|
|
||||||||
B Cell Molecular Immunology Section, Laboratory of Immunoregulation, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892
| Abstract |
|---|
|
|
|---|
and
Gq
and strongly impaired signaling through Gi-linked
signaling pathways, including signaling through the chemokine receptors
CXCR4 and CXCR5. Prolonged CD40 signaling up-regulated
RGS13 expression in human tonsil B lymphocytes. These
results plus previous studies of RGS1 indicate the germinal center B
cells use two RGS proteins, RGS1 and RGS13, to regulate their
responsiveness to chemokines. | Introduction |
|---|
|
|
|---|
subunits to exchange GTP for GDP, which leads
to the dissociation of G
subunits from 
heterodimers. Both GTP-bound G
and free 
subunits
activate downstream effectors. However, G
subunits
possess an intrinsic GTPase activity that limits the duration that they
remain GTP bound and able to trigger signaling (reviewed in Refs.
1, 2). Also limiting the duration of
GTP-G
, members of the regulator of G protein signaling
(RGS)2 protein family
dramatically increase the intrinsic GTPase activity of G
subunits, a property that defines them as GTPase-activating proteins
(GAPs). Genetic studies in yeast, Caenorhabditis elegans,
and Aspergillus nidulans first identified such proteins
(3, 4, 5). Suggesting that they function by binding of
G
subunits, a yeast two-hybrid screen with a
G
subunit identified a mammalian RGS protein termed
G
-interacting protein (6). Cementing
the functional relationship between the yeast and mammalian proteins,
human RGS1, RGS2, RGS3, and RGS4 substituted to varying degrees for
Sst2p, a yeast protein involved in the desensitization of pheromone
signaling (7). Rapidly thereafter several studies
demonstrated that RGS proteins possessed GAP activity for
Gi and Gq subfamily members
(8, 9, 10). Coding regions for
25 human RGS proteins have
now been identified. Two Rho guanine nucleotide exchange factors,
which have a divergent RGS domain, selectively act as GAPs for
G12
and G13
and recently another
subfamily of RGS proteins have been identified that act as GAPs for
Gs
(11, 12). Renowned for their roles in the positioning and migration of lymphocytes within lymphoid tissues, chemokines signal thorough G protein-coupled receptors (GPCRs) that use Gi and Gq, thereby suggesting that chemokine responses depend in part upon the number and levels of RGS proteins that lymphocytes express (reviewed in Refs. 13, 14). RGS proteins may establish thresholds for responsiveness, provide a stop signal for migration, and/or contribute to receptor desensitization. Experimentally, the introduction of expression vectors for RGS1, RGS3, and RGS4 into B lymphocyte cell lines dramatically impaired chemokine-induced cell migration (15, 16, 17). Among the known chemokines and their receptors, CXC chemokine ligand (CXCL)12 via CXCR4, CXCL13 via CXCR4, and CXCL19 and CXCL21 via CCR7 provide critical positioning cues for B lymphocytes during B cell development and/or B cell immune responses (18, 19, 20, 21, 22, 23, 24).
Located within lymphoid tissues, germinal centers are sites critical for the generation of B cells with high-affinity Ag receptors (reviewed in Ref. 25). During the establishment of germinal centers, activated B cells and select T cells must migrate into the germinal center region from the B cell follicle. The acquisition of high-affinity Ag receptors, i.e., the affinity maturation of the B cell Ab response, likely depends upon the recirculation of B lymphocytes between the dark and light zones of the germinal center (26). Finally, select B cells leave the germinal center region destined to become plasma or memory B cells. The retention and migratory signals that orchestrate the movements of germinal center B cells remain only partially understood, although CXCL12/CXCR4 may direct plasma cell precursors from the germinal center region (27).
Among the RGS proteins expressed in B lymphocytes, RGS1 shows a prominent expression in germinal center B cells, CD38+/IgD-, sorted from human tonsil, while similarly sorted mantle zone B cells, CD38-/IgD+, lacked detectable RGS1 by immunoblotting (16). Surprisingly, we find that germinal center B cells prominently express another RGS protein, RGS13. Although RGS1 can be found in many other tissues beside B cells, RGS13 possesses a very restricted range of tissue expression. Beside characterizing RGS13 in B cells and B cell lines, we have also examined what signals modulate its expression, determined its intracellular localization, and examined its ability to modulate signaling through a variety of GPCRs including CXCR4 and CXCR5.
| Materials and Methods |
|---|
|
|
|---|
The coding region of mouse RGS13 was isolated by PCR from a cDNA
clone with GenBank number AW495950 and then subcloned into
EcoRI/BamHI of p3XFLAG-CMV-14 (Sigma-Aldrich, St.
Louis, MO) or pEGFP-N1 (Clontech Laboratories, Palo Alto, CA). The
coding region of human RGS13 was inserted into
EcoRI/BamHI sites of p3XFLAG-CMV-14. Human RGS13
C-terminal tagged with green fluorescent protein (GFP) was
prepared by inserting it into pcDNA3.1/CT-GFP-topoisomerase
(Invitrogen, Carlsbad, CA) and subsequently into the EcoRI
site of pAAV-MCS (Stratagene, La Jolla, CA). The coding region of CXCR5
was isolated by RT-PCR using RNA prepared from human serum
(HS)-Sultan cells and subcloned into the EcoRI site of
pAAV-MCS. Dr. S. Gutkind (National Institute of Dental Research,
National Institutes of Health, Bethesda, MD) kindly provided the
expression vectors for the activated G
subunits. Human
RGS1 and RGS3 C-terminal tagged with Flag were described
previously (7, 16). The Abs against the following were
purchased: FLAG (Sigma-Aldrich), phospho-p42/44 mitogen-activated
protein kinase (MAPK; Cell Signaling, Beverly, MA), p42/44 MAPK,
G
i2, G
q/11 and
G
s (Santa Cruz Biotechnology, Santa Cruz, CA), CD11c,
CD40, CD95, CD4, CD8, CD21, CD23, CD43, GR-1, and B220 (BD PharMingen,
San Diego, CA).
Cell lines and cell cultures
The CA46 (a human Burkitts B cell lymphoma), Ramos (a human Burkitts B cell chronic lymphoma), Raji (a human Burkitts B cell chronic lymphoma), HS-Sultan (a B lineage human plasmacytoma), HR1 (a mouse normal spleen line), KG-1 (a human acute myelogenous leukemia), HEL92.1.7 (a human erythroleukemia), K562 (a human chronic myelogenous leukemia), HL-60 (a human promyelocytic leukemia), Jurkat (a human acute T cell leukemia line), MOLT-4 (a human T lineage leukemia), U937 (a human histiocytic lymphoma), HeLa (a human epitheloid carcinoma), 293T (a T Ag-transformed primary embryonal kidney line with transformation of adenovirus type 5 DNA), Chinese hamster ovary (CHO)-K1, COS (a SV40-transformed fibroblast like kidney line) were obtained from the American Type Culture Collection (Manassas, VA). The human Burkitts lymphoma cell lines COMER and JDRB were kind gifts from Dr. I. Magrath (National Cancer Institute, National Institutes of Health), and the human B cell line BJAB.6 and BHM23 were kind gifts from Dr. T. Folkes (Center for Disease Control and Prevention, Atlanta, GA). All of the lymphoid cell lines and the CHO cells were maintained in RPMI 1640 (Life Technologies, Gaithersburg, MD) supplemented with 10% FCS (Life Technologies), whereas the other nonlymphoid cells were maintained in DMEM (Life Technologies) plus 10% FCS.
Generation of polyclonal antisera to RGS13 and immunohistochemistry staining
A peptide based on a region of RGS13 amino acid sequence likely to be highly antigenic, QPQSPREINIDSTT, was synthesized and conjugated to keyhole limpet hemocyanin before injection into rabbits for the generation of polyclonal Abs. The rabbit serum was affinity purified using the RGS13 peptide (Covance, Princeton, NJ). The Ab recognizes both RGS13-GFP and RGS13-Flag when they are expressed in COS or HEK293 cells. For immunohistochemistry, frozen sections of spleen and thymus tissue were prepared. The frozen slides were fixed in cold acetone for 2 min. Endogenous peroxidase was quenched with DAKO peroxidase blocking reagent (DAKO, Carpinteria, CA). Endogenous biotin in tissue was blocked with an avidin-biotin blocking kit (Vector Laboratories, Burlingame, CA). The sections were preincubated in 5% goat serum in PBS and then overnight with anti-RGS13 rabbit polyclonal Abs diluted 1/100 in PBS with 0.1% Triton X-100 and 1% goat serum. The slides were washed with PBS, incubated with goat anti-rabbit IgG (Vectastain Elite avidin-biotin complex kit; Vector Laboratories), and then developed with diaminobenzidine substrate kit for peroxidase (Vector Laboratories). The slides were counterstained with hematoxylin, dehydrated, cleared in ethanol and xylene, and permanently mounted using Permount (Fisher Scientific, Pittsburgh, PA).
Isolation of cells and their analysis by RT-PCR and Western blotting
The tonsil B and T cells were isolated from tonsil mononuclear
cells by two rounds of SRBC rosetting as previously described
(16). The purity of tonsil B cells was routinely >95%. A
total of 1 x 107 of the purified B cells were
stimulated with various reagents for 4, 24, 48 h in RPMI 1640
supplemented with 10% FCS, respectively, at final concentration of 100
ng/ml CXCL12 (R&D Systems, Minneapolis, MN), 1 µg/ml CXCL13 (R&D
Systems), 1 µg/ml anti-CD40 or anti-CD95 mAb, 20 µmol/L
1-palmitoyl-2-hydroxy-sn-glycero-3-phosphocholine (16/0;
Avanti, Alabaster, AL), 4 µl/ml anti-human IgM
(µ-chain-specific) antiserum, 100 ng/ml PMA, or 30 µmol/L
L-
-lysophosphatidic acid (Sigma-Aldrich). The
stimulated tonsil B cells were harvested and the total RNA was isolated
with TRIzol reagents (Life Technologies) and then 2 µg total RNA was
subsequently used for reverse transcription (Omniscript; Qiagen,
Cologne, Germany). The following PCR primers were used for the PCR:
RGS13, ATGAGCAGGCGGAATTGTTGGA and
GAAACTGTTGTTGGACTGCATA; RGS1,
CCAGGAATGTTCTTCTCTGCTAACCCA and TCACTTTAGGCTATTAGCCTGCAGG; and
-actin-GTTTGAGACCTTCAACACCC and ATACTCCTGCTTGCTGATCC.
Mouse bone marrow cells were isolated from femur bones. A sample was
taken for RNA isolation and the rest was used to isolate
B220+ bright or B220+ dim
from the lymphocyte-gated population by cell sorting. Briefly, the
cells were incubated with mAbs to B220 and CD43, washed with staining
buffer (PBS without
Ca2+/Mg2+ plus 1% BSA
fraction V), and sorted on the FACStarPlus (BD
Biosciences, Mountain View, CA). B cells from mesenteric lymph node,
peripheral lymph nodes, and Peyers patches were isolated by negative
depletion. A single-cell suspension was made and treated with
biotinylated Abs to CD4, CD8, CD11c, and GR-1 for 15 min at 4°C
rotating. After washing, the cells were resuspended with
streptavidin-conjugated Dynabeads (Dynal, Lake Success, NY) for 15 min
at 4°C. Cell bead complexes were removed with a Dynal magnetic
particle concentrator. The B cell purity obtained with this depletion
procedure was 9095%. To obtain activated splenic B cells, mice were
immunized i.p. with a 10% SRBC solution and the spleens were harvested
7 days later. The B cells were isolated as described above. The splenic
B cell subpopulations were isolated by staining single-cell suspensions
of splenic B cells with mAbs CD21, CD23, and B220 and cell sorting on a
FACStarPlus (BD Biosciences). The populations
collected were CD21+/B220+,
CD21+/CD23+/B220+,
and
B220+/CD21dim/CD23-.
RNA from each cell population was used to generate cDNAs using the
Clontech Advantage RT-PCR kit (Clontech Laboratories), following kit
methodology using the Rgs13-specific primers
GAAAATTGCTTCACGAAGGGG and GCATGTTTGAGTGGGTTCACGAATG. In addition,
tonsil T and B cells and mouse spleen cell lysates were prepared using
a kinase lysis buffer (20 mM HEPES (pH 7.4), 2 mM EGTA, 50 mM
-glycerophosphate, 1% Triton X-100, 1 mM sodium orthovanadate, and
10% glycerol plus protease inhibitors). Thirty-microgram proteins of
human tonsil T and B cells and mouse spleen lysates was fractionated by
SDS-PAGE and transferred to pure nitrocellulose. The membrane was
immunoblotted as below using a 1/500 diluted affinity-purified rabbit
anti-mRGS13 polyclonal Ab.
Northern blots and in situ hybridization
For detecting human RGS13 expression, 20 µg total
RNA was isolated from 19 cell lines using TRIzol reagents. The RNAs
were size fractionated and transferred to nitrocellulose. The membranes
were hybridized with a 480-bp RGS13 cDNA fragment labeled
with [
-32P]dCTP using Prime-It RmT Random
Primer Labeling kit (Stratagene, La Jolla, CA) as a probe.
-actin
expression was used as a control. Hybridization was performed at 68°C
for 2 h using QuikHyb (Stratagene), washed three times in 2x
SSC/0.1% SDS for 15 min each at room temperature, and then in 0.1x
SSC/0.1% SDS at 60°C for 30 min. For detecting mouse
Rgs13 expression, mouse tissue and embryo blots were
purchased (Clontech Laboratories). The membranes were hybridized and
processed similar to the human blots with the exception that a 480-bp
Rgs13 cDNA fragment was used. For in situ hybridization, a
1076-bp fragment of the Rgs13 cDNA was subcloned into PCR
4-topoisomerase (Invitrogen). Antisense and sense RGS13 riboprobes were
transcribed with T3 and T7 RNA polymerases in the presence of
35S-labeled UTP (Amersham Pharmacia Biotech,
Piscataway, NJ). Mouse embryo sections of various developmental ages
and sections of adult mouse organs were prepared at Molecular Histology
Laboratories (Gaithersburg, MD). In situ hybridization was performed as
previously described (28).
Intracellular localization of RGS13
Cells (HeLa, 293T, COS, CHO) grown in chamber slides (80%
confluent) were transfected with constructs expressing RGS13-GFP or GFP
using SuperFect (Qiagen) according to the manufacturers instruction,
and the isolated and purified tonsil B cells were transfected with
RGS13-GPF or GFP using a human B cell Nuleofector kit (Amaxa
Biosystems, Koln, Germany) according to the user manual. The
translocation experiments were performed in HeLa cells transfected with
constructs expressing RGS13-GFP or GFP plus constructs that express
different GTPase-deficient G
subunits. The slides were
observed with an Olympus BX-60 microscope equipped with a BX-FLA
fluorescent attachment or a laser confocal microscope (National
Institute of Allergy and Infectious Diseases Imaging Unit, Dr. O.
Schwartz).
Immunoblotting and immunoprecipitations
Cell lysates were prepared using an appropriate lysis buffer
plus protease inhibitors for 20 min on ice. The detergent-insoluble
materials were removed by microcentrifugation for 10 min at 4°C.
Equal amounts of proteins from each sample were fractionated by 10%
SDS-PAGE and transferred to pure nitrocellulose. Membranes were blocked
with 5% BSA in Tween 20 plus Tris-buffered saline (TTBS) for 1 h
and then incubated with an appropriate dilution of the primary Ab in
5% BSA in TTBS for 2 h or overnight. The blots were washed three
times with TTBS before the addition of a biotinylated Ab (DAKO) diluted
1/5,000 in TTBS containing 5% BSA for 1 h and then incubated with
streptavidin conjugated to HRP (DAKO) diluted 1/10,000 in TTBS
containing 5% BSA for 1 h. The signal was detected by ECL
according to the manufacturers instruction (Amersham Pharmacia
Biotech). The coimmunoprecipitation of RGS13 and G
subunits was conducted in 293T cells transfected with C-terminal
FLAG-tagged constructs of RGS13 or RGS3. Briefly, 293T cells were
cultured in 100-mm plates and then transfected with 10 µg RGS
constructs using SuperFect (Qiagen). After a 36-h incubation in DMEM,
293T cells were incubated in the presence or absence of aluminum
fluoride (30 µM AlCl3, 10 mM NaF, and 10 mM
MgCl2 in PBS) for 30 min on ice. The cells were
lysed in kinase lysis buffer and anti-FLAG mAb was added, and the
immunoprecipitates were collected with antimouse Ig-conjugated magnetic
beads (Dynal). They were washed four times in lysis buffer, twice in
lysis buffer with 0.5 M NaCl, twice again in lysis buffer, and then
fractionated by SDS-PAGE and analyzed by immunoblotting with
appropriate anti-G protein Ab. The efficiency of
immunoprecipitation was verified by immunoblotting with
anti-FLAG mAb.
MAPK assay
COS cells were transfected with appropriate receptor expression constructs (0.5 µg, respectively) in the presence or absence of RGS13, RGS1, or RGS3 (2.0 µg, respectively) using SuperFect. After starving the cells using fresh medium without FCS for 6 h, cells were stimulated with CXCL12 (100 ng/ml) or CXCL13 (250 ng/ml) for varying durations and then lysed with 300 µl lysis buffer. MAPK activation was detected by immunoblotting with anti-phospho-p42/44 MAPK mAb using detergent-soluble fractions of lysates after fractionation by SDS-PAGE.
Migration assay
CHO cells in six-well plates were transfected with or without constructs expressing CXCR4 plus or not RGS13-GFP or RGS1-GFP for 36 h and then harvested. The cells were loaded into the insert (8-µm pore size) of a Boyden chamber (Costar, Cambridge, MA) and fibronectin-coated bottom chamber (BD PharMingen), and the CXCL12 was added into the bottom chamber at a final concentration of 100 ng/ml. After a 6-h incubation at 37°C in a 5% CO2 incubator, the migrated cells were harvested and resuspended in 300 µl FACS buffer. The GFP-positive cells (included both weak and strongly positive cells) were counted using a FACS (BD PharMingen), and distribution of GFP expression in the loaded cells, migrated, and nonmigrated cells was determined. The percentage of migrating cells was calculated by dividing the number of GFP-positive cells in the migrated sample by the total number of GFP-positive cells loaded in the upper chamber.
| Results |
|---|
|
|
|---|
Based on the known DNA sequence of a RGS13 cDNA
(GenBank accession number AF030107), we screened the murine
expressed sequence tag (EST) database at the National Center for
Biotechnology Information and identified several likely ESTs derived
from Rgs13. Complete nucleotide sequencing of a mouse B cell
cDNA clone (GenBank accession number AW495950) revealed a 1262-bp cDNA
predicted to encode a 157-aa protein 83% identical to human RGS13
(GenBank accession number AF498319, Fig. 1
). We used the Rgs13 cDNA to
construct a murine RGS13 expression vector and amplified the coding
region for human RGS13 from reverse-transcribed human B cell mRNA to
construct a human RGS13 expression vector. Human and mouse RGS13 are
among the smallest of the RGS proteins composed largely of a RGS
domain. Both human and mouse RGS13 have three cysteines in a
configuration of CXXCXXC beginning at amino acid position 6.
|
Expression of Rgs13 mRNA and RGS13 protein
As a first check of Rgs13 expression, we searched the murine EST
database using the Rgs13 cDNA sequence. We found Rgs13 expressed
sequence tags from murine B cells (accession number AW495950), thymus
(accession number BG089493), gallbladder (accession number BB871265),
and neonatal cerebellum (accession number BB257313). Next, we examined
Rgs13 expression in a variety of mouse tissues and RGS13 expression in
human lymphoid and nonlymphoid cell lines by Northern blot analysis and
RT-PCR and RGS13 expression in cell lysates from mouse spleen cells,
human tonsil B cells, and from HS-Sultan cells by immunoblotting. Among
the murine tissues tested, we found Rgs13 expressed in spleen, stomach,
small intestine, and thymus as well in later stage mouse embryos. The
Rgs13 mRNA transcripts ran as a single band of
1.6 kb, suggesting
that Rgs13 does not generate alternative mRNA transcripts (Fig. 2
). Northern blot analysis of human cell
lines revealed a restriction of RGS13 expression to B cell lines. Eight
of the 19 cell lines tested were of B cell origin and all of them
expressed RGS13. BJA-B and several of the Burkitt lymphoma cells lines
expressed the highest levels of RGS13. In contrast, other hemopoietic
cell lines, including T cell lines and nonhemopoietic cell lines,
failed to express detectable levels of RGS13 mRNA (Fig. 2
). To
determine Rgs13 expression during B cell development and in different B
cell populations, we used RT-PCR. We purified total bone marrow cells,
bone marrow B220+ cells, newly formed splenic B
cells, splenic marginal zone B cells, splenic follicular B cells, and B
cells from immunized spleens, Peyers patches, mesenteric lymph nodes,
or peripheral lymph nodes. The analysis revealed very weak Rgs13
expression in total bone marrow cells, but not in
B220+ bone marrow cells. Because of the lack of
Rgs13 in the B220+ cells in the bone marrow, we
did not examine Rgs13 expression in finer detail during B cell
development. Among the other cell fractions, we found the highest
levels of Rgs13 expression in B cells purified from immunized mouse
spleens and from Peyers patches (Fig. 2
).
|
Although Northern blot analysis detected Rgs13 expression in RNA
prepared from developing mouse embryos, we did not visualize any Rgs13
expression by in situ hybridization upon examining sagittal
sections prepared from e12.5, e14.5, e17.5, and newbornmice
(data not shown). Apparently, there is insufficient Rgs13 expression in
embryonic tissues to allow detection by a standard in situ
hybridization protocol. Nevertheless, we readily detected Rgs13
expression by in situ hybridization using sections prepared from mouse
spleen, ileum in the regions of Peyers patches, and thymus (Fig. 3
). The spleen and thymus sections
derived from nonimmunized, day 9, or day 14 postimmunized mice. We
verified the development of germinal center in the B cell zones of the
mouse spleens by detecting peanut agglutinin (PNA) staining
within lymphoid follicles. Although we did not detect an Rgs13
hybridization signal in spleens from unimmunized mice, we found a
strong signal in the germinal center regions of spleens from immunized
mice. We also detected Rgs13 expression in mouse Peyers patches in
the germinal center regions. Beside its expression in germinal centers,
a very localized Rgs13 in situ signal overlaid the epithelial cells in
the medullary region of the thymus, which occurred independent of the
immunization status of the mice. Immunohistochemistry with
affinity-purified RGS13 anti-peptide Abs also detected RGS13
expression in the germinal center region and the thymic medullary
region (Fig. 3
). The germinal center cells that reacted with the RGS13
Ab predominantly localized within the light zone region.
|
Next, we examined RGS13 expression in tonsil B cells stimulated
with a variety of stimuli and compared the results to RGS1 expression
levels. We prepared RNA from purified B cells stimulated with CXCL12,
CXCL13, anti-CD40, anti-µ, PMA,
L-
-lysophosphatidic acid, anti-Fas, or
1-palmitoyl-2-hydroxy-sn-glycero-3-phosphocholine for 4, 24,
and 48 h and subjected the RNA to RT-PCR using either RGS13- or
RGS1-specific primers. We observed that either CD40 or PMA augmented
RGS13 expression at each of the time points while only PMA enhanced
RGS1 expression at all three time points, although anti-µ
enhanced RGS1 expression at 4 h (Fig. 4
). CD40 stimulation had little effect on
RGS1 expression as previously reported for Rgs1 (17). None
of the other inductive stimuli significantly altered either RGS13 or
RGS1 expression. Thus, RGS1 and RGS13 expression may respond to
different stimuli, CD40 stimulation augments RGS13 while engagement of
the B cell Ag receptor acts to enhance RGS1 expression.
|
The intracellular location of RGS proteins varies among the
particular family members that have been examined. Constitutive plasma
membrane, intracellular vesicle, cytoplasm, and intranuclear expression
have all been documented as well as the recruitment from the cytosol to
plasma membranes upon cell activation (30, 31, 32, 33). To examine
RGS13 expression, we prepared expression vectors for human and murine
RGS13 fused to GFP. We found in HEK293T cells and in COS cells that
mouse RGS13-GFP predominantly resided within the nucleus although we
also observed some plasma membrane expression, whereas in HeLa cells
RGS13-GFP predominated in the cytoplasm (Fig. 5
). Expression of GFP alone resulted in
cytosolic expression in all of the cell types (data not shown).
Coexpression of different GTPase-deficient G
subunits
altered RGS13-GFP localization in HeLa cells (Fig. 5
), although they
failed to significantly alter the intracellular localization of GFP
(data not shown). Coexpression with an active form of Gi
caused RGS13-GFP to accumulate at intracellular junctions; coexpression
with an active form of Gq
altered the morphology of the
HeLa cells, but did not substantially change the localization of
RGS13-GFP; surprisingly, the coexpression with an active form of
Gs
shifted RGS13-GFP from the cytoplasm to the nucleus;
and coexpression with an active form of Go
resulted in a
perinuclear accumulation of RGS13-GFP. To examine RGS13-GFP in human B
cells, we introduced either human or mouse RGS13-GFP into purified
human B cells and examined its intracellular location by confocal
imaging. Like the results with HeLa cells RGS13-GFP localized
predominantly in the cytoplasm of primary human B cells (Fig. 5
).
|
Comparison of the RGS13 amino acid sequence with that of RGS
proteins reveals that RGS13 has a number of substitutions in amino
acids conserved among other family members. Among the 120-aa RGS domain
40 aa are strongly conserved between the RGS proteins that possess
Gi and/or Gq GAP activity. Substitutions occur
in 7 of those 40 aa in RGS13 while 0 substitutions occur in RGS1 and
only 3 in RGS2. However, G
pull-down and functional
signaling experiments indicate that RGS13 affects Gi
and
Gq
signaling in a manner similar to that of other RGS
proteins. Pull-down experiments using the FLAG Ab to immunoprecipitate
either FLAG-RGS13 or a control RGS protein, FLAG-RGS3, expressed in
HEK293T cells demonstrated the interaction of RGS13 with both
Gi
and Gq
(Fig. 6
). As previously shown with other RGS
proteins, demonstration of that interaction depends upon the prior
treatment of the cell lysates with aluminum fluoride (8, 9). When expressed in cells we found that the mouse RGS13-FLAG
routinely ran as a doublet while human RGS13 ran as a single band on
SDS-PAGE.
|
B reporter gene, the activation of a
serum-response element-dependent reporter gene, or the phosphorylation
of endogenous p42 MAPK. RGS13 had no effect on
-adrenergic
receptor-mediated cAMP production (Gs dependent); it
inhibited angiotensin receptor-induced p42 MAPK phosphorylation
(Gq dependent) by
60% at 5, 10, and 15 min following
stimulation; it inhibited M1 muscarinic receptor-induced inositol
triphosphate production (Gq dependent) by
40%, and it
partially inhibited M1 muscarinic receptor-mediated serum-response
element and NF-
B activation (Gq and G12/13
dependent) by 35 and 60%, respectively. In each instance, human and
murine RGS13 performed similarly, although in each case RGS3 expression
provided a greater degree of inhibition than did RGS13 (data not
shown). Expression of RGS13 also very modestly inhibited the activation
of the serum-response element reporter following stimulation with
activated forms of G12
or G13
; however,
whether this represents a significant effect on G12 and
G13 signaling need further investigation (data not
shown).
Because of the likely importance of RGS13 in modulating the response of
germinal center B cells to chemokines, we also compared the effect of
RGS3 and RGS13 on signaling through the CXCR4 and CXCR5 receptors. We
transfected COS cells with either the CXCR4 or CXCR5 receptors in the
presence or absence of expression vectors for human RGS13, mouse RGS13,
or human RGS3. We stimulated the cells with either CXCL12 or CXCL13 and
measured the phosphorylation of endogenous p42 MAPK (Fig. 7
). We found that both human and mouse
RGS13 potently inhibited the production of phosphorylated p42 MAPK
following exposure to CXCL12 (equivalent or even superior to RGS3) or
CXCL13 (nearly equivalent to RGS3). Because germinal center B cells can
express either or potentially both RGS13 and RGS1, we directly compared
RGS1 and RGS13 on CXCR4 and CXCR5 signaling. At equivalent levels of
expression RGS13 proved superior to RGS1 in its ability to inhibit
CXCR4 and CXCR5 signaling to p42 MAPK activation 5 min poststimulation
(Fig. 7
). We observed similar results at 2 and 10 min following
exposure to ligand (data not shown). Pertussis toxin, an inhibitor of
Gi
signaling, also potently inhibited CXCR4 and CXCR5
induced p42 MAPK phosphorylation consistent with the know importance of
Gi
in chemokine signaling (34, 35).
|
|
| Discussion |
|---|
|
|
|---|
and
to a lesser extent to those that couple to Gq
. A
direct comparison with RGS1 indicates that at similar expression levels
RGS13 more potently inhibits CXCL12 and CXCL13 signaling although RGS1
and RGS13 similarly inhibited the migration of CXCR4 transfected CHO
cells. Based on the localization of a RGS13-GFP fusion protein, RGS13
largely resides in the cytoplasm of B lymphocytes. However, analysis of
spleen sections from a recently immunized mouse suggested prominent
membrane localization in germinal center B cells. We also show that
CD40 signaling preferentially regulates RGS13 expression
whereas signaling through the B cell Ag receptor preferentially
regulates RGS1 expression. Beside Rgs13, lymphocytes also express Rgs1 and Rgs2. Interestingly, these three genes are clustered together on chromosome 1, both in mice and humans (30). Rgs1 and Rgs13 are separated by 48 kb while Rgs13 and Rgs2 are located 139 kb apart. There are no known intervening genes between these loci. A search of the mouse EST database using the intervening DNA sequence between Rgs1 and Rgs13 failed to identify any novel coding regions (J. Kehrl, unpublished observation). Determining the DNA regulatory regions that control expression of these three genes should provide some insights into the mechanisms that account for their overlapping and restricted patterns of expression. The close juxtaposition of Rgs1, Rgs13, and Rgs2 complicates the creation of double or triple null animals, likely requiring independent targeting of each locus. Also, it may pose difficulties for the analysis of mice with targeted disruption of one of these loci because of potential effects on the adjacent loci or possible compensatory mechanisms.
RGS13 inhibited both the activation of MAPK in response to CXCR4 and CXCR5 signaling in COS cells and the migration of CXCR4 expressing CHO cells. In preliminary experiments, we have found that the introduction of RGS13 into a human B cell line as a GFP fusion protein reduces the migration of the derived cell lines to either CXCL12 or CXCL13 when compared with control cell lines. In addition, the introduction of an RGS13 cDNA in an antisense orientation into a RGS13-expressing B cell line enhances the migration of the derived cell lines to the same chemokines when compared with control cells (G.-X. Shi, unpublished observations). Thus, a major role for RGS13 may be to regulate the responsiveness of germinal center B cells to chemokines.
The major questions unanswered by this study are precisely what role Rgs13 plays in germinal B cell function and why should germinal center B cells use multiple RGS proteins. To begin to answer these questions, we need to unambiguously ascertain which germinal center B cells express Rgs13 and which Rgs1. The RGS13 Ab used in this study reacted with a limited number of cells in the light zone of the germinal center, yet the in situ hybridization study detected Rgs13 expression in a higher percentage of the germinal center cells. Varying sensitivities of the two methods or protein instability may account for the failure of the mRNA and protein to perfectly colocalize; however, additional studies are needed to resolve this inconsistency. Providing a possible mechanism to differentially express Rgs13 and Rgs1 during the recruitment and trafficking of B cells through the germinal center, CD40 and Ig stimulation distinctively regulated RGS1 and RGS13 expression. Current models of germinal center formation and maintenance suggest a temporal dissociation between these signals (36, 37, 38). Based on the known functions of RGS proteins and our current studies of RGS13, we can speculate on what functional roles RGS13 may have in germinal B cell function. Our current hypothesis based on both in vitro studies and ongoing studies of RGS1-/- mice (C. Moratz, manuscript in preparation) is that a major function of RGS proteins in lymphocytes is to help them negotiate a complex chemokine milieu. Since RGS proteins may exhibit some degree of receptor selectivity the simple expression of RGS13 could bias a cell to preferentially respond to one source of chemoattractant vs another. An intriguing idea is that RGS proteins may be asymmetrically expressed within the cell. Such intracellular localization of RGS13 could allow for directional migratory responses in response to conflicting chemotactic signals. Another possibility is that RGS proteins such as RGS13 participate in chemokine receptor desensitization, thereby allowing the cell to desensitize to a primary chemokine gradient and response to a second one. A likely site of conflicting chemoattractants gradients is the light zone of the germinal center, where B cells have several alternative fates. They may undergo apoptosis, re-enter the dark zone, or leave the germinal center. RGS13 may assist the B cells in making these decisions.
Our results differ slightly from those recently published that
characterized human RGS13 (39). The expression data
reported in that study agreed with our results although we have
provided more detailed information and focused on Rgs13
expression. In contrast, to Johnson and Druey (39), we
failed to detect any effect of RGS13 on either signaling through
Gs-coupled receptors or G
qQL signaling,
although we agree on the effect of RGS13 on Gi- and
Gq-coupled receptors. In addition, we examined the effects
of RGS13 on signaling through GPCRs used by B lymphocytes. We expressed
both human and mouse RGS13 as Flag-tagged proteins, whereas Johnson and
Druey (39) had difficulties in detecting a tagged version
of human RGS13 and resorted to using a GPF fusion protein. Perhaps
contributing to our success, we used a C-terminal triple Flag tag. The
difference between RGS13-GFP and RGS13-Flag may account for some of the
differences in signaling data. We have also repeated some of the
signaling experiments expressing untagged versions of human and mouse
RGS13 with similar results (G. Shi, unpublished data). Also in
contradistinction to the Johnson and Druey study (39), we
could detect endogenous RGS13 by immunoblotting. We made
affinity-purified anti-peptide Abs against three RGS13 peptides: a
C-terminal, N-terminal, and an internal peptide. Only those made
against the internal RGS13 peptide proved useful for immunoblotting and
immunohistochemistry. Finally, while similar to Johnson and Druey
(39), we noted that some cell types express RGS13-GFP
within their nuclei, and we found significant differences in its
intracellular localization depending upon the cell line chosen and no
evidence that B lymphocytes express RGS13 within their nuclei. Thus,
the intracellular localization of an RGS-GFP fusion protein in
heterologous cells may not help predict the intracellular location of
the endogenous RGS proteins.
In conclusion, Rgs13 possesses one of the most limited patterns of expression of the known RGSs. Notable among the cell types that express Rgs13 are germinal center B lymphocytes. The complicated trafficking pattern that B cells undergo during their transit through the germinal center along with the known ability of RGS proteins to regulate chemokine receptor signaling implicates Rgs13 in the control of B cell migration within this microenvironment. Yet germinal center B cells do not rely on Rgs13 alone, but also express Rgs1 and likely other RGSs. Germinal center B cells likely employ these RGS proteins to provide stop signals, set thresholds for responses, and assist in chemokine desensitization, a likely requirement for cells to negotiate complex chemokine networks.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Abbreviations used in this paper: RGS, regulator of G protein signaling; GAP, GTPase-activating protein; GPCR, G protein-coupled receptor; GFP, green fluorescent protein; HS, human serum; MAPK, mitogen-activated protein kinase; CHO, Chinese hamster ovary; EST, expressed sequence tag; PNA, peanut agglutinin; CXCL, CXC chemokine ligand. ![]()
Received for publication May 3, 2002. Accepted for publication June 26, 2002.
| References |
|---|
|
|
|---|
i3, is a member of a protein family with a highly conserved core domain. Proc. Natl. Acad. Sci. USA 92:11916.
subunits. Cell 86:445.[Medline]
-subunits. Nature 383:172.[Medline]
i GTPase activity. Nature 383:175.[Medline]
12 and G
13. Science 280:2109.
S and sorting nexin in vesicular trafficking. Science 294:1939.
signaling responses of B lymphocytes. J. Immunol. 164:1829.
2 results in translocation of cytoplasmic RGS4 to the plasma membrane. J. Biol. Chem. 273:18405.
i heterotrimeric G proteins, is located on clathrin-coated vesicles. Mol. Biol. Cell 9:1123.
11. Mol. Cell. Biol. 19:714.
dimers released by activation of G
i-coupled receptors. Proc. Natl. Acad. Sci. USA 94:14495.
subunit of Gi, not by activating Gq or Gs. Proc. Natl. Acad. Sci. USA 94:14489.This article has been cited by other articles:
![]() |
M. M. Tomayko, S. M. Anderson, C. E. Brayton, S. Sadanand, N. C. Steinel, T. W. Behrens, and M. J. Shlomchik Systematic Comparison of Gene Expression between Murine Memory and Naive B Cells Demonstrates That Memory B Cells Have Unique Signaling Capabilities J. Immunol., July 1, 2008; 181(1): 27 - 38. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. W. Tun, D. Personett, K. A. Baskerville, D. M. Menke, K. A. Jaeckle, P. Kreinest, B. Edenfield, A. C. Zubair, B. P. O'Neill, W. R. Lai, et al. Pathway analysis of primary central nervous system lymphoma Blood, March 15, 2008; 111(6): 3200 - 3210. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Bhattacharya, M. T. Cheah, C. B. Franco, N. Hosen, C. L. Pin, W. C. Sha, and I. L. Weissman Transcriptional Profiling of Antigen-Dependent Murine B Cell Differentiation and Memory Formation J. Immunol., November 15, 2007; 179(10): 6808 - 6819. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Piovan, V. Tosello, S. Indraccolo, M. Masiero, L. Persano, G. Esposito, R. Zamarchi, M. Ponzoni, L. Chieco-Bianchi, R. Dalla-Favera, et al. Differential Regulation of Hypoxia-Induced CXCR4 Triggering during B-Cell Development and Lymphomagenesis Cancer Res., September 15, 2007; 67(18): 8605 - 8614. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Johnson, M. E. Boyer, J.-A. Kang, A. Wickrema, A. B. Cantor, and E. H. Bresnick Friend of GATA-1-independent transcriptional repression: a novel mode of GATA-1 function Blood, June 15, 2007; 109(12): 5230 - 5233. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-I. Han, N.-N. Huang, D.-U. Kim, and J. H. Kehrl RGS1 and RGS13 mRNA silencing in a human B lymphoma line enhances responsiveness to chemoattractants and impairs desensitization J. Leukoc. Biol., June 1, 2006; 79(6): 1357 - 1368. [Abstract] [Full Text] [PDF] |
||||
![]() |
|