The JI Acurri Cytometers
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gray Parkin, K.
Right arrow Articles by Witte, P. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gray Parkin, K.
Right arrow Articles by Witte, P. L.
The Journal of Immunology, 2002, 169: 2292-2302.
Copyright © 2002 by The American Association of Immunologists

Expression of CD28 by Bone Marrow Stromal Cells and Its Involvement in B Lymphopoiesis1

Kirstin Gray Parkin*,{dagger}, Robert P. Stephan{ddagger}, Ron-Gran Apilado*, Deborah A. Lill-Elghanian*, Kelvin P. Lee2,§, Bhaskar Saha and Pamela L. Witte3,*,{dagger}

* Program for Immunology and Aging, Department of Cell Biology, Neurobiology, and Anatomy, and {dagger} Department of Microbiology and Immunology, Loyola University Medical Center, Maywood, IL 60153; {ddagger} Division of Developmental and Clinical Immunology and Department of Medicine, University of Alabama, Birmingham, AL 35294; § Immune Cell Biology Program, Naval Medical Research Institute, Bethesda, MD 20889; and National Center for Cell Science, Ganeshkhind, Pune University Campus, Maharashtra, India


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Young mice lacking CD28 have normal numbers of peripheral B cells; however, abnormalities exist in the humoral immune response that may result from an intrinsic defect in the B cells. The goal of this study was to assess whether CD28 could be involved in the development of B cells. CD28 mRNA was detected preferentially in the fraction of bone marrow enriched for stromal cells. Flow cytometry and RT-PCR analysis demonstrated that CD28 was also expressed by primary-cultured stromal cells that supported B lymphopoiesis. Confocal microscopy revealed that in the presence of B-lineage cells, CD28 was localized at the contact interface between B cell precursors and stromal cells. In addition, CD80 was detected on 2–6% of freshly isolated pro- and pre-B cells, and IL-7 stimulation led to induction of CD86 on 15–20% of pro- and pre-B cells. We also observed that stromal cell-dependent production of B-lineage cells in vitro was greater on stromal cells that lacked CD28. Finally, the frequencies of B-lineage precursors in the marrow from young (4- to 8-wk-old) CD28-/- mice were similar to those in wild-type mice; however, older CD28-/- mice (15–19 mo old) exhibited a 30% decrease in pro-B cells and a 50% decrease in pre-B cells vs age-matched controls. Our results suggest that CD28 on bone marrow stromal cells participates in stromal-dependent regulation of B-lineage cells in the bone marrow. The localization of CD28 at the stromal cell:B cell precursor interface suggests that molecules important for T cell:B cell interactions in the periphery may also participate in stromal cell:B cell precursor interactions in the bone marrow.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
There are at least two points in the life of a B cell when cell-cell contact plays a major role in survival, differentiation, or overall function of the B cell. During development in the bone marrow, B cell precursors depend on contact with bone marrow reticular stromal cells for survival and proliferation (1). Then, after leaving the bone marrow and migrating to secondary lymphoid organs, mature B cells depend on contact with T cells for activation, proliferation, and differentiation (2). Although the molecules involved in the interaction between mature B cells and T cells in the periphery have been well characterized, limited information exists on the molecules mediating the interaction between stromal cells and B cell precursors in the bone marrow. Adhesion molecules (VCAM-1, VLA-4, CD44) are necessary for functional interaction of pro-B cells and stromal cells (3, 4, 5, 6), but involvement of other cell surface moieties is virtually unknown. It may be useful to consider the pro-B:stromal cell interaction, not as a unique event, but having parallels with the B cell:T cell interface. For example, the costimulatory molecules CD80 and CD86 have been suggested to play a role in the selection of developing B cells in the bone marrow (7, 8). However, whether bone marrow stromal cells express CD28, the ligand for CD80/CD86, has not been previously reported. While characterizing molecules expressed on the surface of bone marrow stromal cells in long-term bone marrow cultures, we discovered that the stromal cells do indeed express CD28. We therefore wanted to examine whether CD28 affects the ability of bone marrow stromal cells to support B lymphopoiesis.

CD28 has been previously characterized as a potent costimulatory molecule primarily found on T cells, where it interacts with CD80 and CD86 on activated B cells and APC (9). Similar to other molecules important for the activation of T cells, such as the TCR and protein kinase C{theta}, CD28 localizes to a central region at the T cell:B cell interface (10). Ligation of CD28 in combination with TCR activation leads to increased production of IL-2 and changes in the T cell cytoskeleton, including reorientation of the microtubule-organizing center to the T cell:B cell interface (11, 12). This reorientation of the microtubule-organizing center helps to direct cytokine secretion toward the interacting B cell by polarizing the Golgi complex and associated secretory organelles toward the T cell:B cell interface (13). Similar directed secretion of cytokines from stromal cells to pro-B cells has been proposed based on functional studies (14) and the observation that at least one molecule, {beta}1 integrin, localizes to the stromal cell:B-lineage cell interface (15).

The direct effect of CD28:CD80/CD86 interactions on B cells remains largely unclear, although previous studies have reported that CD80 is phosphorylated following B cell activation (16). CD28-/- mice exhibit decreased levels of basal IgG (17), perhaps due to a lack of T cell help or because of an intrinsic defect in the B cells. In addition, studies by Ferguson et al. (18) demonstrated that the ability of B cells to undergo somatic hypermutation and form germinal centers in response to a T-independent Ag is compromised in mice lacking CD28. These studies suggest that mature B cells from CD28-/- mice may have intrinsic deficiencies in their response to Ag. Whether an intrinsic defect in the mature B cells could result from a lack of CD28 costimulation to B cell precursors in the bone marrow has not been addressed. It is possible that CD28 contributes to both the development of B cells in the bone marrow as well as the function of B cells in the periphery. Thus, we proposed that CD80 and CD86 are expressed on B cell precursors and that CD28 on stromal cells participates in the ability of stromal cells to support B lymphopoiesis. In our studies we found that CD80 is expressed by a small percentage of B cell precursors, and both CD80 and CD86 could be induced on a subset of B cell precursors following treatment with IL-7. We also observed that stromal cell-dependent expansion of B cell precursors was enhanced on CD28-/- stromal cells or in medium obtained from CD28-/- stromal cells in vitro. In addition, we compared young and old wild-type (WT)4 and CD28-/- mice and discovered an age-related alteration in B-lineage cells in the bone marrow of aged CD28-/- mice. Together, our data provide evidence of a role for CD28 in the development of B cell precursors in the bone marrow.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

One- to 24-mo-old BALB/c female mice were purchased from the National Institute on Aging (Bethesda, MD). C57BL/6CD28-/- mice were obtained from The Jackson Laboratory (Bar Harbor, ME) and were originally derived in the laboratory of Dr. T. Mak (17). Fifteen- to 19-mo-old C57BL/6CD28-/- were purchased from The Jackson Laboratory at 6 mo of age as retired breeders or at 8 wk of age and then housed in the Comparative Medicine Facility at Loyola University Medical Center until the time of the experiment. Where noted in Results, separate analyses were performed using 3- or 14- to 15-mo-old BALB/cCD28-/- mice obtained from the Naval Medical Research Institute (Bethesda, MD) and age-matched BALB/c controls (obtained from National Institute on Aging).

Antibodies

The following conjugated rat mAbs were purchased from BD PharMingen (San Diego, CA): PE-anti-mouse CD45R/B220 (RA3-6B2), biotin-anti-mouse CD43 (S7), and FITC-anti-mouse Ly-6G (Gr-1). FITC-conjugated AffiniPure F(ab')2 donkey anti-mouse IgM, µ-chain specific, biotin-SP-conjugated AffiniPure F(ab')2 goat anti-Syrian hamster IgG, and FITC-conjugated AffiniPure Fab rabbit anti-goat IgG were purchased from Jackson ImmunoResearch Laboratories (West Grove, PA). Hamster anti-mouse CD80 (clone 1610-A1) and rat anti-mouse CD86 (clone GL1) Abs were either purified by protein A affinity chromatography and conjugated to FITC or purchased from BD PharMingen. Hamster anti-mouse CD28 Ab (clone 37.51) was purchased from BD PharMingen, and goat anti-mouse CD28 Ab (clone M-20) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Biotin-conjugated rat anti-mouse IgD (SBA-1) was purchased from Southern Biotechnology Associates (Birmingham, AL). Mouse anti-{alpha} smooth muscle actin-Cy3 (clone 1A4) was purchased from Sigma-Aldrich (St. Louis, MO). Streptavidin-allophycocyanin and streptavidin-FITC (BD PharMingen) were used to reveal the biotin-conjugated Abs.

FACS analysis of bone marrow cells

The strategy for discriminating bone marrow B-lineage subpopulations was modified from that described by Hardy et al. (19) and has been used by our laboratory in previous experiments (20). One million freshly isolated bone marrow cells were sequentially stained with one of the following combinations of Abs: 1) anti-B220, anti-CD43, and anti-IgM; 2) anti-B220, anti-IgM, and anti-IgD; or 3) anti-B220, anti-CD43, and anti-CD80 or anti-CD86 for 30 min at 4°C in the dark. Between all stainings the cells were washed three times with HBSS containing 5% heat-inactivated FBS. The developmental stages were defined as: pro-B, B220lowCD43+IgM-; pre-B, B220lowCD43-IgM-; newly formed B cells, B220lowIgM+IgD-; and mature B cells in the marrow, B220highIgM+IgD+. All analyses were performed on a dual laser FACStarPlus (BD Biosciences, San Jose, CA) gated on all viable cells. Calibration of the FACStarPlus was manually performed daily using Rainbow Calibration Particles (Spherotech, Libertyville, IL).

Induction of CD80/CD86 on freshly isolated pro-B and pre-B cells

Pro-B cells (B220lowCD43+IgM-) and pre-B cells (B220lowCD43-IgM-) were FACS-sorted from freshly harvested bone marrow of BALB/c mice (4 wk of age). The staining procedure followed that described above. Ten thousand FACS-sorted pro-B or pre-B cells were cultured in the presence of the indicated factor in a 100-µl total volume at 37°C in 7.5% CO2 for 1–4 days. Recombinant murine IL-7 (Genzyme, Cambridge, MA) was used at 5.0 ng/ml; bacterial LPS (Sigma-Aldrich) was used at 25 µg/ml. The pre-B cells were examined 1 day after culture initiation, since pre-B cells undergo rapid spontaneous apoptosis (14) (R. P. Stephan, unpublished observations). After 1–4 days the lymphoid cells were harvested by washing each well with 0.02% EDTA. The cells were then stained with anti-B220 and anti-CD80 or anti-CD86. Propidium iodide (PI) was included in the samples at the time of analysis to ensure that only viable cells were analyzed.

Preparation of Whitlock-type long term bone marrow cultures for B lymphocytes (LTBMC-B)

LTBMC-B (21) were initiated from the pooled femoral and tibial bone marrow of BALB/c or C57BL/6 female mice, 1–3 mo of age, and were grown in RPMI 1640 supplemented with 5% FBS (selected lot 14 M73 (Summit, Fort Collins, CO) or selected lot AJM11262 (HyClone Laboratories, Logan, UT)), L-glutamine, penicillin, streptomycin, and 5 x 10-5 M 2-ME. By 4 wk, a complex adherent layer, consisting of stromal cells and macrophages, had formed and was supporting ongoing B lymphopoiesis.

Cell lines

The following stromal cells lines were maintained as previously described: BMS2, OP42, S17, CBA20, NX4, and NU14 (22, 23). CR3 and CR4 are stromal cells lines previously derived in our laboratory from LTBMC-B by R. Stephan and D. Lill-Elghanian. The dendritic cell line, GBE-16, was previously derived from the spleen of a 22-mo-old BALB/c mouse by Dr. H.-M. Jack and G. Beck-Engeser and maintained in medium used for LTBMC-B (described above).

Discrimination of CD28 on primary cultured stromal cells by flow cytometry

Using the FACS as previously described (24), reticular-type stromal cells from LTBMC-B were gated based on differential forward vs side scatter and the uptake of 1,1'-dioctadecyl-1–2,3,3',3-tetramethyl-indocarocyanine perchlorate-labeled acetylated low density lipoprotein (Biomedical Technologies (Stoughton, MA) or Molecular Probes (Eugene, OR)). Briefly, LTBMC-B were incubated for 3 h with 5 µg acetylated low density lipoprotein at 37°C in 7.5% CO2. Lymphoid cells were removed by addition of 0.02% EDTA. The adherent cells (stromal cells and macrophages) and any remaining lymphocytes were then harvested by treatment with 0.25% trypsin or by gently scraping with a silicon rubber policeman. Aliquots of the adherent cells from LTBMC-B were incubated on ice with biotinylated-anti-CD28, followed by streptavidin-allophycocyanin. Data were obtained using a live stromal cell gate in which adherent cells were distinguished from lymphocytes by high forward and side scatter, and stromal cells were distinguished from macrophages by lack of acetylated LDL uptake. All analyses were performed 4–7 wk after culture initiation.

Separation of bone marrow into aggregated and deaggregated populations

Isolation of the aggregated (stromal cell-enriched) and deaggregated (stromal-depleted) populations was performed as described previously (25). Briefly, dispersed femoral bone marrow cells were suspended at 3 femur equivalents/ml and vigorously pipetted to disrupt nonspecific clumping of the cells. One milliliter of this suspension was carefully layered over 3 ml cold FBS in a 5-ml tube. Cellular aggregates were allowed to settle by placing the tube on ice in a vertical position. After 15 min, the aggregated cells were collected as the lower-most 1 ml, and the top 1 ml was collected as the deaggregated population.

RT-PCR

Expression of CD28, CD80, CD86, and {beta}-actin RNA was analyzed by RT-PCR. Total RNA was isolated from bone marrow, the aggregated and deaggregated bone marrow cell fractions, FACS-purified stromal cells from LTBMC-B (as described above), and FACS-sorted pro- and pre-B cells using guanidine isothiocyanate for lysis and separation on cesium chloride gradients. cDNA was prepared by addition of 4 µg total RNA into a 20-µl reaction mixture containing 200 U Moloney murine leukemia virus reverse transcriptase, 94 pmol random hexamers, 975 U/ml ribosomal RNasin, 10 mM DTT (Promega, Madison, WI), and 1 mM each of dATP, dCTP, dGTP, and dTTP (PerkinElmer, Foster City, CA). Samples were kept at room temperature for 10 min, followed by a 2-h incubation at 37°C. Transcription was stopped by heating at 95°C for 10 min. Samples were stored at -20°C until used in PCR reactions.

PCR amplifications were performed using the cDNA at an 1.0 µg RNA equivalent. The final volume of each PCR reaction was 100 µl and consisted of 1x PCR buffer containing 1.5 mM MgCl2; 200 µM each of dATP, dCTP, dGTP, and dTTP; 2.5 U AmpliTaq DNA polymerase (PerkinElmer); and 1 µM each of 5' and 3' primers. Primer oligonucleotides were: CD28 5' primer, TACTTCTGCAAAATTGAGTTCATG; CD28 3' primer, GGGGAGTCATGTTCATGTAG; {beta}-actin 5' primer, ATGGATGACGATATCGCT; {beta}-actin 3' primer, ATGAGGTAGTCTGTCAGGT; CD80 3' primer, CAGGAGGATTGCTGCAAGCT; CD80 5' primer, CTGCAAACACGGTTCTCTAGGTG; CD86 3' primer, TGTAGACGTGTTCCAGAACTTACGG; and CD86 5' primer, CTTCTTAGGTTTCGGGTGACCTTG. cDNAs were amplified for 35 cycles, consisting of 1 min at 94°C, 1 min at 54°C, and 2 min at 72°C, followed by a 4°C soak. PCR products were resolved by electrophoresis of 10 µl of each CD28 PCR reaction mixture precipitated from ethanol and were redissolved in 20 µl TE buffer or 10 µl of each CD80, CD86, or {beta}-actin PCR reaction mixture on a 5% polyacrylamide gel and were visualized by UV illumination after staining with ethidium bromide. PCR products were compared against a 100-bp DNA m.w. marker (Life Technologies, Grand Island, NY). Splenocytes treated with Con A (4 µg/ml; Sigma-Aldrich) for 48 h served as a positive control.

Confocal immunofluorescence microscopy

Total adherent cells, consisting of stromal cells and macrophages, were removed from LTBMC-B using 0.25% trypsin and plated at 5 x 104 cells/well in Permanox chamber slides (Nunc, Naperville, IL). The adherent cells were cultured for 3 days before addition of B-lineage lymphocytes. Precursor B lymphocytes were obtained from LTBMC-B by detaching the lymphocytes from the adherent layer with 0.02% EDTA. The recovered lymphocytes were then added directly to the adherent cells for 48 h. The cells were fixed in acetone and blocked with goat IgG or rabbit IgG, respectively. Then the cells were incubated with one of the following primary Abs: hamster anti-mouse CD28, hamster IgG, goat anti-mouse CD28, or goat IgG. Biotin-conjugated goat anti-hamster IgG and strepavidin-FITC, or FITC-conjugated rabbit anti-goat IgG were used to detect the primary Abs. In addition, mouse anti-{alpha} actin-Cy3 was used to define stromal cells where indicated. The slides were mounted in Fluorosave reagent (Calbiochem, San Diego, CA) and stored at 4°C until analysis. Fluorescence confocal microscopy was performed on a Zeiss LSM 510 microscope (New York, NY) with a x63 oil objective. An HeNe laser at 543 nm was used to detect allophycocyanin fluorochrome, and an argon laser at 458–488 nm was used to detect FITC fluorochrome.

Stromal-dependent survival and proliferation of pro-B cells

LTBMC-B were initiated with bone marrow from C57BL/6 (WT) and C57BL/6 CD28-/- (CD28-/-) mice. Stromal cells were FACS-sorted from LTBMC-B (as described above) into 96-well flat-bottom plates at 1 x 104 cells/well and incubated for 4–6 days. Pro-B cells were then FACS-sorted from fresh WT bone marrow and added to the stromal cells for 24, 48, 72, or 96 h. To harvest the B-lineage lymphocytes, medium was removed from the wells, and 0.02% EDTA was added to detach the B lymphocytes from the adherent stromal cells. The B lymphocytes from each well of an experimental group were pooled and counted to determine the average number of B lymphocytes per well. For experiments using stromal-conditioned medium, 50 µl medium was removed from the FACS-sorted WT or CD28-/- stromal cells after 4–6 days of culture. The conditioned medium was immediately added to FACS-sorted pro-B cells at a 1/1 dilution. The lymphocytes were then harvested after 96 h and counted.

Annexin V staining of B cell precursors

Purified pro-B cells and stromal cells were cocultured as indicated in Results. After being harvested from stromal cells, B-lineage lymphocytes were stained with annexin V-FITC (BD PharMingen) to determine the percentage of cells undergoing apoptosis (26). Briefly, B lymphocytes were washed in cold PBS and then resuspended in 100 µl binding buffer (10 mM HEPES/NaOH (pH 7.4) and 140 mM NaCl2). Five microliters of annexin V-FITC and 10 µl PI (50 µg/ml) were added and incubated at room temperature in the dark for 30 min before flow cytometric analysis. Cells that were positive for annexin V and negative for PI were recorded as undergoing apoptosis.

Bioassay for comparing production of IL-7 by WT and CD28-/-stromal cells

WT and CD28-/- stromal cells were FACS-sorted from respective LTBMC-B (as described above) at 1 x 104 cells/well. IL-7-dependent pre-B cell lines were added to the stromal cells at 1 x 104 cells/well and cultured for 96 h. Three IL-7-dependent pre-B cell lines, BC76, BC715, and BC77, were used in each experiment (donated by Dr. P. Kincade and previously characterized as solely dependent on IL-7, except BC76, which is responsive to IL-7 and an unknown stromal-derived factor (14)). The pre-B cells were then harvested using 0.02% EDTA and counted. Fold change was calculated as the number of harvested cells per starting cell number.

Data analysis

Statistical analysis of the results was performed using unpaired Student’s t test (GraphPad Software, San Diego, CA). Values of p < 0.05 were considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Constitutive expression of CD28 by bone marrow stromal cells

To examine CD28 expression in the bone marrow, freshly isolated murine bone marrow was separated into aggregated (stromal cell-enriched) and deaggregated (stromal cell-depleted) fractions, as previously described (22), and analyzed by RT-PCR. As shown in Fig. 1GoA (lanes 3 and 4), CD28 mRNA was detected in the aggregated bone marrow fraction, yet CD28 mRNA was greatly reduced in the deaggregated bone marrow fraction. The aggregate fraction contains reticular stromal cells tightly adhered to hemopoietic cells, including B cell precursors (25). Although CD28+ T cells may be present in the aggregates, the amount of CD28 mRNA contributed by T cells would probably be similar in the deaggregated and aggregated fractions, since the frequency of lymphoid cells is similar in the two groups. Also, stromal cells are enriched 50-fold in the aggregate fraction compared with the deaggregated fraction. Thus, the stromal cells in the aggregates are the most likely source of the CD28 mRNA. The adhesive nature of the aggregates made it difficult to analyze CD28 Ag expression on stromal cells isolated directly from the bone marrow (27). Therefore, an alternative strategy was used to assess CD28 expression on isolated bone marrow stromal cells from long term bone marrow cultures. Primary cultured stromal cells were isolated by FACS-sorting from LTBMC-B as previously described by our laboratory (24). As shown in Fig. 1GoA (lane 2), the FACS-purified stromal cells from LTBMC-B also expressed CD28 mRNA. In addition, flow cytometry, using two different Abs against CD28, confirmed that CD28 protein was expressed on the surface of most primary-cultured stromal cells (Fig. 1GoB). The level of CD28 on stromal cells was compared with that expressed by Con A-activated T cells (Fig. 1Go, lane 1) and thymocytes (Fig. 1GoC). As shown, the level of CD28 surface expression was more heterogeneous on stromal cells compared with activated T cells and thymocytes. We also observed that surface expression of CD28 was undetectable on primary stromal cells after five passages in culture, and CD28 was undetectable on the following stromal cell lines: CR3, CR4, BMS2, OP42, S17, CBA20, NX4, and NU14 (data not shown). Thus, CD28 was detected on primary stromal cells, and the level of CD28 expression was found to diminish with consecutive in vitro passages.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 1. The expression of CD28 in WT bone marrow and primary cultured, reticular stromal cells. A, RT-PCR analysis. Lane 1, positive control, Con A-activated spleen cells; lane 2, primary cultured stromal cells purified from LTBMC-B by FACS; lanes 3 and 4, fresh bone marrow cells divided into the stromal cell-enriched fraction (aggregated BM; lane 3) and stromal cell-depleted fraction (deaggregated BM; lane 4). The expression of {beta}-actin served as a control for the relative quality and quantity of RNA present in each sample. B–D, Flow cytometric analysis of CD28 surface expression on stromal cells from LTBMC-B (B), thymocytes from 5-wk-old C57BL/6 mice (C), and B-lineage cells from LTBMC-B (D). The solid histogram shows hamster anti-CD28 (37.51) staining. The open histogram shows staining with isotype-matched hamster IgG. Note in B that the overall increase in mean fluorescence intensity is due to autofluorescence from the stromal cells.

 
Upon interaction with a B cell, CD28 on T cells colocalizes to the T cell:B cell interface

To determine whether the distribution of CD28 on stromal cells changes in the presence of B cell precursors, immunofluorescence was performed on primary cultured stromal cells in the absence and the presence of B cell precursors. Stromal cells were FACS-sorted into chamber slides and double-stained for CD28 (FITC, green) and {alpha}-actin (APC, red), which is typically expressed by marrow reticular stromal cells (27). Two different Abs were used to detect CD28 protein: monoclonal hamster anti-mouse CD28 (17) and polyclonal goat anti-mouse CD28 (10). Similar results were obtained with both Abs. As shown, {alpha}-actin-positive cells were large and reticular in shape, a common morphology previously described for stromal cells (Fig. 2Go). Approximately 70–80% of the stromal cells expressed CD28 protein, and the relative intensity of CD28 staining was heterogeneous among individual stromal cells, which correlated with the flow cytometry results described in Fig. 1Go. In the absence of B cell precursors, CD28-positive stromal cells displayed a heavier deposition of CD28 around the nucleus, with patches of CD28 spreading out into the stromal cell body (Fig. 2Go, A, D, and E). To determine whether the distribution of CD28 on stromal cells changed in the presence of B cell precursors, immunofluorescence was performed on stromal cells cocultured with B-lineage cells for 48 h before fixation. Notably, CD28 protein was localized in distinct, bright patches where the B-lineage cells contacted the stromal cells (Fig. 2Go, B, D, and E). An extensive examination by fluorescence and phase microscopy verified that each fluorescent patch was associated with a lymphocyte contacting a stromal cell body or process. Furthermore, flow cytometric analysis revealed that CD28 was undetectable on B-lineage cells removed from the stromal cells (Fig. 1GoD), indicating that the CD28 protein was associated with the stromal cells and not the lymphocytes. Thus, the distribution of CD28 on stromal cells changed in the presence of B cell precursors and localized to the stromal cell:B cell precursor interface.



View larger version (83K):
[in this window]
[in a new window]
 
FIGURE 2. Localization of CD28 on stromal cells. Adherent cells (stromal cells and macrophages) from LTBMC-B were plated in chamber slides at a concentration of 5 x 104 cells/well and cultured for 3 days without B cells before fixation. Precursor B cells from LTBMC-B (1 x 104) were added to each well of adherent cells (prepared as described above) and cultured for 48 h before fixation. The cells were then stained with the following primary Abs: goat anti-mouse CD28 (A and B), goat IgG (C), hamster anti-mouse CD28 (D and E), or hamster IgG (F). Goat Abs were detected with rabbit anti-goat IgG-FITC (A–C), and hamster Abs were detected with goat anti-hamster IgG-FITC (D–F). {alpha}-Actin is expressed by reticular stromal cells; thus, mouse anti-{alpha}-actin-Cy3 (D–F) was used to visualize stromal cells. The pictures represent an overlay of green fluorescence (A–C) or red and green fluorescence (E and F) on the differential interference contrast (DIC), except in D, in which only the green fluorescence of E is shown. Red arrows are used to aid visualization of the stromal cells in A–C, and B cell precursors (BCP) are indicated.

 
Expression of known ligands for CD28 on bone marrow cells

Since CD28 was found to be expressed on stromal cells, we wanted to determine whether the ligands for CD28 were expressed on B lymphoid precursors that contact stromal cells in the bone marrow (4, 28). Expression of CD80 and CD86, the known ligands for CD28, was examined on developing B cells isolated from both bone marrow and LTBMC-B using flow cytometry and RT-PCR analysis (Fig. 3Go). CD80 was detected by flow cytometry on 4–6% of pre-B cells and 2–4% of pro-B cells isolated directly from bone marrow (Fig. 3GoA). Likewise, 14–17% of pre-B cells and 9–14% of pro-B cells isolated from LTBMC-B expressed CD80 (Fig. 3GoD). CD80 mRNA was detected by RT-PCR analysis in B-lineage cells from LTBMC-B and pre-B cells isolated from bone marrow; however, CD80 mRNA was undetectable in pro-B cells isolated from bone marrow (Fig. 3Go, C and F). Two different size CD80 mRNA products were detected in the pre-B cells from bone marrow and probably represent alternatively spliced RNA (29). Unlike CD80, CD86 was undetectable on pro- and pre-B cells, isolated from bone marrow or LTBMC-B, by flow cytometric analysis (Fig. 3Go, B and E). However, small amounts of CD86 mRNA were detected by RT-PCR in pro- and pre-B cells isolated from bone marrow (Fig. 3GoB). CD80 and CD86 were both undetectable on freshly isolated sIgM+ bone marrow cells (data not shown).



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 3. Expression of CD80/CD86 on B-lineage cells. Flow cytometry and RT-PCR analysis were performed on cells from LTBMC-B (A–C; n = 3) and freshly isolated bone marrow (D–F; n = 4). For flow cytometric analysis, B220lowIgM- lymphocytes were gated and then examined for CD80 (A and D) and CD86 (B and E) expression on CD43- (pre-B) and CD43+ (pro-B) cells. Data for one experiment are shown. The numbers represent the percentage of B220lowIgM- cells within in each quadrant. Quadrant gates were set based on staining with isotype controls. RT-PCR analysis was performed on pro- and pre-B cells FACS-sorted from fresh bone marrow (C) and B-lineage cells isolated from LTBMC-B (F). The dendritic cell line GBE-16 (DC) was used as a positive control for CD80 and CD86 expression, and samples run without reverse transcriptase (-) served as the negative control.

 
Neither CD80 nor CD86 is expressed by mature B cells unless induced by T cells or cytokines (30, 31). Previous reports documented that CD80/CD86 expression can be induced by treatment with IL-7 on a human pre-B cell line and on leukemia cells (32, 33). To ascertain whether CD80 or CD86 expression could be induced on developing mouse B-lineage cells, FACS-purified pro-B cells (B220lowCD43+IgM-) or pre-B cells (B220lowCD43-IgM-) were cultured with IL-7 and then stained with Abs specific for CD80 or CD86. After 96 h, surface expression of CD86 was detected on 15–20% of B-lineage cells in cultures initiated with pro-B cells and IL-7, and CD80 expression was detected on 5–8% of B-lineage cells in the same cultures (Fig. 4GoA). In a separate experiment the expression of CD86 was observed as early as 42 h of culture with IL-7 (not shown). Likewise, CD86 was observed on B-lineage cells in cultures initiated from pre-B cells after 18 h of stimulation with IL-7 or LPS (Fig. 4GoB; later time points were not examined due to rapid cell death of pre-B cells). When pro-B (B220lowCD43+) cells were cultured with IL-7, the induced CD86 expression was found primarily on B220lowIgM- cells that were probably pro- or pre-B cells. In contrast, when the quiescent, small pre-B cells (B220lowCD43-) were cultured overnight with LPS, the small subset of the cells that expressed CD86 also expressed higher levels of B220, which is characteristic of mature B cells. Therefore, both the stimulus and the stage of the cells may be important for the induced expression of CD86 on B cell precursors.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 4. Induction of CD80/CD86 on purified bone marrow B-lineage precursors. A, FACS-purified pro-B cells (B220lowCD43+IgM-) from fresh bone marrow were cultured with 5 ng/ml recombinant murine IL-7 for 96 h, and the expression of CD80 or CD86 was determined by flow cytometry. The shaded histogram shows staining with nonspecific hamster IgG (1.6% positive). B, FACS-purified pre-B cells (B220lowCD43-IgM-) were cultured for 18 h with 5 ng/ml IL-7, and the expression of CD86 was determined. CD86 was expressed by 1.7% of the cells after culture with medium alone (not shown). The shaded histogram shows staining with irrelevant hamster IgG (0.3% positive). Dead cells were excluded from the analysis with PI. The results in A represent one of four experiments, and those in B represent one of two experiments.

 
Comparison of the ability of WT and CD28-/- stromal cells to support pro-B cell expansion

Signals leading to the proliferation and survival of pro-B cells are received from interacting stromal cells and soluble growth factors produced by the stromal cells (1). On T cells, ligation of CD28 increases the production of growth factors (9). During stromal cell:B cell precursor interactions, ligation of CD28 on stromal cells may similarly affect the secretion of growth factors necessary for the proliferation and survival of developing B cells. To address this possibility, an in vitro assay was used to compare the abilities of WT and CD28-/- stromal cells to support pro-B cell expansion (20). FACS-sorted WT pro-B cells from fresh bone marrow were cultured with FACS-sorted WT or CD28-/- stromal cells from LTBMC-B for 96 h. During this time, pro-B cells will proliferate, and some will differentiate into IgM+ immature B cells (19). In all six experiments (Fig. 5GoA) the number of B-lineage cells recovered from cultures with CD28-/- stromal cells was greater (average, 132% of WT ± 12.7%) than the number recovered from cultures with WT stromal cells. However, the percentages of IgM+ cells recovered from WT and CD28-/- stromal cells were similar, indicating that the proportion of pro-B cells differentiating into immature IgM+ B cells was not affected by the absence of CD28 (data not shown). Thus, the expansion of pro-B cells was greater on stromal cells lacking CD28 than on stromal cells that expressed CD28.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 5. Expansion of pro-B cells on WT and CD28-/- stromal cells. A, Pro-B cells were cultured for 96 h either directly on stromal cells (sc) FACS-purified from LTMBC of either WT or CD28-/- mice or with stromal-conditioned medium (sc-medium) obtained from the respective stromal cells. Lymphocytes were then harvested from the stromal cells with 0.02% EDTA and counted. The recovery of lymphocytes from cocultures with CD28-/- sc or sc-medium was calculated as the percentage of cells harvested from WT stromal cells and sc-medium in each experiment (n = 6 experiments with sc and n = 3 experiments with sc-medium). The average percentage of WT ± SD is reported in A (**, p < 0.0001; ***, p = 0.001). B, WT and CD28-/- stromal cells were prepared as described above. IL-7-dependent pre-B cells (1 x 104) were added and cultured on the stromal cells for 96 h. Three IL-7-dependent cell lines were used: BC76, BC715, and BC77. Cells were harvested using 0.02% EDTA and counted. The fold change was calculated as the ratio of recovered cell number per input cell number. The data represent the average fold change ± SD of six independent experiments.

 
To determine whether the enhanced expansion of progenitor B cells cultured with CD28-/- stromal cells was due to a stromal cell-secreted factor, pro-B cells were cultured with stromal-conditioned medium from FACS-sorted WT or CD28-/- stromal cells. In all three experiments (Fig. 5GoA) the number of pro-B cells recovered after 4 days was greater when cultured with conditioned medium from CD28-/- stromal cells (average, 185% of WT ± 14.2%) than with conditioned medium from WT stromal cells. Thus, our results suggest that stromal cells lacking CD28 provide a secreted factor(s) that stimulates greater proliferation and/or survival of pro-B cells.

IL-7 secreted by stromal cells is critical for both pro-B cell proliferation and survival (34). To address the possibility that CD28-/- stromal cells produce more IL-7 than WT stromal cells, the relative amount of IL-7 released by WT and CD28-/- stromal cells was assessed using an IL-7/stromal cell bioassay. This bioassay uses IL-7-dependent pre-B cell lines documented to respond exclusively to IL-7 (14). In six of seven independent experiments using FACS-sorted primary stromal cells (Fig. 5GoB), the IL-7-dependent pre-B cell lines proliferated similarly on CD28-/- stromal cells compared with WT stromal cells, indicating that CD28-/- stromal cells and WT stromal cells secrete similar amounts of IL-7. Thus, the results stated above suggest that a lymphopoietic factor other than IL-7 may enhance the expansion of B-lineage cells on CD28-/- stromal cells.

Survival of pro-B cells on WT and CD28-/- stromal cells

To determine whether the enhanced expansion of pro-B cells on CD28-/- stromal cells was due to either enhanced proliferation or enhanced survival of pro-B cells, an in vitro assay was performed. The assay was used to compare the kinetics of pro-B cell expansion, including the total number and the percentage of apoptotic B-lineage cells recovered from WT and CD28-/- stromal cells at different time points. Apoptotic cells were detected by flow cytometry using PI and annexin V-FITC, which binds the plasma membrane of cells during the early stages of apoptosis (26). Cells undergoing apoptosis were defined as annexin V positive and PI negative. As shown in Fig. 6Go, the numbers of cells harvested from WT and CD28-/- stromal cells were similar at 24, 48, and 72 h, yet the number of cells harvested from CD28-/- stromal cells was ~50% greater than the number of cells harvested from WT stromal cells at 96 h. In addition, the percentage of cells undergoing apoptosis was similar between cultures with WT stromal cells and cultures with CD28-/- stromal cells at all harvest times. Thus, the lower number of cells harvested from WT stromal cells at 96 h was not due to an increase in cells undergoing apoptosis in these cultures. These results suggest that the increased production of developing B cells on CD28-/- stromal cells is not due to an increase in pro-B cell survival on CD28-/- stromal cells. In addition, the large increase in the number of B lymphocytes harvested from CD28-/- stromal cells between 72 and 96 h of culture suggests the B-lineage cells proliferated more rapidly during this time period on CD28-/- stromal cells vs the B lymphocytes on WT stromal cells. Thus, in vitro CD28 appears to negatively regulate the ability of stromal cells to support pro-B cell expansion.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 6. Survival of pro-B cells in vitro in the absence of CD28. A, Stromal cells were FACS sorted out of LTBMC-B initiated from WT and CD28-/- mice and incubated for 3–5 days. Pro-B cells were FACS-sorted from fresh WT bone marrow and cultured with stromal cells for 96 h. Lymphocytes were harvested and counted at the indicated time points. B, Cells harvested in A were stained with FITC-labeled annexin V and PI to determine the percentage of pro-B cells undergoing apoptosis (annexin V+, PI-).

 
Composition of B-lineage precursors in the bone marrow of young and aged CD28-/- mice

If CD28 negatively regulates the ability of stromal cells to support pro-B cell expansion in vitro, the absence of CD28 may also lead to increased expansion of pro-B cells in vivo. To determine whether CD28 affects pro-B cell expansion in vivo, we compared the numbers of B-lineage cells in young WT and CD28-/- mice. An earlier report using young mice noted no significant differences between the frequencies of total bone marrow B-lineage cells in CD28-/- and WT mice (17); however, changes in individual subsets of B cell precursors were not addressed in that study. To re-examine whether a lack of CD28 expression affects B lymphopoiesis in vivo, flow cytometric analysis was used to compare relative numbers of B cell precursors in WT and CD28-/- mice. As shown in Fig. 7GoA, the frequency and absolute number of the different stages of B-lineage cells were not significantly different between young WT and young CD28-/- mice. These data suggest that either CD28 does not affect the ability of stromal cells to support pro-B cell expansion in vivo or other factors compensate for the lack of CD28 in vivo and conceal any effect linked to the lack of CD28.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 7. Comparison of the bone marrow B-lineage composition between CD28-/- mice and WT mice. Four- to 8-wk-old and 15- to 19-mo-old WT and CD28-/- mice were examined by three-color flow cytometry as described in Materials and Methods. Both the relative frequencies (left panels) and the absolute numbers (right panels) of B-lineage cells are shown. A, At 4–8 wk of age (CD28-/-, n = 8; WT, n = 8) no statistically significant differences were observed between CD28-/- and WT animals. B, By 15–19 mo of age the frequencies of pro-B cells and pre-B cells in CD28-/- bone marrow (n = 13) were significantly lower than those in age-matched WT animals (n = 17). Conversely, the frequency of mature B cells was significantly higher in the old CD28-/- mice compared with that in age-matched controls. Data points from each mouse are shown, and the average in each group is indicated by a thick black line (*, p = 0.002; **, p <= 0.0003; ***, p = 0.004).

 
A lack of CD28 may not affect B lymphopoiesis under homeostatic conditions; however, an absence of CD28 may affect B lymphopoiesis when the bone marrow microenvironment is stressed, such as in aged mice. By 24 mo of age, the number of pre-B cells declines 50–75% compared with that of pre-B cells in young mice (20). If pro-B cell proliferation is greater on CD28-/- stromal cells in vivo, we predicted that the decrease in B-lineage cells associated with aging may be less dramatic in CD28-/- mice than in age-matched controls. On the contrary, we observed a greater decline in B-lineage cells in the bone marrow of aged CD28-/- mice compared with age-matched WT mice. As shown in Fig. 7GoB, the average frequency of pro-B cells in 15- to 19-mo-old CD28-/- mice was reduced 30% compared with that in age-matched WT mice, while the number of pro-B cells was not significantly different between the two groups. In addition, both the average frequency and the absolute number of pre-B cells in 15- to 19-mo-old CD28-/- mice were reduced by ~50% compared with those in age-matched WT mice. The frequency and absolute number of immature B cells in the bone marrow were not significantly reduced in aged CD28-/- mice; however, the average frequency and absolute number of mature B cells in the bone marrow of aged CD28-/- mice were increased by 40–50% compared with those in aged-matched WT mice (Fig. 7GoB). Thus, an age-related impairment of B lymphopoiesis exists in mice that lack CD28, suggesting a role for CD28 during B cell development when the bone marrow microenvironment is stressed.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Based on previous studies with CD28-/- mice, the goal of this investigation was to determine whether a lack of CD28 expression in the bone marrow affects B cell development. In studies by Shahinian et al. (17) the basal level of Ig was found to be ~20% less in CD28-/- mice compared with control littermates. This decreased level of Ig may be due to a lack of costimulation by T cells to mature B cells. However, Ferguson et al. (18) observed that germinal centers were not formed in CD28-/- mice in response to a T-independent Ag, suggesting that the B cells in CD28-/- mice may have an intrinsic defect in their ability to respond to Ags. An intrinsic defect in the B cells of CD28-/- mice may result from a lack of costimulation of immature B cells in the periphery or, alternatively, a lack of costimulation of developing B cells in the bone marrow. Thus, CD28 and its ligands, CD80 and CD86, which are critical in regulating activation of mature B cells, may also regulate the development of precursor B cells. We found that CD28 is present on bone marrow stromal cells, which contact and provide essential stimuli for precursor B cells, and that CD28 regulates the ability of stromal cells to support expansion of B cell precursors.

In our studies the distribution of CD28 on bone marrow stromal cells varied depending on whether B-lineage cells were contacting stromal cells. In the absence of B-lineage cells, CD28 was localized in patches across the surface of the stromal cell; however, in the presence of B-lineage cells, CD28 localized to the B cell precursor:stromal cell interface. CD80, one ligand for CD28, was detectable on freshly isolated pre-B cells, and surface expression of CD86, a second ligand for CD28, was induced on a subset of B cell precursors following exposure to IL-7. Additional experiments were performed to determine whether CD28 affected the ability of stromal cells to support developing B cells. The production of B cells was found to be greater on stromal cells lacking CD28 than on CD28-expressing stromal cells. This effect was at least partly due to a difference in soluble factors produced by the stromal cells, because the increased expansion of B cell precursors also occurred in stromal-conditioned medium from CD28-/- stromal cells. The results obtained from the experiments with stromal-conditioned medium could argue against a specific interaction between stromal cells and B cell precursors involving CD28. However, the stromal cells used in these experiments were isolated from LTBMC-B in which the stromal cells contact B cell precursors. The differences between medium from WT and CD28-/- stromal cells could have thus resulted from a previous lack of CD28 engagement on the stromal cells by CD80/CD86 on B cell precursors in the LTBMC. Taken together, our results suggest that CD28 expression on bone marrow stromal cells contributes to stromal-dependent regulation of B-lineage cells.

The studies presented here provide evidence for a parallel between B cell-T cell interactions in the peripheral lymphoid tissues and B cell precursor-stromal cell associations in the bone marrow. Upon interaction with a B cell, the cytoskeleton of the T cell rearranges to localize the TCR, costimulatory molecules, and adhesion and signaling molecules to the T cell:B cell interface (35). This reorganization provides a mechanism for optimal signal transduction and subsequent activation of the T cell, leading to directional release of cytokines toward the interacting B cell. CD28 provides an essential costimulatory signal during this process and localizes to the T cell:B cell interface, particularly in the central region where the TCR also localizes (10). The results from the present study suggest that CD28 may localize in a similar manner on stromal cells by aggregating at the stromal cell:B cell precursor interface. If CD28 participates in regulating the production of developing B cells by interacting with CD80/CD86 on the precursor B cells, one may predict that CD80 and/or CD86 to also localize to the stromal cell:B cell precursor interface. This possibility will be addressed in future experiments using B cell precursors from CD80/CD86-/- mice. It would also be interesting to examine the localization of the pre- B cell Ag receptor (pre-BCR) on pre-B cells and determine whether this molecule aggregates at the stromal cell:B cell precursor interface. To date, a ligand for the pre-BCR has not been identified, but it has been recently reported that soluble pre-BCR molecules bind to stromal cells (36). Aggregation of the pre-BCR at the stromal cell:B cell precursor interface would support the possibility that a ligand for the pre-BCR may be present on stromal cells in addition to supporting a functional role for localization of CD28 at the stromal cell:B cell precursor interface.

Aggregation of specific cell surface molecules at the stromal cell:B cell precursor interface may allow stromal cells to distinguish B-lineage precursors from other lineages in the bone marrow to release B-lineage-specific cytokines. This concept was introduced by Jacobsen et al. (15), who reported that {beta}1 integrin (identified by KMI6 mAb) localized to the stromal cell-lymphoid cell contact site in native bone marrow. The authors suggested that the expression of specific molecules, such as {beta}1 integrin, at the stromal cell/lymphoid cell interface may lead to directional secretion of lymphoid-specific cytokines. Support for this concept comes from other studies that showed that IL-7 is released from stromal cells upon contact with pro-B cells and stromal cells (14, 34). It is possible that aggregation of CD28 and its ligands at the stromal cell:B cell precursor contact area may lead to signaling that regulates secretion of B-lineage-specific growth factors from the stromal cells. Indeed, our observation that stromal-conditioned medium from CD28-/- stromal cells led to greater production of B cells supports this hypothesis. This observation suggests that CD28-/- stromal cells produce either a greater amount of soluble factors that stimulate the expansion of B cell precursors or a smaller amount of soluble factors that inhibit the expansion of B cell precursors.

To date, it is not known which growth factors produced by stromal cells may be regulated by CD28. Although IL-7 production appears to be similar from WT and CD28-/- stromal cells, the production factors that synergize with IL-7, such as stem cell factor, IGF-I, and Flt-3 ligand (37, 38, 39, 40), may be greater in the absence of CD28. Alternatively, the production of inhibitory factors such as IFN-{alpha}, TGF-{beta}, or IFN-{gamma} (41, 42, 43), may be decreased from stromal cells lacking CD28. It is also possible that CD28 may indirectly regulate the expression of growth factor receptors on developing B cells by interacting with CD80/CD86 or an alternative ligand on the B cells. For example, engagement of CD80/CD86 on B cell precursors by CD28 on stromal cells may lead to down-regulation of the IL-7R on B cell precursors and decreased proliferation of the developing B cells. Thus, CD28 may regulate the production of B cells in the bone marrow by directly regulating the production of growth factors by stromal cells or indirectly regulating the expression of growth factor receptors on the B cell precursors.

Although our studies did not directly address the role of CD80/CD86 in the production of developing B cells, previous studies by Parijis et al. (7) and Fournier et al. (8) provide evidence for roles for CD80 and CD86 in B cell development and selection of B cell precursors. Both groups reported that overexpression of CD80 or CD86 led to a decrease in the number of B220+ IgM- (pre- and pro-B cells) and B220+IgM+ immature B cells in the bone marrow. In fact, the few immature B cells present in these mice did not express CD80 or CD86. The authors speculated that CD80 and CD86 might be up-regulated on immature B cells upon recognition of self Ag, targeting these cells for elimination. If true, this hypothesis may explain the low levels of CD80/CD86 detected on pro- and pre-B cells in our studies. During development, CD80/CD86 may be up-regulated on pro-and pre-B cells following exposure to IL-7 for a short period of time and then down-regulated in functional cells. In contrast, continued expression of CD80 and CD86 may occur in developing B cells with intrinsic defects and thus target these cells for deletion.

The results from our in vitro experiments suggest that CD28 on stromal cells negatively regulates the production of developing B cells. Based on these results, we predicted that CD28-/- mice might have an increased number of B-lineage cells in the bone marrow compared with WT mice. On the contrary, the number of B-lineage cells was similar in the bone marrow of young CD28-/- mice and that of WT control mice. One of the many possible explanations for the differences between the in vitro and in vivo data is a compensatory mechanism acting in vivo that is absent in vitro. For example, the number of B-lineage cells produced in the bone marrow of the young CD28-/- mice may be higher than that in WT mice, yet this increase in B cell production may be counteracted by an increase in the number of B-lineage cells undergoing cell death in CD28-/- mice. We addressed the possibility of increased B cell production in CD28-/- mice using in vivo bromodeoxyuridine labeling and did not observe a significant difference between the number of pro- and pre-B cells produced per day in WT and CD28-/- mice (data not shown). Unfortunately, we were unable to accurately compare apoptosis in the bone marrow of WT and CD28-/- mice due to the presence of macrophages in the bone marrow that quickly phagocytose dying and dead cells (44). The data from the bromodeoxyuridine experiments, however, suggest that in vivo the production rate of B cell precursors was not affected by the absence of CD28.

If B lymphopoiesis is not altered in CD28-/- mice under homeostatic conditions, it is possible that a lack of CD28 may affect B lymphopoiesis under conditions in which B lymphopoiesis is stressed. One example of a stressful condition is the bone marrow of a normal aged animal in which the number of B cell precursors is altered compared with that in young animals (20, 45). Thus, we decided to compare the numbers of B cell precursors in the bone marrow of aged CD28-/- mice and age-matched WT mice. At 15–19 mo of age CD28-/- mice exhibited a significant decrease in the number of pro- and pre-B cells in the bone marrow compared with age-matched WT mice. Therefore, the decline in pre-B cells previously reported to occur in the bone marrow of aged WT animals is augmented in animals lacking CD28. One explanation for the decline in pro- and pre-B cells is a defect in the ability of bone marrow stromal cells in aged CD28-/- mice to support expansion of B-lineage cells. Previous studies reported that the ability of stromal cells to support in vitro proliferation of pro-B cells declines with age in WT animals (14). It is possible that signaling through CD28 provides stimulation to maintain the functional capability of stromal cells, and the absence of this signal over time leads to a greater decline in the ability of stromal cells to support B lymphopoiesis. Yet, as seen in both the aged WT and CD28-/- mice, B cells continue to be produced despite possible defects in the stromal cells.

Another explanation for the decline in pro- and pre-B cells in aged CD28-/- mice may be the increase in mature B cells recirculating back and residing in the bone marrow of these mice. To maintain a homeostatic number of B-lineage cells in the bone marrow, an increase in mature B cells may be compensated by a decrease in B cell precursors. Likewise, mature B cells may compete for growth factors and ligands, such as a possible ligand for the pre-BCR, which are needed by precursor B cells to survive and proliferate. The increased number of mature B cells in the bone marrow may be a downstream effect of increased numbers of mature B cells in the spleen (data not shown), as observed in the aged CD28-/- mice. In that case, mature B cells recirculating back to the bone marrow may create a feedback loop in which the number of B cells in the spleen indirectly controls the number of B cell precursors being produced in the bone marrow.

The results from the present study provide evidence that parallels exist between mature B cell:T cell interactions and precursor B cell: stromal cell interactions. We found that CD28, which has been previously characterized on T cells, is also expressed on bone marrow stromal cells and affects the ability of the stromal cells to support B lymphopoiesis. Future studies will be performed to determine whether CD80/CD86, the ligands for CD28, also regulate B lymphopoiesis. The parallels between T cell:B cell interactions and stromal cell:B cell precursor interactions may not be limited to CD28 and CD80/CD86, but may also include other costimulatory molecules. For example, the costimulatory molecules CD40 and CD40 ligand have been suggested to regulate B lymphopoiesis in previous studies (46, 47); however, whether CD40 ligand is expressed on bone marrow stromal cells and/or affects the function of bone marrow stromal cells is still unknown. The results from our studies may lead to future experiments addressing whether the ability of B cell precursors to respond to costimulation in the bone marrow relates to the ability of mature B cells to respond to costimulation in the periphery.


    Acknowledgments
 
We are grateful to Dr. Paul Kincade for the kind gift of the IL-7-dependent cell lines. We thank Heather Minges Wols, Kara Johnson, and John Dye for helpful suggestions and editing of the manuscript. Jeanette Pifer, Cynthia Bugasky, and Zheng Yu provided excellent technical assistance in some studies. We also thank Patricia Simms, Dr. Tom Ellis, and the Loyola FACS Core Facility for assistance with the flow cytometric analysis and cell sorting.


    Footnotes
 
1 This work was supported by National Institutes of Health Grants RO1AG13874 and K07AG00997. Back

2 Current address: Papanicolaou Building, Room 211 (M710), University of Miami Medical School, 1550 NW 10th Avenue, Miami, FL 33136. Back

3 Address correspondence and reprint requests to Dr. Pamela L. Witte, Department of Cell Biology, Neurobiology, and Anatomy, Loyola University Medical Center, 2160 South First Avenue, Maywood, IL 60153. E-mail address: pwitte{at}lumc.edu Back

4 Abbreviations used in this paper: WT, wild type; BCR, B cell Ag receptor; LTBMC-B, long term bone marrow culture for B lineage; PI, propidium iodide. Back

Received for publication October 18, 2001. Accepted for publication June 25, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. LeBien, T. W.. 1998. B-cell lymphopoiesis in mouse and man. Curr. Opin. Immunol. 10:188.[Medline]
  2. MacLennan, I. C.. 1994. Germinal centers. Annu. Rev. Immunol. 12:117.[Medline]
  3. Miyake, K., K. Medina, K. Ishihara, M. Kimoto, R. Auerbach, P. W. Kincade. 1991. A VCAM-like adhesion molecule on murine bone marrow stromal cells mediates binding of lymphocyte precursors in culture. J. Cell Biol. 114:557.[Abstract/Free Full Text]
  4. Funk, P. E., P. W. Kincade, P. L. Witte. 1994. Native associations of early hematopoietic stem cells and stromal cells isolated in bone marrow cell aggregates. Blood 83:361.[Abstract/Free Full Text]
  5. Miyake, K., K. L. Medina, S. Hayashi, S. Ono, T. Hamaoka, P. W. Kincade. 1990. Monoclonal antibodies to Pgp-1/CD44 block lympho-hemopoiesis in long-term bone marrow cultures. J. Exp. Med. 171:477.[Abstract/Free Full Text]
  6. Miyake, K., I. L. Weissman, J. S. Greenberger, P. W. Kincade. 1991. Evidence for a role of the integrin VLA-4 in lympho-hemopoiesis. J. Exp. Med. 173:599.[Abstract/Free Full Text]
  7. Fournier, S., J. C. Rathmell, C. C. Goodnow, J. P. Allison. 1997. T cell-mediated elimination of B7.2 transgenic B cells. Immunity 6:327.[Medline]
  8. Van Parijs, L., M. P. Sethna, A. N. Schweitzer, F. Borriello, A. H. Sharpe, A. K. Abbas. 1997. Functional consequences of dysregulated B7-1 (CD80) and B7-2 (CD86) expression in B or T lymphocytes of transgenic mice. J. Immunol. 159:5336.[Abstract]
  9. Slavik, J. M., J. E. Hutchcroft, B. E. Bierer. 1999. CD28/CTLA-4 and CD80/CD86 families: signaling and function. Immunol. Res. 19:1.[Medline]
  10. Egen, J. G., J. P. Allison. 2002. Cytotoxic T lymphocyte antigen-4 accumulation in the immunological synapse is regulated by TCR signal strength. Immunity 16:23.[Medline]
  11. Gross, J. A., E. Callas, J. P. Allison. 1992. Identification and distribution of the costimulatory receptor CD28 in the mouse. J. Immunol. 149:380.[Abstract]
  12. Sedwick, C. E., M. M. Morgan, L. Jusino, J. L. Cannon, J. Miller, J. K. Burkhardt. 1999. TCR, LFA-1, and CD28 play unique and complementary roles in signaling T cell cytoskeletal reorganization. J. Immunol. 162:1367.[Abstract/Free Full Text]
  13. Kupfer, A., T. R. Mosmann, H. Kupfer. 1991. Polarized expression of cytokines in cell conjugates of helper T cells and splenic B cells. Proc. Natl. Acad. Sci. USA 88:775.[Abstract/Free Full Text]
  14. Stephan, R. P., C. R. Reilly, P. L. Witte. 1998. Impaired ability of bone marrow stromal cells to support B-lymphopoiesis with age. Blood 91:75.[Abstract/Free Full Text]
  15. Jacobsen, K., K. Miyake, P. W. Kincade, D. G. Osmond. 1992. Highly restricted expression of a stromal cell determinant in mouse bone marrow in vivo. J. Exp. Med. 176:927.[Abstract/Free Full Text]
  16. Hirokawa, M., J. Kuroki, A. Kitabayashi, A. B. Miura. 1996. Transmembrane signaling through CD80 (B7-1) induces growth arrest and cell spreading of human B lymphocytes accompanied by protein tyrosine phosphorylation. Immunol. Lett. 50:95.[Medline]
  17. Shahinian, A., K. Pfeffer, K. P. Lee, T. M. Kundig, K. Kishihara, A. Wakeham, K. Kawai, P. S. Ohashi, C. B. Thompson, T. W. Mak. 1993. Differential T cell costimulatory requirements in CD28-deficient mice. Science 261:609.[Abstract/Free Full Text]
  18. Ferguson, S. E., S. Han, G. Kelsoe, C. B. Thompson. 1996. CD28 is required for germinal center formation. J. Immunol. 156:4576.[Abstract]
  19. Hardy, R. R., C. E. Carmack, S. A. Shinton, J. D. Kemp, K. Hayakawa. 1991. Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow. J. Exp. Med. 173:1213.[Abstract/Free Full Text]
  20. Stephan, R. P., V. M. Sanders, P. L. Witte. 1996. Stage-specific alterations in murine B lymphopoiesis with age. Int. Immunol. 8:509.[Abstract/Free Full Text]
  21. Whitlock, C. A., O. N. Witte. 1982. Long-term culture of B lymphocytes and their precursors from murine bone marrow. Proc. Natl. Acad. Sci. USA 79:3608.[Abstract/Free Full Text]
  22. Deryugina, E. I., C. E. Muller-Sieburg. 1993. Stromal cells in long-term cultures: keys to the elucidation of hematopoietic development?. Crit. Rev. Immunol. 13:115.[Medline]
  23. Dong, Z., H. H. Wortis. 1992. Function of bone marrow stromal cell lines derived from nude mice. J. Immunol. 149:3456.[Abstract]
  24. Witte, P. L., L. M. Frantsve, M. Hergott, S. M. Rahbe. 1993. Cytokine production and heterogeneity of primary stromal cells that support B lymphopoiesis. Eur. J. Immunol. 23:1809.[Medline]
  25. Funk, P. E., P. L. Witte. 1992. Enrichment of primary lymphocyte-supporting stromal cells and characterization of associated B lymphocyte progenitors. Eur. J. Immunol. 22:1305.[Medline]
  26. Vermes, I., C. Haanen, H. Steffens-Nakken, C. Reutelingsperger. 1995. A novel assay for apoptosis: flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled annexin V. J. Immunol. Methods 184:39.[Medline]
  27. Funk, P. E., R. P. Stephan, P. L. Witte. 1995. Vascular cell adhesion molecule 1-positive reticular cells express interleukin-7 and stem cell factor in the bone marrow. Blood 86:2661.[Abstract/Free Full Text]
  28. Westen, H., D. F. Bainton. 1979. Association of alkaline-phosphatase-positive reticulum cells in bone marrow with granulocytic precursors. J. Exp. Med. 150:919.[Abstract/Free Full Text]
  29. Kugiyama, K., H. Yasue, K. Minoda, K. Okumura, Y. Inobe, S. Tomiguchi, A. Kojima, M. Takahashi, M. Inobe. 1994. Identification of an alternatively spliced form of the murine homologue of B7. Am. J. Cardiol. 73:661.[Medline]
  30. Valle, A., J. P. Aubry, I. Durand, J. Banchereau. 1991. IL-4 and IL-2 upregulate the expression of antigen B7, the B cell counterstructure to T cell CD28: an amplification mechanism for T-B cell interactions. Int. Immunol. 3:229.[Abstract/Free Full Text]
  31. Stack, R. M., D. J. Lenschow, G. S. Gray, J. A. Bluestone, F. W. Fitch. 1994. IL-4 treatment of small splenic B cells induces costimulatory molecules B7-1 and B7-2. J. Immunol. 152:5723.[Abstract]
  32. Costello, R. T., F. Mallet, H. Chambost, D. Sainty, J. A. Gastaut, D. Olive. 1999. Differential modulation of immune recognition molecules by interleukin-7 in human acute leukaemias. Eur. Cytokine Network 10:87.[Medline]
  33. Dennig, D., R. J. O’Reilly. 1994. IL-7 induces surface expression of B7/BB1 on pre-B cells and an associated increase in their costimulatory effects on T cell proliferation. Cell. Immunol. 153:227.[Medline]
  34. Sudo, T., M. Ito, Y. Ogawa, M. Iizuka, H. Kodama, T. Kunisada, S. Hayashi, M. Ogawa, K. Sakai, S. Nishikawa. 1989. Interleukin 7 production and function in stromal cell-dependent B cell development. J. Exp. Med. 170:333.[Abstract/Free Full Text]
  35. Bromley, S. K., W. R. Burack, K. G. Johnson, K. Somersalo, T. N. Sims, C. Sumen, M. M. Davis, A. S. Shaw, P. M. Allen, M. L. Dustin. 2001. The immunological synapse. Annu. Rev. Immunol. 19:375.[Medline]
  36. Bradl, H., H. M. Jack. 2001. Surrogate light chain-mediated interaction of a soluble pre-B cell receptor with adherent cell lines. J. Immunol. 167:6403.[Abstract/Free Full Text]
  37. Landreth, K. S., R. Narayanan, K. Dorshkind. 1992. Insulin-like growth factor-I regulates pro-B cell differentiation. Blood 80:1207.[Abstract/Free Full Text]
  38. Hirayama, F., S. D. Lyman, S. C. Clark, M. Ogawa. 1995. The flt3 ligand supports proliferation of lymphohematopoietic progenitors and early B-lymphoid progenitors. Blood 85:1762.[Abstract/Free Full Text]
  39. Hunte, B. E., S. Hudak, D. Campbell, Y. Xu, D. Rennick. 1996. flk2/flt3 ligand is a potent cofactor for the growth of primitive B cell progenitors. J. Immunol. 156:489.[Abstract]
  40. Funk, P. E., A. Varas, P. L. Witte. 1993. Activity of stem cell factor and IL-7 in combination on normal bone marrow B lineage cells. J. Immunol. 150:748.[Abstract]
  41. Gimble, J. M., K. Medina, J. Hudson, M. Robinson, P. W. Kincade. 1993. Modulation of lymphohematopoiesis in long-term cultures by {gamma} interferon: direct and indirect action on lymphoid and stromal cells. [Published erratum appears in 1993 Exp. Hematol. 21:594]. Exp. Hematol. 21:224.[Medline]
  42. Lee, G., A. E. Namen, S. Gillis, L. R. Ellingsworth, P. W. Kincade. 1989. Normal B cell precursors responsive to recombinant murine IL-7 and inhibition of IL-7 activity by transforming growth factor-{beta}. J. Immunol. 142:3875.[Abstract]
  43. Lin, Q., C. Dong, M. D. Cooper. 1998. Impairment of T and B cell development by treatment with a type I interferon. J. Exp. Med. 187:79.[Abstract/Free Full Text]
  44. Jacobsen, K., and D. G. Osmond. 1991. Cell death in B cell genesis and the role of bone marrow macrophages. In Lymphatic Tissues and In Vivo Immune Responses. S. B.-A. S. Ezine and B.A. Imhof, eds. Marcel Dekker, New York, p. 343.
  45. Riley, R. L., M. G. Kruger, J. Elia. 1991. B cell precursors are decreased in senescent BALB/c mice, but retain normal mitotic activity in vivo and in vitro. Clin. Immunol. Immunopathol. 59:301.[Medline]
  46. Castigli, E., F. Young, A. M. Carossino, F. W. Alt, R. S. Geha. 1996. CD40 expression and function in murine B cell ontogeny. Int. Immunol. 8:405.[Abstract/Free Full Text]
  47. Larson, A. W., T. W. LeBien. 1994. Cross-linking CD40 on human B cell precursors inhibits or enhances growth depending on the stage of development and the IL costimulus. J. Immunol. 153:584.[Abstract]



This article has been cited by other articles: