subfamily of G protein {alpha} subunits. Cell 86:445.[Medline]
  9. Watson, N., M. E. Linder, K. M. Druey, J. H. Kehrl, K. J. Blumer. 1996. RGS family members: GTPase-activating proteins for heterotrimeric G-protein {alpha}-subunits. Nature 383:172.[Medline]
  10. Hunt, T. W., T. A. Fields, P. J. Casey, E. G. Peralta. 1996. RGS10 is a selective activator of G{alpha}i GTPase activity. Nature 383:175.[Medline]
  11. Kozasa, T., X. Jiang, M. J. Hart, P. M. Sternweis, W. D. Singer, A. G. Gilman, G. Bollag, P. C. Sternweis. 1998. p115 RhoGEF, a GTPase activating protein for G{alpha}12 and G{alpha}13. Science 280:2109.[Abstract/Free Full Text]
  12. Zheng, B., Y. C. Ma, R. S. Ostrom, C. Lavoie, G. N. Gill, P. A. Insel, X. Y. Huang, M. G. Farquhar. 2001. RGS-PX1, a GAP for G{alpha}S and sorting nexin in vesicular trafficking. Science 294:1939.[Abstract/Free Full Text]
  13. Ansel, K. M., J. G. Cyster. 2001. Chemokines in lymphopoiesis and lymphoid organ development. Curr. Opin. Immunol. 13:172.[Medline]
  14. Kehrl, J. H.. 1998. Heterotrimeric G protein signaling: roles in immune function and fine-tuning by RGS proteins. Immunity 8:1.[Medline]
  15. Bowman, E. P., J. J. Campbell, K. M. Druey, A. Scheschonka, J. H. Kehrl, E. C. Butcher. 1998. Regulation of chemotactic and proadhesive responses to chemoattractant receptors by RGS (regulator of G-protein signaling) family members. J. Biol. Chem. 273:28040.[Abstract/Free Full Text]
  16. Moratz, C., V. H. Kang, K. M. Druey, C. S. Shi, A. Scheschonka, P. M. Murphy, T. Kozasa, J. H. Kehrl. 2000. Regulator of G protein signaling 1 (RGS1) markedly impairs Gi{alpha} signaling responses of B lymphocytes. J. Immunol. 164:1829.[Abstract/Free Full Text]
  17. Reif, K., J. G. Cyster. 2000. RGS molecule expression in murine B lymphocytes and ability to down-regulate chemotaxis to lymphoid chemokines. J. Immunol. 164:4720.[Abstract/Free Full Text]
  18. Nagasawa, T., S. Hirota, K. Tachibana, N. Takakura, S. Nishikawa, Y. Kitamura, N. Yoshida, H. Kikutani, T. Kishimoto. 1996. Defects of B-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature 382:635.[Medline]
  19. Zou, Y. R., A. H. Kottmann, M. Kuroda, I. Taniuchi, D. R. Littman. 1998. Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development. Nature 393:595.[Medline]
  20. Forster, R., A. E. Mattis, E. Kremmer, E. Wolf, G. Brem, M. Lipp. 1996. A putative chemokine receptor, BLR1, directs B cell migration to defined lymphoid organs and specific anatomic compartments of the spleen. Cell 87:1037.[Medline]
  21. Gunn, M. D., V. N. Ngo, K. M. Ansel, E. H. Ekland, J. G. Cyster, L. T. Williams. 1998. A B-cell-homing chemokine made in lymphoid follicles activates Burkitt’s lymphoma receptor-1. Nature 391:799.[Medline]
  22. Legler, D. F., M. Loetscher, R. S. Roos, I. Clark-Lewis, M. Baggiolini, B. Moser. 1998. B cell-attracting chemokine 1, a human CXC chemokine expressed in lymphoid tissues, selectively attracts B lymphocytes via BLR1/CXCR5. J. Exp. Med. 187:655.[Abstract/Free Full Text]
  23. Forster, R., A. Schubel, D. Breitfeld, E. Kremmer, I. Renner-Muller, E. Wolf, M. Lipp. 1999. CCR7 coordinates the primary immune response by establishing functional microenvironments in secondary lymphoid organs. Cell 99:23.[Medline]
  24. Reif, K., E. H. Ekland, L. Ohl, H. Nakano, M. Lipp, R. Forster, J. G. Cyster. 2002. Balanced responsiveness to chemoattractants from adjacent zones determines B-cell position. Nature 416:94.[Medline]
  25. MacLennan, I. C.. 1994. Germinal centers. Annu. Rev. Immunol. 12:117.[Medline]
  26. Meyer-Hermann, M., A. Deutsch, M. Or-Guil. 2001. Recycling probability and dynamical properties of germinal center reactions. J. Theor. Biol. 210:265.[Medline]
  27. Hargreaves, D. C., P. L. Hyman, T. T. Lu, V. N. Ngo, A. Bidgol, G. Suzuki, Y. R. Zou, D. R. Littman, J. G. Cyster. 2001. A coordinated change in chemokine responsiveness guides plasma cell movements. J. Exp. Med. 194:45.[Abstract/Free Full Text]
  28. Hong, J. X., G. L. Wilson, C. H. Fox, J. H. Kehrl. 1993. Isolation and characterization of a novel B cell activation gene. J. Immunol. 150:3895.[Abstract]
  29. Sierra, D. A., D. J. Gilbert, D. Householder, N. V. Grishin, K. Yu, P. Ukidwe, S. A. Barker, W. He, T. G. Wensel, G. Otero, et al 2002. Evolution of the regulators of G-protein signaling multigene family in mouse and human. Genomics 79:177.[Medline]
  30. Druey, K. M., B. M. Sullivan, D. Brown, E. R. Fischer, N. Watson, K. J. Blumer, C. R. Gerfen, A. Scheschonka, J. H. Kehrl. 1998. Expression of GTPase-deficient Gi{alpha}2 results in translocation of cytoplasmic RGS4 to the plasma membrane. J. Biol. Chem. 273:18405.[Abstract/Free Full Text]
  31. De Vries, L., E. Elenko, J. M. McCaffery, T. Fischer, L. Hubler, T. McQuistan, N. Watson, M. G. Farquhar. 1998. RGS-GAIP, a GTPase-activating protein for G{alpha}i heterotrimeric G proteins, is located on clathrin-coated vesicles. Mol. Biol. Cell 9:1123.[Abstract/Free Full Text]
  32. Dulin, N. O., A. Sorokin, E. Reed, S. Elliott, J. H. Kehrl, M. J. Dunn. 1999. RGS3 inhibits G protein-mediated signaling via translocation to the membrane and binding to G{alpha}11. Mol. Cell. Biol. 19:714.[Abstract/Free Full Text]
  33. Chatterjee, T. K., R. A. Fisher. 2000. Cytoplasmic, nuclear, and Golgi localization of RGS proteins: evidence for N-terminal and RGS domain sequences as intracellular targeting motifs. J. Biol. Chem. 275:24013.[Abstract/Free Full Text]
  34. Arai, H., C. L. Tsou, I. F. Charo. 1997. Chemotaxis in a lymphocyte cell line transfected with C-C chemokine receptor 2B: evidence that directed migration is mediated by {beta}{gamma} dimers released by activation of G{alpha}i-coupled receptors. Proc. Natl. Acad. Sci. USA 94:14495.[Abstract/Free Full Text]
  35. Neptune, E. R., H. R. Bourne. 1997. Receptors induce chemotaxis by releasing the {beta}{gamma} subunit of Gi, not by activating Gq or Gs. Proc. Natl. Acad. Sci. USA 94:14489.[Abstract/Free Full Text]
  36. Kosco-Vilbois, M. H., J. Y. Bonnefoy, Y. Chvatchko. 1997. The physiology of murine germinal center reactions. Immunol. Rev. 156:127.[Medline]
  37. Choi, Y. S.. 1997. Differentiation and apoptosis of human germinal center B-lymphocytes. Immunol. Res. 16:161.[Medline]
  38. Jones, D.. 2002. Dismantling the germinal center: comparing the processes of transformation, regression, and fragmentation of the lymphoid follicle. Adv. Anat. Pathol. 9:129.[Medline]
  39. Johnson, E. N., K. M. Druey. 2002. Functional characterization of the G protein regulator RGS13. J. Biol. Chem. 1:1.[Free Full Text]



This article has been cited by other articles:


Home page
BloodHome page
W. J. Chng, E. D. Remstein, R. Fonseca, P. L. Bergsagel, J. A. Vrana, P. J. Kurtin, and A. Dogan
Gene expression profiling of pulmonary mucosa-associated lymphoid tissue lymphoma identifies new biologic insights with potential diagnostic and therapeutic applications
Blood, January 15, 2009; 113(3): 635 - 645.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Bansal, J. A. DiVietro, H. S. Kuehn, S. Rao, K. H. Nocka, A. M. Gilfillan, and K. M. Druey
RGS13 Controls G Protein-Coupled Receptor-Evoked Responses of Human Mast Cells
J. Immunol., December 1, 2008; 181(11): 7882 - 7890.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. M. Tomayko, S. M. Anderson, C. E. Brayton, S. Sadanand, N. C. Steinel, T. W. Behrens, and M. J. Shlomchik
Systematic Comparison of Gene Expression between Murine Memory and Naive B Cells Demonstrates That Memory B Cells Have Unique Signaling Capabilities
J. Immunol., July 1, 2008; 181(1): 27 - 38.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. W. Tun, D. Personett, K. A. Baskerville, D. M. Menke, K. A. Jaeckle, P. Kreinest, B. Edenfield, A. C. Zubair, B. P. O'Neill, W. R. Lai, et al.
Pathway analysis of primary central nervous system lymphoma
Blood, March 15, 2008; 111(6): 3200 - 3210.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Bhattacharya, M. T. Cheah, C. B. Franco, N. Hosen, C. L. Pin, W. C. Sha, and I. L. Weissman
Transcriptional Profiling of Antigen-Dependent Murine B Cell Differentiation and Memory Formation
J. Immunol., November 15, 2007; 179(10): 6808 - 6819.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. Piovan, V. Tosello, S. Indraccolo, M. Masiero, L. Persano, G. Esposito, R. Zamarchi, M. Ponzoni, L. Chieco-Bianchi, R. Dalla-Favera, et al.
Differential Regulation of Hypoxia-Induced CXCR4 Triggering during B-Cell Development and Lymphomagenesis
Cancer Res., September 15, 2007; 67(18): 8605 - 8614.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. D. Johnson, M. E. Boyer, J.-A. Kang, A. Wickrema, A. B. Cantor, and E. H. Bresnick
Friend of GATA-1-independent transcriptional repression: a novel mode of GATA-1 function
Blood, June 15, 2007; 109(12): 5230 - 5233.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J.-I. Han, N.-N. Huang, D.-U. Kim, and J. H. Kehrl
RGS1 and RGS13 mRNA silencing in a human B lymphoma line enhances responsiveness to chemoattractants and impairs desensitization
J. Leukoc. Biol., June 1, 2006; 79(6): 1357 - 1368.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
I. Airoldi, L. Raffaghello, E. Piovan, C. Cocco, B. Carlini, A. Amadori, M. V. Corrias, and V. Pistoia
CXCL12 Does Not Attract CXCR4+ Human Metastatic Neuroblastoma Cells: Clinical Implications
Clin. Cancer Res., January 1, 2006; 12(1): 77 - 82.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Berthebaud, C. Riviere, P. Jarrier, A. Foudi, Y. Zhang, D. Compagno, A. Galy, W. Vainchenker, and F. Louache
RGS16 is a negative regulator of SDF-1-CXCR4 signaling in megakaryocytes
Blood, November 1, 2005; 106(9): 2962 - 2968.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Le, M. Honczarenko, A. M. Glodek, D. K. Ho, and L. E. Silberstein
CXC Chemokine Ligand 12-Induced Focal Adhesion Kinase Activation and Segregation into Membrane Domains Is Modulated by Regulator of G Protein Signaling 1 in Pro-B Cells
J. Immunol., March 1, 2005; 174(5): 2582 - 2590.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. D. Estes, T. C. Thacker, D. L. Hampton, S. A. Kell, B. F. Keele, E. A. Palenske, K. M. Druey, and G. F. Burton
Follicular Dendritic Cell Regulation of CXCR4-Mediated Germinal Center CD4 T Cell Migration
J. Immunol., November 15, 2004; 173(10): 6169 - 6178.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. V. Gulino, D. Moratto, S. Sozzani, P. Cavadini, K. Otero, L. Tassone, L. Imberti, S. Pirovano, L. D. Notarangelo, R. Soresina, et al.
Altered leukocyte response to CXCL12 in patients with warts hypogammaglobulinemia, infections, myelokathexis (WHIM) syndrome
Blood, July 15, 2004; 104(2): 444 - 452.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Moratz, J. R. Hayman, H. Gu, and J. H. Kehrl
Abnormal B-Cell Responses to Chemokines, Disturbed Plasma Cell Localization, and Distorted Immune Tissue Architecture in Rgs1-/- Mice
Mol. Cell. Biol., July 1, 2004; 24(13): 5767 - 5775.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Corcione, N. Arduino, E. Ferretti, L. Raffaghello, S. Roncella, D. Rossi, F. Fedeli, L. Ottonello, L. Trentin, F. Dallegri, et al.
CCL19 and CXCL12 Trigger in Vitro Chemotaxis of Human Mantle Cell Lymphoma B Cells
Clin. Cancer Res., February 1, 2004; 10(3): 964 - 971.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Inngjerdingen, B. Rolstad, and J. C. Ryan
Activating and Inhibitory Ly49 Receptors Modulate NK Cell Chemotaxis to CXC Chemokine Ligand (CXCL) 10 and CXCL12
J. Immunol., September 15, 2003; 171(6): 2889 - 2895.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shi, G.-X.
Right arrow Articles by Kehrl, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shi, G.-X.
Right arrow Articles by Kehrl, J. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS