| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Department of Respiratory Medicine and Allergy, GKT School of Medicine, King’s College, London, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
in individual
cells using intracellular cytokine staining at various times during the
differentiation process. We provide direct evidence that the Th2
cytokines IL-4, IL-5, and IL-13, unlike the other cytokines, are
regulated by a coordinated mechanism. We also show that IL-10 is
expressed by a different subset of cells that is prevalent at early
stages of Th2 differentiation, but then diminishes. Additionally we
demonstrate that while naive cells can express IL-2 upon activation,
they cannot express GM-CSF. Commitment to GM-CSF expression occurs
during differentiation in a Th1/Th2 subset-independent manner.
Furthermore, we have examined the levels of GATA3, c-Maf, T-bet, and
Ets-related molecule during human Th1/Th2 differentiation and
suggest that differences in the levels of these critical transcription
factors are responsible for commitment toward the Th1 or Th2
lineage. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, whereas Th2 cells express IL-4, IL-5, IL-10, and IL-13
(2). Some cytokines, for example GM-CSF, were expressed by
both subsets. Similar subsets of T cell clones have been described in
humans (3).
Recently, several groups have examined the processes by which
antigenically naive precursors differentiate into Th1 or Th2 lineages
(4). Numerous studies have shown that the cytokine
environment plays a critical role in this lineage commitment process.
IL-12 promotes Th1 differentiation, whereas IL-4 promotes Th2
differentiation (5). Several of the transcription factors
that are critical to murine Th1/Th2 differentiation have recently been
identified. GATA3 and c-Maf are both selectively expressed in murine
Th2 cells and have been shown to regulate Th2 cytokine expression
(6, 7). c-Maf is required for the expression of IL-4, but
not IL-5 or IL-13 (8), whereas GATA3 appears to have a
broader role in the expression of IL-4, IL-5, and IL-13 (7, 9). Th1-specific transcription factors have recently been
identified. T-bet appears to be critical for IFN- expression, but
suppresses IL-2 expression during differentiation (10).
The transcription factor Ets-related molecule
(ERM)3 is also
selectively expressed in murine Th1 cells, but its function remains
unclear (11).
One aspect of Th1/Th2 cell commitment that remains unclear is the
relationships between the expression of different cytokine genes within
individual cells. Several studies have suggested that there is
considerable heterogeneity of expression of cytokines at the
single-cell level in both Th1/Th2 clones and primary cell culture
systems (12, 13, 14, 15). However, most of these studies examined
a limited number of cytokines or were based upon analysis of a
relatively small number of cells. To address this we have developed an
in vitro differentiation assay in which human naive
CD4+ cells are driven toward either the Th1 or
Th2 phenotype. We have examined the interrelationships among the
expression of IL-2, IL-4, IL-5, IL-10, IL-13, GM-CSF, and IFN- in
individual cells using intracellular cytokine staining at various times
during the differentiation process. Here we provide direct evidence
that the Th2 cytokines IL-4, IL-5, and IL-13 are regulated by a
coordinated mechanism. Furthermore, we have examined the levels of
GATA3, c-Maf, T-bet, and ERM during human Th1/Th2 differentiation and
show that several differences in the levels of these critical
transcription factors exist between human and murine Th1 and Th2
cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Venous blood was taken from nonatopic healthy human male volunteers using heparin as an anticoagulant. Ethical approval for the use of human volunteers in this study was obtained from the institutional ethical review committee. PBMCs were isolated using Lymphoprep (Nycomed, Oslo, Norway) according to the manufacturer’s instructions. CD4+ T cells were isolated from PBMCs using a CD4 Positive Isolation Kit (Dynal Biotech, Great Neck, NY) according to the manufacturer’s instructions. Naive CD45RA+ cells were purified from CD4+ cells by depletion of CD45RO+ cells using mouse anti-human CD45RO Ab (UCHL1; BD PharMingen, San Diego, CA; 0.5 µg/1 x 106 cells) and rat anti-mouse IgG2a Dynabeads (Dynal Biotech) according to the manufacturer’s instructions. The purity of fractionated cell populations was determined by FACS analysis using FITC-conjugated anti-CD45RA (L48; BD PharMingen), PE-conjugated anti-CD45RO (UCHL1; BD PharMingen), PE- or CyChrome-conjugated anti-CD4 (RPA-T4; BD PharMingen), and CyChrome-conjugated anti-CD62 ligand (Dreg 56; BD PharMingen). Samples were analyzed on a FACSCalibur (BD Biosciences, Franklin Lakes, NJ).
In vitro differentiation
Purified CD45RA+ cells (1 x
106/ml) were cultured in RPMI 1640 (Life
Technologies, Gaithersburg, MD) supplemented with 10% FCS, 2 mM
L-glutamine (Life Technologies), 100 U/ml penicillin (Life
Technologies), and 100 µg/ml streptomycin (Life Technologies). Cells
were stimulated with plate-bound anti-CD3 (1 µg/ml; clone OKT3)
and anti-CD28 (2 µg/ml; clone 15E8; CLB, Amsterdam, The
Netherlands) and rIL-2 (50 U/ml; Eurocetus, Amsterdam, The
Netherlands). To direct Th1 differentiation, rIL-12 (2.5 ng/ml; R&D
Systems, Minneapolis, MN) and anti-IL-4 (5 µg/ml; clone MP4-25D2;
BD PharMingen) were added. For Th2 differentiation, rIL-4 (12.5 ng/ml;
NBS Biologicals, Huntingdon, Cambridge, U.K.), anti-IFN-
(5 µg/ml; clone B-B1; BioSource, Camarillo, CA), and anti-IL-10
(5 µg/ml; clone JES3-9D7; BioSource) were added. After 4 days the
cells were expanded under the same conditions in the absence of
anti-CD3 or anti-CD28. Cells were then restimulated every 7
days. When required, cells were activated with PMA (5 ng/ml;
Sigma-Aldrich, St. Louis, MO) and ionomycin (500 ng/ml; Calbiochem, La
Jolla, CA) for 4 h.
Intracellular cytokine staining
Resting cells were activated with PMA (5 ng/ml) and ionomycin
(500 ng/ml) for 4 h. Monensin (2 µM; Sigma-Aldrich) was added
for the final 2 h of activation. Cells were harvested in FACS
tubes and placed on ice, 7-amino-actinomycin D (4 µg/ml;
Sigma-Aldrich) was added, and cells were incubated for 10 min on ice.
Cells were then washed with FACSFlow (BD PharMingen) and processed for
intracellular cytokine staining with Cytofix/Cytoperm kit (BD
PharMingen) according to the manufacturer’s instructions. Abs used (BD
PharMingen unless stated otherwise): PE-conjugated anti-IL-2
(MQ1-17H12), PE-conjugated anti-IL-4 (4B3; BioSource), PE- or
allophycocyanin-conjugated anti-IL-5 (TRFK5), PE- or
allophycocyanin-conjugated anti-IL-10 (JES3-19F1), PE-conjugated or
biotinylated anti-IL-13 (JES10-5A2 and B69-2), PE-conjugated
anti-GM-CSF (BVD2-21C11), and FITC-conjugated anti-IFN-
(B27). Biotinylated anti-IL-13 was detected with
streptavidin-allophycocyanin (BD PharMingen). Samples were analyzed on
a FACSCalibur (BD Biosciences). Live cells were analyzed for cytokine
expression based upon forward and side scatter and exclusion of
7-amino-actinomyin D. At least 10,000 live cells were analyzed for each
sample. Quadrant markers were set based upon background staining of
matched control Abs (also from BD PharMingen) and on resting,
unactivated cells treated in parallel.
RNA isolation and RT-PCR
Total RNA was isolated from resting and activated naive cells
and from Th1 and Th2 cells on days 14 and 28 of in vitro
differentiation. Isolation of total cellular RNA was performed using
the RNA/DNA mini kit (Qiagen, Chatsworth, CA) according to the
manufacturer’s instructions, and RT-PCR was performed as previously
described (16) using 25 ng reverse transcribed RNA. The
primers used in RT-PCR for kinesin superfamily 3A (KIF3A), IL-4, IL-13,
and RAD50 have been described previously (16).
RT-PCR primers for other genes were as follows: IFN- sense,
GCAGGTCATTCAGATGTAGCGG; IFN- antisense,
TGTCTTCCTTGATGGTCTCCACAC; IL-5 sense, GAGGATGCTTCTGCATTTGAGTTTG;
IL-5 antisense, GTCAATGTATTTCTTTATTAAGGACAAG; GATA3 sense,
AACTGTCAGACCACCACAACCACAC; GATA3 antisense,
GGATGCCTTCCTTCTTCATAGTCAGG; c-Maf long form (MafLF) sense,
GGAGAAATACGAGAAGTTGGTGAGC; MafLF antisense,
ACAGAAGTCAGGGGTAGGTGGTTC; T-bet sense, CACTACAGGATGTTTGTGGACGTG;
T-bet antisense, CCCCTTGTTGTTTGTGAGCTTTAG; ERM sense,
CAATGCTGAAACCTCTCAAAGTGG; ERM antisense,
TTCCTCTTTCTGTCAATCACAGGC; 18S rRNA sense, TGACTCAACACGGGAAACCTCAC;
and 18S rRNA antisense, GGACATCTAAGGGCATCACAGACC. All primers were
supplied by MWG Biotech (Ebersberg, Germany).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Human CD4+ cells can be separated into two
subsets based upon the surface expression of different isoforms of
CD45. CD4+CD45RA+ cells
represent the naive cell population, whereas
CD4+CD45RO+ cells represent
the effector/memory populations (17). Naive
CD4+CD45RA+ T cells were
isolated from peripheral blood of nonatopic healthy volunteers by
positive selection of CD4+ cells, followed by
depletion of CD45RO+ cells (Fig. 1
A). These cells were also
CD62Lhigh, which is required for homing to
secondary lymphoid organs (18), and
CD25-, which is an activation marker (Fig. 1B and data not shown). To drive differentiation, the naive
cells were then stimulated with anti-CD3, anti-CD28, and
rIL-2. Recombinant IL-12 and anti-IL-4 were added for Th1
conditions; rIL-4, anti-IFN-, and anti-IL-10 were added for
Th2 conditions. Anti-IL-10 was added to the Th2 cultures because
preliminary experiments indicated that endogenously produced IL-10
suppressed Th2 cytokine expression (data not shown), as reported
previously (19). At various time points during in vitro
differentiation, cytokine expression was analyzed by intracellular
cytokine staining (Fig. 1, C and D). This
technique allows us to examine the frequency of individual cells within
a heterogeneous population that are capable of expressing a particular
cytokine upon activation (13). All the experiments
described in this report were performed at least three times using
different healthy donors, and similar results were obtained.
|
, C and D). The naive cells were not capable of
expressing any of the other cytokines examined. By day 7 of Th1
differentiation a large percentage of the cells was capable of
expressing IL-2, IFN-, or GM-CSF when activated (Fig. 1C). Further differentiation increased the frequency of
IFN-+ and GM-CSF+ cells
until day 21, when 95% of the cells were
IFN-+ and GM-CSF+ upon
activation. The frequency of IL-2+ cells within
the culture remained high, but never reached this level. The expression
of IL-4, IL-5, IL-10, and IL-13 was virtually undetectable at all time
points during Th1 differentiation.
During Th2 development, IL-2+ cells were
maintained at levels similar to those seen in the Th1 cultures (Fig. 1D). The ability to express GM-CSF also mirrored the time
course observed in Th1 cells. The Th2 cytokines IL-4, IL-5, and IL-13
were expressed by small numbers of cells at early time points of
the Th2 culture, but by day 28 high percentages of
IL-4+, IL-5+, and
IL-13+ cells were observed. The kinetics of
expression of these three cytokines were quite different, with a high
frequency of IL-13+ cells detected earlier in the
culture than IL-4 and IL-5. The frequency of IL-10 expression was very
low and peaked on day 7 of Th2 differentiation.
Cytokine coexpression during Th1 differentiation
We used multicolor intracellular cytokine staining to investigate
which cytokines are coexpressed within individual cells during Th1
differentiation (Fig. 2). The naive cells
clearly expressed IL-2 at high frequency, but not IFN- or GM-CSF. By
day 7 double staining for IL-2 and IFN- revealed four distinct
populations. The largest population concomitantly expressed IL-2 and
IFN-, but the
IL-2+IFN--,
IL-2-IFN-+, and
IL-2-IFN-- populations
were all clearly detectable. As Th1 differentiation proceeded, IL-2 and
IFN- were more likely to be expressed concomitantly, and by
day 21, less than 1% of the cells were
IL-2+IFN--. The
patterns of GM-CSF and IFN- coexpression were similar, with four
populations on day 7 and increasing coexpression at later time points.
Indeed, by day 21 >97% of the cells were
GM-CSF+IFN-+. Similar
results were obtained in five independent experiments.
|
+ cells is no
more than would be expected for random events (Table I). This indicates that expression of
IL-2 or IFN- by individual cells are independent events. Similar
analysis of GM-CSF and IFN- expression demonstrates that the
frequency of
GM-CSF+IFN-+ cells is no
greater than expected for independent events (Table I), indicating that
expression of GM-CSF and IFN- are not linked during Th1
development.
|
or GM-CSF expression. Furthermore,
the results indicate that the expression of any one of these three
genes is not a prerequisite for the expression of the other genes.
Finally, although concomitant expression is high for IL-2, GM-CSF, and
IFN-, especially at later time points, the regulation of their
expression is not coordinated. Relationship between IL-10 expression and other cytokines during Th2 differentiation
During in vitro Th2 differentiation we observed a relatively low
frequency of IL-10+ cells that peaked on day 7
(Fig. 1D). Multicolor intracellular cytokine staining
revealed complex interrelationships between the expression of IL-10 and
that of other cytokines at the single-cell level (Fig. 3). Once again it was clear that only
IL-2 was expressed by naive T cells upon activation with PMA/ionomycin.
By day 7, when the incidence of IL-10+ cells was
maximal, only 5% of the cells were
IL-2+IL-10+. The frequency
of GM-CSF+IL-10+ cells was
similarly low, even though both IL-2 and GM-CSF were expressed at high
levels at this stage. Within individual cells, the Th2 cytokines IL-4,
IL-5, and IL-13 also appeared highly incompatible with IL-10
expression. Indeed, IL-5 expression was only noticeable once the
incidence of IL-10+ cells had started to subside
on day 14. Similar results were obtained in five independent
experiments. From these data it appears that concomitant expression of
IL-10 and the other cytokines examined is rare. Moreover, coexpression
of IL-10 and IL-5 seems to be mutually exclusive. Furthermore, we only
start to detect IL-4+,
IL-5+, and IL-13+ cells at
high frequency once the incidence of IL-10+ cells
had completely diminished (Figs. 1D and 4).
|
We have also examined the relationship between the expression of
IL-5, a Th2 cytokine, and that of other cytokines within individual
cells during in vitro Th2 differentiation (Fig. 4). The frequency of
IL-5+ cells was extremely low until day 14, when
6% of the cells were IL-5+.
IL-2+IL-5+ cells were
clearly detectable at this point, and their frequency increased as the
incidence of IL-5 expression increased. However, although there was a
high level of concomitant expression at later time points, it was
unlikely to reflect coordinated expression, since the
IL-2+IL-5+ population was
approximately what would be expected for two independent events (Table II). The correlation between IL-5 and
GM-CSF expression was similar (Fig. 4), with a high degree of
concomitant expression probably reflecting independent events
(Table II).
|
|
shows that there was a high frequency of concomitant expression of IL-4
and IL-5 even at early time points. This level of concomitance was
3-fold higher than would be expected for independent expression (Table II). A similarly skewed frequency of
IL-13+/IL-5+ cells was
observed (Table II). From Fig. 4 it is also clear that coexpression of
IL-10 and IL-5 is rare, as was observed earlier (Fig. 3). In fact by
day 21, when a high frequency of IL-5+ cells was
observed, the incidence of IL-10 expression had diminished to <1% of
the cells. These results demonstrate that during Th2 cell differentiation, IL-2 expression is maintained from naive cells until day 28 (as was observed during Th1 differentiation) and that the competence of a particular cell to express IL-2 is not linked to its ability to express IL-5. Furthermore, the data clearly show that competence for expression of GM-CSF is induced in Th2 cells and that this is independent of the capacity of an individual cell to express IL-5. In contrast, the high level of concomitant expression of both IL-4 and IL-13 with IL-5, particularly at early time points suggests that the Th2 cytokines are not regulated independently within individual cells during Th2 differentiation.
Concomitant expression of IL-13 and other cytokines during Th2 differentiation
To further investigate the relationships between coexpression of
the Th2 cytokines, we performed multicolor intracellular cytokine
staining with IL-13 and IL-2, IL-4, and GM-CSF (Fig. 5). High frequencies of concomitant
expression of IL-2 and IL-13 were observed, but the expression of IL-2
and IL-13 appeared independent when the coexpression frequency was
analyzed (Table III). The intracellular
staining of GM-CSF and IL-13 suggests that the expression of these two
cytokines is also independently regulated (Table III). In contrast to
IL-2 and GM-CSF, the intracellular staining data for IL-4 and IL-13
displayed a high frequency of coexpression, especially at early time
points, which cannot be explained by an independent relationship
(Table III).
|
|
and Table II and strongly
suggest that although IL-2 and GM-CSF are highly expressed in Th2
cells, their expression is not linked to the expression of the Th2
cytokines. The results also demonstrate that during Th2 differentiation
there is a high frequency of concomitant expression of the Th2
cytokines IL-4, IL-5, and IL-13.
The data from day 28 (Figs. 4 and 5) can be combined in a Venn diagram
that displays the relative frequency with which each Th2 cytokine is
expressed (Fig. 6). This figure shows
that 28% of the cells are expressing all three Th2 cytokines on day
28. Furthermore, it demonstrates that the likelihood of a cell
expressing IL-4 without expressing both IL-5 and IL-13 is low and that
the majority of cells are expressing at least two of these cytokines at
this time point.
|
A). Using RT-PCR, we found
very polarized, activation-dependent, Th2-specific expression of IL-4,
IL-5, and IL-13 mRNA (compare lane 4 with lane 6,
and lane 8 with lane 10). It is
interesting to note that some mRNA for the Th2 cytokines is present in
the highly polarized (day 28) Th2 cells before activation (Fig. 7A, lane 9). We also observe highly polarized
activation-dependent Th1-specific expression of IFN- (compare
lane 4 with lane 6, and lane 8 with
lane 10). The level of RAD50 mRNA also appeared to increase
in Th2 cells compared with Th1 cells (see lanes 3–6).
However, the level of RAD50 mRNA did not increase noticeably upon
activation, unlike the cytokines. Interestingly, the level of RAD50
mRNA appeared to decrease upon activation of the highly polarized (day
28) Th1 cells (compare lanes 7 and 8). We also
examined the mRNA levels of KIF3A, the gene that flanks IL-4. On day 28
of differentiation resting Th2 cells appeared to have a higher level of
KIF3A mRNA than Th1 cells (compare lanes 7 and
9). The level of KIF3A mRNA diminished in both populations
upon activation (lanes 8 and 10).
|
Several transcription factors have been identified as critical
regulators of murine Th1/Th2 lineage commitment. To examine the
potential for these factors to be involved in human Th1/Th2
differentiation, we studied their expression by RT-PCR during in vitro
culture (Fig. 7B). GATA3 mRNA was readily detectable in
resting naive cells and was slightly down-regulated after activation
with PMA/ionomycin (lanes 1 and 2). It was
also detectable in Th1 cells and was found at higher levels in Th2
cells (compare lanes 7–10). GATA3 was not up-regulated upon
activation in either Th1 or Th2 cells. Human c-Maf is expressed as two
isoforms: the Maf short form is unspliced, whereas MafLF has an
additional spliced final exon (22). MafLF mRNA was not
detectable in naive cells, but was clearly present in both Th1 and Th2
cells. The level of MafLF mRNA was higher in Th2 cells than in Th1
cells (Fig. 7B, compare lanes 7 and
9). Interestingly, the level of MafLF mRNA appeared to
diminish upon activation in both highly polarized Th1 and Th2 cells
(compare lanes 7–10). Similar results were obtained when
examining total c-Maf mRNA by RT-PCR (data not shown). Human T-bet mRNA
was not detected in resting naive cells, but was highly up-regulated
upon activation with PMA/ionomycin (Fig. 7B, compare
lanes 1 and 2). Although T-bet mRNA was clearly
detectable in resting Th1 cells, but not in Th2 cells, it was
up-regulated in Th2 cells upon activation (compare lanes
7–10). Human ERM mRNA was preferentially expressed in activated
Th1 cells (lanes 4 and 8), but was also
detectable in resting and activated naive cells and Th2 cells.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
IL-2 has long been considered as a Th1-specific cytokine based
upon experiments performed with murine T cell clones (2).
However, considerable heterogeneity in the level of IL-2 expression by
human T cell clones has previously been reported (3). We
have shown that approximately half of human naive T cells are capable
of expressing IL-2. During in vitro differentiation of both Th1 and Th2
cells, the number of cells capable of expressing IL-2 remains fairly
constant (Fig. 1). We have also shown that the expression of IL-2 by an
individual cell does not correlate with the expression of
IFN-, IL-10, IL-5, or IL-13, although concomitant expression of
these genes may occur (
Figs. 2–5). This strongly suggests that the
mechanisms that regulate IL-2 expression in human T cells are distinct
from the mechanisms that control Th1 or Th2 commitment. The observation
that not all cells express IL-2 probably indicates that the decision by
an individual cell to express IL-2 is an inefficient stochastic
process. Indeed, recent experiments have indicated that this may well
be the case in murine T cells (23, 24). It has been
suggested, based upon overexpression studies, that the Th1-specific
factor T-bet suppresses IL-2 expression in murine T cells
(10). We found little evidence for this in human Th1
cells, since we observed a high frequency of concomitant expression of
IFN- and IL-2. Taken together our results indicate that IL-2 is
expressed by activated naive T cells and that competence to express
IL-2 is maintained throughout both Th1 and Th2 differentiation.
GM-CSF expression during Th1/Th2 differentiation
In these experiments we have demonstrated that GM-CSF is not
expressed by naive human T cells upon activation. However, T cells
rapidly acquire the ability to express GM-CSF upon differentiation
regardless of Th1/Th2 commitment (Figs. 2 and 3). GM-CSF is located on
human chromosome 5 and is closely associated with IL-3
(20). Recent work by Cockerill and colleagues (25, 26) has shown that GM-CSF expression is regulated by a
tissue-specific and activation-responsive DHS in Jurkat cells and
transgenic mice. This DHS has been shown to bind NF-AT and AP1
components, which are also involved in IL-2 expression. It is therefore
intriguing that while the naive cells are competent for IL-2
expression, they cannot express GM-CSF upon activation. One possible
explanation for this could involve the chromatin environment at the
IL-2 and GM-CSF loci. If the IL-2 locus has an open structure, and the
GM-CSF locus has a closed chromatin structure in naive cells, which
then opens during T cell differentiation, it could account for these
results. It will be interesting to examine the chromatin structure of
GM-CSF in naive cells and after differentiation along both Th1 and Th2
lineages. This may also indicate whether Th1 and Th2 cells express
GM-CSF using the same or independent mechanisms. An alternative
possibility is that GM-CSF expression requires an additional
transcription factor that is only expressed upon differentiation
regardless of the Th1/Th2 lineage decision.
IL-10 expression during Th2 commitment
During Th2 differentiation, we observed a limited number of
IL-10+ cells that peaked on day 7 of culture.
This was surprising, since IL-10 is conventionally described as a Th2
cytokine. The ability of an individual cell to express IL-10 did not
appear to correlate with the expression of any other cytokine examined,
suggesting that it is not a Th1- or Th2-specific cytokine (Fig. 3).
This is in agreement with recent work from several laboratories
suggesting that IL-10 is expressed by a different T cell subset, termed
T regulatory cells (27, 28). Our data suggest that the
development of T regulatory cells is favored at early time points of
Th2 differentiation, but that these cells are either outgrown or commit
to a Th2 phenotype as culture progresses.
Coordinated expression of IL-4, IL-5, and IL-13
Commitment of a cell to express the Th2-specific cytokines IL-4,
IL-5, and IL-13 appears to take a prolonged period under Th2-inducing
conditions, unlike the commitment of a Th1 cell to express IFN-.
Different kinetics of Th1 and Th2 differentiation have also been
observed in murine Th cell development. Indeed, it has been shown that
murine Th cells do not begin to express Th2 cytokines until they have
been through several rounds of cell division (24). Thus,
it appears that this is also true for human Th2 commitment.
We have shown that at early time points the ability of an individual
cell to express one Th2 cytokine strongly correlates with its ability
to express either of the other two. On average, the level of
concomitant expression is 3-fold greater than what would be expected
for independent events (Tables II and III). At later time points this
effect is not as apparent, which probably reflects the fact that most
of the cells have committed to Th2 expression by this time. Our data
strongly suggest that the human Th2 cytokines are coordinately
regulated within an individual cell. Whether similar results will be
obtained in murine Th2 cells remains to be determined. However, other
evidence has recently indicated that these genes may also be
coordinately regulated in murine T cells. Kelly and Locksley
(29) have shown that of 23 T cell clones selected for IL-4
expression, 11 also expressed IL-5 or IL-13. Their results differ
considerably from ours in that they observed a high proportion of cells
expressing only IL-4, whereas we detected <1% in our cultures on day
28. This may be because of the different assays used (intracellular
staining vs RT-PCR), the small number of clones analyzed, or the
preselection of IL-4+ clones by Kelly and
Locksley (29). It is interesting to note that at later
time points of Th2 differentiation we did not detect any significant
proportion of cells expressing a single Th2 cytokine. Indeed, 28%
of the cells were expressing IL-4, IL-5, and IL-13, and an additional
40% were expressing IL-5 and IL-13. While this may initially suggest
that there is a closer relationship between IL-13 and IL-5 than between
IL-4 and the other two genes, it merely reflects the relatively low
proportion of cells expressing IL-4 compared with IL-5 and IL-13. The
relatively infrequent expression of IL-4 is intriguing; it suggests
that either the mechanisms that activate IL-4 are inefficient, or that
further differentiation would take place if the Th2 cultures were
extended.
Recent papers by Locksley and colleagues (30, 31) have identified a region between IL-4 and IL-13, termed conserved non-coding sequence-1 (CNS-1), that is conserved between human and mouse. Deletion of CNS-1 in the murine germline compromises Th2 development and the expression of IL-4, IL-13, and IL-5. They have proposed that CNS-1 is a coordinate regulator of all three genes, although down-regulation of IL-5 expression in CNS-1-/- mice was modest, and the cells were still capable of expressing all three genes (30). The results presented here clearly demonstrate that these genes are coordinately regulated, and it will be interesting to determine which other cis elements are required for their coordinated expression in human cells. It will also be interesting to determine the roles played by different signaling pathways in the activation of these genes, and also whether similar coordinated expression is observed with Ag-specific T cell activation.
Transcription factors during Th1/Th2 commitment
During murine Th1/Th2 commitment, the transcription factors T-bet and ERM are selectively expressed in Th1 cells, and GATA3 and c-Maf are selectively expressed in Th2 cells (4). Here we provide evidence that these factors are expressed in a broadly analogous manner during human Th1/Th2 differentiation, but with important differences. We show that GATA3 mRNA is present in resting naive cells and is slightly down-regulated upon acute activation. We also find that GATA3 is still expressed in Th1 cells, but is up-regulated in Th2 cells. We show that c-Maf is present in both Th1 and Th2 cells, but not naive cells and is more highly expressed in Th2 cells. In contrast to GATA3 and c-Maf, both T-bet and ERM are more highly expressed in activated Th1 cells.
On days 14 and 28 virtually all Th1 cells are competent to express
IFN- and do not express detectable Th2 cytokines. Based upon the
data from murine systems it may be surprising that we detected GATA3
and c-Maf expression in Th1 cells. However, GATA3 is required for T
cell development and the expression of the TCR genes, which Th1 cells
presumably express (32, 33). Therefore, we propose that it
is the relative level of GATA3 expression, and probably the other
transcription factors, that regulates the balance between commitment
toward a Th1 or Th2 phenotype rather than the complete presence or
absence of this critical factor. Considerable support for this
possibility can be drawn from analogous work in erythroid lineage
commitment, which has demonstrated that subtle changes in the levels of
GATA1 and GATA2 can affect cell fate decisions (34). It is
interesting to note that the Th2 cells express T-bet upon activation.
This could suggest either that the Th2 cells are not fully committed at
this time point, or that human Th2 cells retain the ability to activate
T-bet and hence can reprogram toward an IFN-+
phenotype when the conditions are favorable, as has been reported by
other groups (35).
The presence of GATA3 mRNA in both naive and Th1 cells demonstrates that GATA3 expression per se is not sufficient for Th2 cytokine production even when the cells are activated. This is in contrast to studies performed in murine Th1 cells, where overexpression of GATA3 can cause Th2 cytokine production in developing Th1 cells (36). It is possible that in human cells an additional Th2-specific factor(s) may be required for Th2 cytokine expression. Alternatively, post-translational modifications of GATA3, such as acetylation (37), may be critical for controlling its mechanism of action in Th1 and Th2 cells.
Taken together, our results show that the closely linked IL-4, IL-5, and IL-13 genes are coordinately regulated during human Th2 differentiation. Furthermore, we show that IL-10 is expressed by a different subset of cells during Th2 differentiation. We also show that there is no correlation between coexpression of the other cytokines examined during either Th1 or Th2 development, even though there is a high degree of concomitant expression.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. David J. Cousins, Department of Respiratory Medicine and Allergy, King’s College, 5th Floor Thomas Guy House, Guy’s Hospital, London, U.K. SE1 9RT. E-mail address: david.cousins{at}kcl.ac.uk
3 Abbreviations used in this paper: ERM, Ets-related molecule; CNS-1, conserved non-coding sequence-1; DHS, DNase I-hypersensitive site; MafLF, c-Maf long form; KIF3A, kinesin superfamily 3A.
Received for publication March 1, 2002. Accepted for publication July 1, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
gene. EMBO J. 10:1187.[Medline]
This article has been cited by other articles:
|
|
 |
|
  R. G. Jenner, M. J. Townsend, I. Jackson, K. Sun, R. D. Bouwman, R. A. Young, L. H. Glimcher, and G. M. Lord The transcription factors T-bet and GATA-3 control alternative pathways of T-cell differentiation through a shared set of target genes PNAS, October 20, 2009; 106(42): 17876 - 17881. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Tsuji, N. K. Altorki, G. Ritter, L. J. Old, and S. Gnjatic Characterization of Preexisting MAGE-A3-Specific CD4+ T Cells in Cancer Patients and Healthy Individuals and Their Activation by Protein Vaccination J. Immunol., October 1, 2009; 183(7): 4800 - 4808. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Hashimoto-Okada, T. Kitawaki, N. Kadowaki, S. Iwata, C. Morimoto, T. Hori, and T. Uchiyama The CD70-CD27 interaction during the stimulation with dendritic cells promotes naive CD4+ T cells to develop into T cells producing a broad array of immunostimulatory cytokines in humans Int. Immunol., August 1, 2009; 21(8): 891 - 904. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Atayar, A. van den Berg, T. Blokzijl, M. Boot, R. D Gascoyne, L. Visser, and S. Poppema Hodgkin's lymphoma associated T-cells exhibit a transcription factor profile consistent with distinct lymphoid compartments J. Clin. Pathol., October 1, 2007; 60(10): 1092 - 1097. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-B. Lee, K.-A Lee, and J. Chang Phenotypic changes induced by IL-12 priming regulate effector and memory CD8 T cell differentiation Int. Immunol., September 6, 2007; (2007) dxm072v1. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Sandig, J. McDonald, J. Gilmour, M. Arno, T. H. Lee, and D. J. Cousins Human Th2 cells selectively express the orexigenic peptide, pro-melanin-concentrating hormone PNAS, July 24, 2007; 104(30): 12440 - 12444. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. De Fanis, F. Mori, R. J. Kurnat, W. K. Lee, M. Bova, N. F. Adkinson, and V. Casolaro GATA3 up-regulation associated with surface expression of CD294/CRTH2: a unique feature of human Th cells Blood, May 15, 2007; 109(10): 4343 - 4350. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Lund, M. Loytomaki, T. Naumanen, C. Dixon, Z. Chen, H. Ahlfors, S. Tuomela, J. Tahvanainen, J. Scheinin, T. Henttinen, et al. Genome-Wide Identification of Novel Genes Involved in Early Th1 and Th2 Cell Differentiation J. Immunol., March 15, 2007; 178(6): 3648 - 3660. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Seddiki, B. Santner-Nanan, S. G. Tangye, S. I. Alexander, M. Solomon, S. Lee, R. Nanan, and B. F. de Saint Groth Persistence of naive CD45RA+ regulatory T cells in adult life Blood, April 1, 2006; 107(7): 2830 - 2838. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Palaniappan, S. Singh, U. P. Singh, R. Singh, E. W. Ades, D. E. Briles, S. K. Hollingshead, W. Royal III, J. S. Sampson, J. K. Stiles, et al. CCL5 Modulates Pneumococcal Immunity and Carriage J. Immunol., February 15, 2006; 176(4): 2346 - 2356. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. N. Georas, J. Guo, U. De Fanis, and V. Casolaro T-helper cell type-2 regulation in allergic disease Eur. Respir. J., December 1, 2005; 26(6): 1119 - 1137. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Xue, S. L. Gyles, F. R. Wettey, L. Gazi, E. Townsend, M. G. Hunter, and R. Pettipher Prostaglandin D2 Causes Preferential Induction of Proinflammatory Th2 Cytokine Production through an Action on Chemoattractant Receptor-Like Molecule Expressed on Th2 Cells J. Immunol., November 15, 2005; 175(10): 6531 - 6536. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Foley, U. Jung, A. Miera, T. Borenstein, J. Mariotti, M. Eckhaus, B. E. Bierer, and D. H. Fowler Ex Vivo Rapamycin Generates Donor Th2 Cells That Potently Inhibit Graft-versus-Host Disease and Graft-versus-Tumor Effects via an IL-4-Dependent Mechanism J. Immunol., November 1, 2005; 175(9): 5732 - 5743. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-K. Jee, J. Gilmour, A. Kelly, H. Bowen, D. Richards, C. Soh, P. Smith, C. Hawrylowicz, D. Cousins, T. Lee, et al. Repression of Interleukin-5 Transcription by the Glucocorticoid Receptor Targets GATA3 Signaling and Involves Histone Deacetylase Recruitment J. Biol. Chem., June 17, 2005; 280(24): 23243 - 23250. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Atayar, S. Poppema, T. Blokzijl, G. Harms, M. Boot, and A. van den Berg Expression of the T-Cell Transcription Factors, GATA-3 and T-bet, in the Neoplastic Cells of Hodgkin Lymphomas Am. J. Pathol., January 1, 2005; 166(1): 127 - 134. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Okamoto, Y. Nukada, K. Tezuka, K. Ohashi, K. Mizuno, and T. Tsuji AILIM/ICOS signaling induces T-cell migration/polarization of memory/effector T-cells Int. Immunol., October 1, 2004; 16(10): 1515 - 1522. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. F. Rogan, D. J. Cousins, S. Santangelo, P. A. Ioannou, M. Antoniou, T. H. Lee, and D. Z. Staynov Analysis of intergenic transcription in the human IL-4/IL-13 gene cluster PNAS, February 24, 2004; 101(8): 2446 - 2451. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
