|
|
||||||||
Department of Cell Biology, University of Alabama, Birmingham, AL 35294
| Abstract |
|---|
|
|
|---|
induces CD40 expression in macrophages and
microglia. IFN-
leads to STAT-1
activation directly and
up-regulation of NF-
B activity due to the secretion and subsequent
autocrine signaling of TNF-
. However, TNF-
alone is not capable
of inducing CD40 expression in these cells. Suppressor
of cytokine signaling 1 protein (SOCS-1) is a cytokine-inducible Src
homology 2-containing protein that regulates cytokine receptor
signaling by inhibiting STAT-1
activation via a specific interaction
with activated Janus kinase 2. Given the important role of CD40 in
inflammatory events in the CNS as well as other organ systems, it is
imperative to understand the molecular mechanisms contributing to both
CD40 induction and repression. We show that ectopic expression of
SOCS-1 abrogates IFN-
-induced CD40 protein expression, mRNA levels,
and promoter activity. Additionally, IFN-
-induced TNF-
secretion,
as well as STAT-1
and NF-
B activation, are inhibited in the
presence of SOCS-1. We conclude that SOCS-1 inhibits cytokine-induced
CD40 expression by blocking IFN-
-mediated STAT-1
activation,
which also then results in suppression of IFN-
-induced TNF-
secretion and subsequent NF-
B activation. | Introduction |
|---|
|
|
|---|
, and
macrophage-inflammatory protein 1
) as well as cytotoxic
radicals (for review, see Ref. 1). The production of IL-12
is thought to be particularly important for promoting T cell maturation
toward the Th1 pathway (3, 4, 5). CD40 has been implicated in the pathogenesis of many human diseases, particularly autoimmune diseases (for review, see Ref. 6). Interaction of CD40-CD154 is necessary for the initiation of insulitis and diabetes in nonobese diabetic mice (7) and has been implicated in the pathogenesis of Alzheimers disease (AD)3 (8, 9). Aberrant expression of CD40 and CD154 has been described in rheumatoid arthritis (10), multiple sclerosis (11), atherosclerosis (12), as well as AD (9, 13, 14, 15). Recently, increased numbers of CD40-positive microglia were detected in HIV-1-infected brain tissue (16). Because CD40 is functionally critical and nonredundant for the activation of immune responses, blocking the interaction between CD40-CD154 with anti-CD154 or CD40-Ig has been shown to be significantly beneficial in animal models of autoimmune diseases such as experimental autoimmune encephalomyelitis (17, 18, 19, 20), graft-vs-host disease (21, 22), and atherosclerosis (23). These findings collectively illustrate the importance of CD40-CD154 interactions for homeostasis of immune responses. Despite the importance of CD40 in regulating the immune system and its involvement in human diseases, little is known about its regulation.
We have previously shown that macrophages and microglia constitutively
express CD40 at a low level, which is enhanced by IFN-
(24, 25). In these cells, IFN-
-activated STAT-1
is critical for
induction of CD40. In addition to the activation of STAT-1
, which
binds to IFN-
activation site (GAS) elements within the CD40
promoter, IFN-
induces the secretion and subsequent autocrine and/or
paracrine signaling of TNF-
(26). The importance of
TNF-
in IFN-
-mediated CD40 expression is demonstrated by the
observation that IFN-
induction of CD40 expression is attenuated in
the presence of a neutralizing anti-TNF-
Ab (26).
Moreover, we have demonstrated that there are critical
B elements
within the CD40 promoter (26). However, although TNF-
is a necessary component of IFN-
-induced CD40 up-regulation, TNF-
treatment in and of itself does not induce CD40 expression in
macrophages/microglia (24).
The suppressor of cytokine signaling 1 protein (SOCS-1) is one of seven
recently discovered cytokine-inducible down-regulators of cytokine
signaling (27, 28, 29). SOCS-1 interacts with phosphorylated
Janus kinase (JAK) 2 via an Src homology 2 domain and has been shown to
specifically inhibit signaling by IFN-
(30).
Additionally, a conserved C-terminal motif among SOCS members, known as
the SOCS box, has been implicated in coupling proteins to proteasomal
degradation (31, 32). A multitude of studies have
implicated SOCS-1 involvement in the inhibition of a number of
signaling pathways (27, 28, 33, 34, 35, 36). However, it appears
that the most important in vivo target of SOCS-1 is the
IFN-
-activated JAK-STAT pathway. This has been demonstrated by the
fact that the lethal perinatal syndrome observed in SOCS-1-deficient
mice, which includes fatty degeneration, necrosis of the liver, and
damage to the pancreas, heart, and skin due to infiltrating T
lymphocytes, macrophages, and eosinophils (37, 38, 39), is
eliminated with Abs to IFN-
or in mice deficient in IFN-
in
addition to SOCS-1 (40). This clearly implicates SOCS-1 as
a specific inhibitor of the IFN-
-mediated JAK-STAT pathway. It is
worthy of comment, however, that mice lacking both SOCS-1 and IFN-
,
though saved from the lethal perinatal syndrome observed in
SOCS-1-deficient mice, develop a variety of chronic infections or
inflammatory lesions as adults (41).
To further define the role of the JAK-STAT pathway in the induction of
CD40 expression in macrophages and to identify a potential means to
inhibit pathological inflammation by down-regulating CD40 expression,
we constructed a murine macrophage cell line stably expressing murine
SOCS-1 to determine its effect on IFN-
-mediated CD40 induction. We
have previously shown that IFN-
-induced STAT-1
phosphorylation is
blunted by ectopic SOCS-1 expression in these cells (42).
In this study, we demonstrate that IFN-
-mediated CD40 up-regulation
in macrophages is abrogated by ectopic SOCS-1 expression. Clues to the
potential mechanisms of this inhibition include the observations that
SOCS-1 inhibits IFN-
-mediated STAT-1
phosphorylation and binding
to the medial GAS element of the CD40 promoter, as well as
IFN-
-mediated NF-
B activation and binding to the distal
B
binding site of the CD40 promoter. We also show that the latter effect
is likely due to the inhibition by SOCS-1 of IFN-
-mediated induction
of TNF-
and its receptor.
| Materials and Methods |
|---|
|
|
|---|
Recombinant murine IFN-
was purchased from Genzyme (Boston,
MA) and murine TNF-
and neutralizing anti-murine TNF-
Ab were
purchased from Endogen (Woburn, MA). Rat IgG2a-
anti-mouse CD40
Ab (clone 3/23), biotinylated mouse anti-rat IgG2a, and
PE-conjugated streptavidin were purchased from BD PharMingen (San
Diego, CA). Mouse anti-human c-myc Ab was purchased from
Calbiochem (La Jolla, CA). Goat anti-human NF-
B p50 and p65 Abs,
rabbit anti-SOCS-1 Ab, and consensus NF-
B binding
oligonucleotide were purchased from Santa Cruz Biotechnology (Santa
Cruz, CA). Abs to STAT-1
and phosphotyrosine-701-STAT-1
were
purchased from Upstate Biotechnology (Lake Placid, NY).
Cells
The murine macrophage cell line RAW264.7 was maintained in DMEM supplemented with 10% FBS as previously described (25).
Stable transfection of SOCS-1
SOCS-1 stable transfectants were created by transfecting RAW cells with the pcDNA3 expression vector containing N-terminal myc-tagged cDNA of mouse SOCS-1 (a generous gift from Prof. A. Yoshimura, Kurume University, Kurume, Japan) using the Lipofectamine Plus method according to the manufacturer (Life Technologies, Rockville, MD) (42). RAW264.7 cells stably transfected with the pcDNA3 plasmid only were used as a negative control. Cells were selected in G418 sulfate (100 µg/ml) and screened for SOCS-1 expression by immunoblotting for c-myc expression as well as fluorescence microscopy for SOCS-1.
CD40 promoter constructs
The characterization of the human CD40 promoter construct (hCD40p0.7) was described previously (25).
RNA isolation, riboprobes, and ribonuclease protection assay (RPA)
Total cellular RNA was isolated from confluent monolayers of
RAW264.7 cells. The riboprobes for murine CD40, IFN regulatory factor
1 (IRF-1), TNF-
, and GAPDH prepared from in vitro
transcription with T7 polymerase are 576, 367, 312, and 270 nt,
respectively. The riboprobes for murine receptor-interacting protein
(RIP), L32, and TNFR1 were purchased from BD PharMingen and prepared
similarly following the manufacturers guidelines. Twenty micrograms
of total RNA from RAW264.7 cells was hybridized with CD40, IRF-1,
TNF-
, and GAPDH riboprobes or with RIP, TNFR1, L32, and GAPDH
(25 x 103 cpm) at 42°C overnight in 20
µl of 40 mM PIPES (pH 6.4), 80% deionized formamide, 400 mM NaOAc,
and 1 mM EDTA. The hybridized mixture was then treated with RNase A/T1
(1/200 dilution in 200 µl of the RNase digestion buffer) at 37°C
for 30 min, analyzed by 5% denaturing (8 M urea) PAGE, and the gels
were exposed to phosphorimaging cassettes. The protected fragments of
the CD40, IRF-1, TNF-
, and GAPDH riboprobes are 419, 314, 270 and
212 nt in length, respectively. Quantification of the protected RNA
fragments was performed by scanning with the PhosphorImager (Molecular
Dynamics, Sunnyvale, CA). Values for CD40, IRF-1, TNF-
, RIP, and
TNFR1 mRNA expression were normalized to GAPDH mRNA levels for each
experimental condition. GAPDH mRNA was used as a housekeeping gene
because its levels are not affected by cytokine treatment.
Nuclear extracts and EMSA
Cells were incubated with medium or IFN-
(10 ng/ml) for
various time periods (024 h), and nuclear extracts were prepared.
EMSA was performed with 510 µg of nuclear extract in a total volume
of 15 µl of binding buffer (50 mM NaCl, 1 mM
MgCl2, 0.1 mM EDTA, 4% glycerol, 0.5 mM DTT, 4
mM Tris-HCl (pH 7.5), 1 µg polydeoxyinosinic-deoxycytidyl acid, and
20,000 cpm 32P-labeled oligonucleotide probe),
and incubated on ice for 15 min. Bound and free DNA were then resolved
by electrophoresis through a 6% polyacrylamide gel in 0.5x
Tris-borate-EDTA buffer at 250 V for 1 h. For supershift
analysis, 1 µg of indicated Ab was added, or for competition
analysis, a 100-fold molar excess of the indicated cold oligonucleotide
was added to the nuclear extracts and incubated on ice for 30 min,
followed by an additional incubation for 15 min with the labeled probe.
The oligonucleotide sequences used as probes include the distal NF-
B
element (CGAGGGAATTTCCTTTGAA) and the medial GAS element
(GGAAACTCTTCCTTGAAACGCCTCC) from the human CD40 promoter
(26).
Transient transfection and analysis
A total of 0.7 µg of the human CD40 (hCD40) promoter construct
was transiently transfected into 2 x 105
SOCS-1 stable transfectants or pcDNA3-transfected RAW264.7 cells in
12-well plates using the LipofectAMINE Plus method as previously
described (25). As a comparison, wild-type RAW264.7 cells
were also transiently transfected with 0.35 µg of the hCD40 promoter
construct and 0.35 µg of either the SOCS-1 plasmid or the empty
pcDNA3 vector. Differences in the amount of DNA were adjusted with the
appropriate empty vector. After 3 h of transfection, cells were
allowed to recover for 4 h before treatment with IFN-
(10
ng/ml) for 12 h, which we have previously determined to be optimal
for IFN-
-induced activation of the hCD40p0.7 construct
(25). Cells were washed with PBS and lysed with 200 µl
of lysis buffer (25 mM triphosphate (pH 7.8), 2 mM DTT, 2 mM
diaminocyclohexane tetraacetic acid, 10% glycerol, and 1% Triton
X-100). Extracts were assayed in triplicate for luciferase activity in
a total volume of 130 µl (30 µl cell extract, 20 mM Tricine, 0.1 mM
EDTA, 1 mM MgCO3, 2.67 mM
MgSO4, 33.3 mM DTT, 0.27 mM CoA, 0.47 mM
luciferin, and 0.53 mM ATP), and light intensity was measured using a
luminometer (Promega, Madison, WI). Luciferase activity was integrated
over a 10-s time period. Extracts were also assayed in triplicate for
protein concentration. The luciferase activity of each sample was
normalized to total protein concentration to yield relative luciferase
activity. Fold induction was calculated as the ratio of relative
luciferase activity between IFN-
and medium-treated samples that
were transfected with the same construct.
Measurement of TNF-
secretion
Cells were incubated in the absence or presence of IFN-
(10
ng/ml) for various time points after which supernatants were collected
and analyzed with a murine TNF-
ELISA kit purchased from R&D Systems
(Minneapolis, MN) following the manufacturers instructions. Samples
were read in triplicate and normalized to total protein levels which
were also determined in triplicate.
Western blotting
For detection of tyrosine-phosphorylated STAT-1
and total
STAT-1
, 100 µg of cell lysates were boiled in sample buffer,
separated on 10% SDS-PAGE, transferred to a nitrocellulose membrane,
and probed with anti-phospho-701-STAT-1
. Membranes were stripped
at 50°C in buffer containing 100 mM 2-ME, 2% SDS, 62.5 mM Tris-HCl
(pH 6.7) with occasional shaking, and reprobed for total STAT-1
protein. The ECL method was used for protein detection.
| Results |
|---|
|
|
|---|
is required for IFN-
induction of CD40, but alone does
not induce CD40 expression
We have recently shown that both IFN-
and TNF-
are required
for CD40 gene expression in macrophages and microglia
(26). FACS analysis demonstrated that IFN-
increases
CD40 protein expression on the cell surface, as measured by mean
fluorescence intensity (Fig. 1
A). TNF-
is required for
IFN-
induction of CD40 expression in RAW264.7 cells. This is
demonstrated by the attenuation of IFN-
-induced CD40 protein
expression by a neutralizing anti-TNF-
mAb (Fig. 1
A).
However, TNF-
treatment alone is unable to induce CD40 expression
(Fig. 1
A). We have previously demonstrated that IFN-
induction of CD40 in these cells requires both STAT-1
and NF-
B
activation (25, 26). TNF-
is a well-known activator of
NF-
B and does so in the RAW264.7 cells (data not shown).
Additionally, recent studies implicate TNF-
as an activator of
STAT-1
in certain cell lines (43, 44, 45). To determine the
reason for the failure of TNF-
to induce CD40, we tested whether or
not TNF-
is able to induce STAT-1
tyrosine phosphorylation. As
shown in Fig. 1
B, TNF-
was unable to induce tyrosine
phosphorylation of STAT-1
in RAW264.7 cells, in contrast to that
seen by IFN-
. The inability of TNF-
to induce tyrosine
phosphorylation of STAT-1
may preclude it from being sufficient to
induce CD40 expression since activated STAT-1
is critical for CD40
induction in these cells (25). Thus, TNF-
alone does
not induce CD40 expression in RAW264.7 cells, but is an important
component of IFN-
-induced CD40 expression.
|
induction of CD40 mRNA and protein
expression
As shown above, IFN-
is a potent inducer of CD40 expression on
macrophages. FACS analysis confirmed a robust induction of CD40 surface
expression in RAW264.7 cells stably transfected with the pcDNA3 control
vector (RAW-pcDNA3) after a 48-h treatment with 10 ng/ml murine IFN-
(Fig. 2
A), comparable to that
seen in untransfected cells (Fig. 1
A). However, in the
RAW264.7 cells stably transfected with SOCS-1, IFN-
-induced CD40
expression is abrogated (Fig. 2
B). mRNA levels of CD40 were
also monitored using ribonuclease protection assay. An 8-h IFN-
treatment (10 ng/ml) led to a 20-fold induction of CD40 mRNA levels in
the RAW-pcDNA3 cells (Fig. 3
, lane
3) and this induction was inhibited by
80% in the presence of
SOCS-1 (lane 6). IRF-1 mRNA induction by IFN-
was
also examined since it is an IFN-
-inducible gene (46).
A 24-fold induction of IRF-1 was observed upon IFN-
treatment (Fig. 3
, lane 3) and
75% inhibition was noted in the presence
of SOCS-1 (Fig. 3
, lane 6). LPS induction of TNF-
was also monitored in this experiment. This signaling pathway was not
affected by SOCS-1 overexpression (Fig. 3
, lanes 2 and
5). These results demonstrate that IFN-
induction of both
CD40 and IRF-1 mRNA expression is inhibited by ectopic SOCS-1
expression in RAW264.7 cells, whereas LPS induction of TNF-
mRNA is
not affected, indicating specificity of SOCS-1 for IFN-
-induced
signaling.
|
|
-induced CD40 promoter activity
The effect of SOCS-1 overexpression on CD40 promoter activity was
analyzed next to determine whether the inhibitory effect was mediated
at the transcriptional level. A 12-h treatment with IFN-
(10 ng/ml)
led to a 3-fold induction of CD40 promoter activity in the RAW-pcDNA3
cells, whereas no induction of CD40 promoter activity was detected in
the RAW-SOCS-1 cells (Fig. 4
A). To determine whether or
not this inhibitory effect was an artifact of chronic SOCS-1
overexpression, wild-type RAW264.7 cells were transiently cotransfected
with the human CD40 promoter construct and either SOCS-1 or the pcDNA3
vector. IFN-
treatment enhanced CD40 promoter activity 4.5-fold,
which was inhibited by transient expression of SOCS-1 (Fig. 4
B).
|
-activated STAT-1
DNA-binding activity is inhibited in
RAW264.7 cells expressing SOCS-1
We have previously shown that IFN-
induction of CD40 promoter
activation is dependent on the STAT-1
transcription factor and that
activated STAT-1
binds to two GAS elements within the CD40 promoter
(25). Given the strong inhibitory effect of SOCS-1 on
IFN-
-induced CD40 expression, we reasoned that IFN-
-activated
STAT-1
may be inhibited by ectopic SOCS-1 expression. To determine
the effect of SOCS-1 on IFN-
activation of STAT-1
, we performed
EMSA using the medial GAS sequence of the CD40 promoter as a probe. As
expected, IFN-
treatment induced STAT-1
DNA-binding activity in
the RAW264.7-pcDNA3 cells in a time-dependent manner, and this was
inhibited in the presence of SOCS-1 (Fig. 5
). This result suggests that the
inhibitory effect of SOCS-1 may be due in part to inhibition of
STAT-1
binding to the medial GAS element of the CD40 promoter.
|
-mediated NF-
B DNA-binding
activity and TNF-
secretion
We have recently shown that another important component of
IFN-
-induced CD40 expression is contributed by TNF-
. IFN-
induces TNF-
secretion in macrophages and microglia, and the
subsequent autocrine or paracrine signaling by TNF-
is necessary for
maximal IFN-
induction of CD40 expression in these cells. This is in
part due to NF-
B activation and binding to the CD40 promoter
(26). To determine the effect of SOCS-1 on IFN-
-induced
NF-
B-binding activity, EMSA experiments were performed using the
distal
B CD40-binding sequence as a probe. In the presence of
SOCS-1, IFN-
was unable to induce NF-
B-binding activity compared
with that observed in pcDNA3 stable transfectants (Fig. 6
A). We confirmed that
IFN-
-induced NF-
B activation is due to induction and subsequent
autocrine/paracrine action of TNF-
by showing that IFN-
-induced
NF-
B activity is attenuated in the presence of a neutralizing
anti-TNF-
Ab (Fig. 6
B). Supershift analysis suggests
that both p65 and p50 subunits of NF-
B are involved in this response
(Fig. 6
C).
|
-mediated TNF-
secretion is necessary for
subsequent NF-
B activation, we next assessed the effect of ectopic
SOCS-1 expression on TNF-
production. RAW cells (pcDNA3 and SOCS-1)
were incubated with IFN-
(10 ng/ml) for various times (024 h),
then supernatants were harvested and analyzed for TNF-
production by
ELISA. IFN-
treatment of pcDNA3-RAW cells led to a time-dependent
induction of TNF-
, while this same response was abrogated in SOCS-1
overexpressors (Fig. 7
-induced
TNF-
production and subsequent activation of NF-
B.
|
-induced TNFR1 and RIP mRNA levels
In addition to the enhanced secretion of TNF-
that leads to
activation of the TNF-
signaling cascade and activation of NF-
B,
we considered the potential role of IFN-
to enhance the sensitivity
of the cell to TNF-
signaling. We examined whether IFN-
may
enhance the expression of TNFR1, as well as RIP, an adaptor protein
important for TNF-
-mediated NF-
B activation (47).
Moreover, we reasoned that since SOCS-1 appears to be a specific
inhibitor of the IFN-
pathway in our system, any IFN-
-mediated
sensitization to TNF-
signaling may be abrogated by SOCS-1
overexpression. As shown in Fig. 8
, RAW-pcDNA3 cells constitutively express TNFR1 mRNA (lane
1) which is enhanced by an 8-h treatment with IFN-
(3.1-fold
induction; lane 2). In addition, a 2.6-fold induction of RIP
mRNA is observed in the RAW-pcDNA3 cells (Fig. 8
, lane 2).
Ectopic expression of SOCS-1 abrogates the IFN-
induction of both
TNFR1 and RIP (Fig. 8
, lane 4). This result suggests that
IFN-
may be involved in priming macrophages for TNF-
action by
enhancing the expression of TNFR1 and RIP. As well, attenuation of
IFN-
-mediated TNFR1 and RIP up-regulation by ectopic SOCS-1 may
contribute to the mechanism of its inhibitory effect on
IFN-
-mediated CD40 up-regulation.
|
does not restore IFN-
-induced CD40
expression in the SOCS-1 transfectants
IFN-
-induced TNF-
production is attenuated in the SOCS-1
transfectants, which is in part responsible for SOCS-1 inhibition of
IFN-
-induced CD40 expression. We next examined whether exogenously
provided TNF-
compensates for the loss of TNF-
production in the
SOCS-1 transfectants for inducing CD40 expression. As shown in Fig. 9
, TNF-
alone does not induce CD40
mRNA expression in RAW-pcDNA3 cells (lane 2), nor
does it enhance IFN-
-induced CD40 mRNA expression (compare
lanes 3 and 4). In the SOCS-1 expressors, IFN-
alone does not induce CD40 expression (Fig. 9
, lane 7), and
the addition of TNF-
with IFN-
treatment was unable to restore
CD40 expression (Fig. 9
, lane 8). Thus, exogenously provided
TNF-
does not compensate for the loss of IFN-
-induced TNF-
production in SOCS-1 transfectants. Although exogenous TNF-
does
activate NF-
B in the SOCS-1 transfectants (data not shown), this
signal, in the absence of IFN-
activation of STAT-1
, is not
sufficient for CD40 expression.
|
| Discussion |
|---|
|
|
|---|
leads to the up-regulation of CD40 on macrophages and
microglia. Necessary for such induction is STAT-1
activation as well
as TNF-
secretion and subsequent autocrine/paracrine induction of
TNF-
-dependent NF-
B activation (25, 26). Although
TNF-
signaling is necessary for CD40 induction, TNF-
treatment
alone does not induce CD40 expression (Figs. 1
-activated STAT-1
and NF-
B, along with constitutively
expressed PU.1/Spi-B, bind to GAS,
B, and etsA and etsB elements
within the CD40 promoter (25, 26). SOCS-1 attenuates
IFN-
signaling in vivo (40) and may have additional
intracellular actions whose importance emerge later in life
(41). It was of interest to us to identify a means to
inhibit CD40 expression in macrophages as well as to further define the
role of IFN-
in CD40 gene induction.
In this current study, we show that IFN-
is unable to induce CD40
protein expression in RAW264.7 cells ectopically expressing SOCS-1
(Fig. 2
). SOCS-1 attenuates IFN-
-induced CD40 mRNA expression (Fig. 3
) as well as promoter activity (Fig. 4
). Additionally, IFN-
-induced
STAT-1
phosphorylation and binding to the medial GAS element of the
CD40 promoter is abrogated (Fig. 5
), and IFN-
induction of NF-
B
binding to the distal
B element of the CD40 promoter is
significantly decreased in RAW264.7 cells ectopically expressing SOCS-1
(Fig. 6
A). The later effect is likely due to the abrogation
of IFN-
mediated TNF-
secretion (Fig. 7
) as IFN-
is unable to
activate NF-
B in the presence of a neutralizing TNF-
Ab (Fig. 6
B). Also in this study is the observation that IFN-
leads to an up-regulation of TNFR1 and RIP (Fig. 8
), both important for
TNF-
-mediated NF-
B activation (53, 54). This finding
provides an additional clue as to how IFN-
is involved in
sensitizing macrophages to TNF-
signaling. Ectopic SOCS-1 expression
inhibits IFN-
-induced TNFR1 and RIP mRNA expression (Fig. 8
).
Further studies need to be done to determine whether TNFR1 and/or RIP
up-regulation is necessary for IFN-
-induced CD40 expression in
macrophages and microglia. Since SOCS-1 is a potent inhibitor of
IFN-
-mediated STAT-1
activation, these results imply that IFN-
induction of TNFR1 and RIP mRNA levels as well as TNF-
secretion are
STAT-1
dependent.
There is one study in the literature implicating SOCS-1 as an inhibitor
of TNF-
signaling (35) and an accumulating amount of
evidence stands to implicate STAT-1
and JAK2 in the TNF-
signaling cascade (43, 44, 45). However, in the RAW264.7
cells, TNF-
does not activate STAT-1
, as assessed by STAT-1
tyrosine phosphorylation (Fig. 1
B). As mentioned previously,
in macrophages, IFN-
-mediated TNF-
secretion (which is inhibited
by SOCS-1) is necessary for CD40 up-regulation (26). We
tested the possibility of restoring IFN-
-mediated CD40 up-regulation
in SOCS-1 overexpressing cells by adding exogenous TNF-
in addition
to IFN-
. Under these conditions, we observed no restoration of CD40
mRNA expression (Fig. 9
) or CD40 promoter activity and protein levels
(data not shown). This result suggests that IFN-
activated STAT-1
(which is effectively blocked by SOCS-1), in addition to
IFN-
-induced TNF-
secretion and subsequent NF-
B activation,
are necessary for optimal CD40 up-regulation. Alternatively, it is also
possible that IFN-
mediates a JAK/STAT-dependent sensitization of
the cells to TNF-
signaling that is necessary for CD40 induction,
such as TNFR1 and RIP up-regulation, and/or that SOCS-1 blocks some
aspect of TNF-
signaling independent of the JAK-STAT pathway. The
mechanism of these effects and the consequences this may have on CD40
expression are currently being investigated.
Recently, it has been shown that an important form of regulation of
CD40 function is through alternative splicing. Tone et al.
(55) have identified a number of CD40 isoforms generated
by alternative splicing. Type I CD40 is the functional form, which
contains the signal-transducing domain. Type II CD40 lacks the
membrane-associated endodomain and seems to inhibit the expression of
signal-transducing CD40 on the cell surface. Type III and IV are
membrane-bound CD40 isoforms with cytoplasmic domains not capable of
signal transduction. Using RT-PCR analysis, SOCS-1 was previously shown
to inhibit IFN-
-mediated CD40 mRNA levels (55);
however, the mechanism of this effect was not explored. Furthermore, in
this same study, SOCS-1 was shown to preferentially inhibit
LPS-mediated type II CD40, but not type I. How SOCS-1 is involved in
the differential splicing is not clear. In light of these recent
findings, it is noteworthy that our riboprobe corresponds to the first
452 bp common to all CD40 isoforms.
CD40 expression by resident cells of the CNS, most likely microglia, is
critical for the infiltration/retention of inflammatory cells in the
CNS, leading to the disease of experimental autoimmune
encephalomyelitis (50). As well, chronic neuroinflammatory
processes including glial activation may play a role in the
pathogenesis of AD. Interestingly, blockade of CD40-CD154 interaction
opposes reactive microglial-mediated neurotoxicity in vitro and is a
candidate for mitigating hyperphosphorylation of tau in a mouse model
for AD (for review, see Ref. 8). Given the important role
of CD40 in inflammatory events in the CNS as well as other organ
systems (for review, see Refs. 6, 56), it is imperative
to understand the molecular mechanisms contributing to both CD40
induction and repression in various cell types. We have previously
shown that IL-4 inhibits IFN-
-induced CD40 expression in
microglia in a STAT-6-dependent and SOCS-1-independent manner
(57). Interestingly, unlike SOCS-1, IL-4 does not inhibit
IFN-
activation of STAT-1
and subsequent IRF-1 up-regulation. Its
inhibitory effect seems to involve the ability of STAT-6 to compete
with STAT-1
for binding to GAS elements within the CD40 promoter.
Thus, numerous mechanisms exist to suppress CD40 expression.
The studies applied here confirm the essential role of IFN-
and the
JAK-STAT pathway in CD40 up-regulation in macrophages. Subsequent to
IFN-
exposure, macrophages up-regulate the expression of TNF-
as
well as TNFR1 and RIP, all important for TNF-
-mediated NF-
B
activation. NF-
B can then enter the nucleus and bind to
B
elements within the CD40 promoter. Additionally, STAT-1
is activated
and binds to GAS elements in the promoter region of CD40. In
SOCS-1-overexpressing cells, IFN-
is unable to induce STAT-1
phosphorylation, TNF-
secretion, TNFR1 and RIP mRNA up-regulation,
and NF-
B DNA-binding activity, making it a potent inhibitor of
CD40 gene expression.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Etty (Tika) Benveniste, Department of Cell Biology, University of Alabama, 1530 3rd Avenue South, MCLM 395, Birmingham, AL 35294-0005. E-mail address: tika{at}uab.edu ![]()
3 Abbreviations used in this paper: AD, Alzheimers disease; GAS, IFN-
activation site; SOCS-1, suppressor of cytokine signaling 1 protein; JAK, Janus kinase; RPA, ribonuclease protection assay; IRF, IFN regulatory factor; RIP, receptor-interacting protein; hCD40, human CD40. ![]()
Received for publication April 4, 2002. Accepted for publication June 18, 2002.
| References |
|---|
|
|
|---|
are required for IL-12 but not prostaglandin E2 secretion by microglia during antigen presentation to Th1 cells. J. Immunol. 162:1384.
-amyloid peptides. Brain Res. Bull. 50:143.[Medline]
-amyloid peptides induce inflammatory cascade in human vascular cells: the roles of cytokines and CD40. Brain Res. 807:110.[Medline]
. Eur. J. Immunol. 28:2537.[Medline]
and ets family members in interferon-
induction of CD40 transcription in macrophages/microglia. J. Biol. Chem. 271:23674.
and NF-
B in IFN-
-induced CD40 expression in microglia/macrophages. J. Biol. Chem. 277:13796.
-induced cell death in fibroblasts. Proc. Natl. Acad. Sci. USA 97:5405.
signaling and prevents the potentially fatal neonatal actions of this cytokine. Cell 98:597.[Medline]
regulation of class II transactivator promoter IV in macrophages and microglia: involvement of the suppressors of cytokine signaling-1 protein. J. Immunol. 166:2260.
B activation. Mol. Cell. Biol. 20:4505.
-induced apoptosis in STAT-null cells due to low constitutive levels of caspases. Science 278:1630.
interferon- and interferon-stimulated genes but is not a primary transcriptional activator of either. Mol. Cell. Biol. 10:2448.
and -
bind to the same two types of tumor necrosis factor receptors and maximally activate the transcription factor NF-
B at low receptor occupancy and within minutes after receptor binding. J. Biol. Chem. 265:15183.
B but not Fas/APO-1-initiated apoptosis. EMBO J. 15:6189.[Medline]
-induced CD40 gene expression in macrophages/microglia. J. Immunol. 165:6235.This article has been cited by other articles:
![]() |
G. Ortiz-Munoz, J. L. Martin-Ventura, P. Hernandez-Vargas, B. Mallavia, V. Lopez-Parra, O. Lopez-Franco, B. Munoz-Garcia, P. Fernandez-Vizarra, L. Ortega, J. Egido, et al. Suppressors of Cytokine Signaling Modulate JAK/STAT-Mediated Cell Responses During Atherosclerosis Arterioscler. Thromb. Vasc. Biol., April 1, 2009; 29(4): 525 - 531. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Qin, S. A. Niyongere, S. J. Lee, B. J. Baker, and E. N. Benveniste Expression and Functional Significance of SOCS-1 and SOCS-3 in Astrocytes J. Immunol., September 1, 2008; 181(5): 3167 - 3176. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. N. Benveniste and H. Qin Type I Interferons as Anti-Inflammatory Mediators Sci. Signal., December 11, 2007; 2007(416): pe70 - pe70. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Lapteva, M. R. Seethammagari, B. A. Hanks, J. Jiang, J. M. Levitt, K. M. Slawin, and D. M. Spencer Enhanced Activation of Human Dendritic Cells by Inducible CD40 and Toll-like Receptor-4 Ligation Cancer Res., November 1, 2007; 67(21): 10528 - 10537. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Qin, K. L. Roberts, S. A. Niyongere, Y. Cong, C. O. Elson, and E. N. Benveniste Molecular Mechanism of Lipopolysaccharide-Induced SOCS-3 Gene Expression in Macrophages and Microglia J. Immunol., November 1, 2007; 179(9): 5966 - 5976. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Lee, H. Qin, and E. N. Benveniste Simvastatin inhibits IFN-{gamma}-induced CD40 gene expression by suppressing STAT-1{alpha} J. Leukoc. Biol., August 1, 2007; 82(2): 436 - 447. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. D'Alimonte, V. Flati, M. D'Auro, E. Toniato, S. Martinotti, M. P. Rathbone, S. Jiang, P. Ballerini, P. Di Iorio, F. Caciagli, et al. Guanosine Inhibits CD40 Receptor Expression and Function Induced by Cytokines and beta Amyloid in Mouse Microglia Cells J. Immunol., January 15, 2007; 178(2): 720 - 731. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Qin, C. A. Wilson, K. L. Roberts, B. J. Baker, X. Zhao, and E. N. Benveniste IL-10 Inhibits Lipopolysaccharide-Induced CD40 Gene Expression through Induction of Suppressor of Cytokine Signaling-3 J. Immunol., December 1, 2006; 177(11): 7761 - 7771. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Qin, C. A. Wilson, S. J. Lee, and E. N. Benveniste IFN-{beta}-induced SOCS-1 negatively regulates CD40 gene expression in macrophages and microglia FASEB J, May 1, 2006; 20(7): 985 - 987. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tedgui and Z. Mallat Cytokines in Atherosclerosis: Pathogenic and Regulatory Pathways Physiol Rev, April 1, 2006; 86(2): 515 - 581. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Calder, L. B. Nicholson, and A. D. Dick A Selective Role for the TNF p55 Receptor in Autocrine Signaling following IFN-{gamma} Stimulation in Experimental Autoimmune Uveoretinitis J. Immunol., November 15, 2005; 175(10): 6286 - 6293. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Qin, C. A. Wilson, S. J. Lee, X. Zhao, and E. N. Benveniste LPS induces CD40 gene expression through the activation of NF-{kappa}B and STAT-1{alpha} in macrophages and microglia Blood, November 1, 2005; 106(9): 3114 - 3122. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Koenigsknecht-Talboo and G. E. Landreth Microglial Phagocytosis Induced by Fibrillar {beta}-Amyloid and IgGs Are Differentially Regulated by Proinflammatory Cytokines J. Neurosci., September 7, 2005; 25(36): 8240 - 8249. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Jackson, C.-R. Yu, R. M. Mahdi, S. Ebong, and C. E. Egwuagu Dendritic Cell Maturation Requires STAT1 and Is under Feedback Regulation by Suppressors of Cytokine Signaling J. Immunol., February 15, 2004; 172(4): 2307 - 2315. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Wesemann and E. N. Benveniste STAT-1{alpha} and IFN-{gamma} as Modulators of TNF-{alpha} Signaling in Macrophages: Regulation and Functional Implications of the TNF Receptor 1:STAT-1{alpha} Complex J. Immunol., November 15, 2003; 171(10): 5313 - 5319. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Park, S. Y. Park, E.-h. Joe, and I. Jou 15d-PGJ2 and Rosiglitazone Suppress Janus Kinase-STAT Inflammatory Signaling through Induction of Suppressor of Cytokine Signaling 1 (SOCS1) and SOCS3 in Glia J. Biol. Chem., April 18, 2003; 278(17): 14747 - 14752. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Von der Thusen, J. Kuiper, T. J. C. Van Berkel, and E. A. L. Biessen Interleukins in Atherosclerosis: Molecular Pathways and Therapeutic Potential Pharmacol. Rev., March 1, 2003; 55(1): 133 - 166. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |