|
|
||||||||




* Program for Immunology and Aging, Department of Cell Biology, Neurobiology, and Anatomy, and
Department of Microbiology and Immunology, Loyola University Medical Center, Maywood, IL 60153;
Division of Developmental and Clinical Immunology and Department of Medicine, University of Alabama, Birmingham, AL 35294;
Immune Cell Biology Program, Naval Medical Research Institute, Bethesda, MD 20889; and
¶ National Center for Cell Science, Ganeshkhind, Pune University Campus, Maharashtra, India
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
CD28 has been previously characterized as a potent costimulatory
molecule primarily found on T cells, where it interacts with CD80 and
CD86 on activated B cells and APC (9). Similar to other
molecules important for the activation of T cells, such as the TCR and
protein kinase C
, CD28 localizes to a central region at the T cell:B
cell interface (10). Ligation of CD28 in combination with
TCR activation leads to increased production of IL-2 and changes in the
T cell cytoskeleton, including reorientation of the
microtubule-organizing center to the T cell:B cell interface (11, 12). This reorientation of the microtubule-organizing center
helps to direct cytokine secretion toward the interacting B cell by
polarizing the Golgi complex and associated secretory organelles toward
the T cell:B cell interface (13). Similar directed
secretion of cytokines from stromal cells to pro-B cells has been
proposed based on functional studies (14) and the
observation that at least one molecule,
1
integrin, localizes to the stromal cell:B-lineage cell interface
(15).
The direct effect of CD28:CD80/CD86 interactions on B cells remains largely unclear, although previous studies have reported that CD80 is phosphorylated following B cell activation (16). CD28-/- mice exhibit decreased levels of basal IgG (17), perhaps due to a lack of T cell help or because of an intrinsic defect in the B cells. In addition, studies by Ferguson et al. (18) demonstrated that the ability of B cells to undergo somatic hypermutation and form germinal centers in response to a T-independent Ag is compromised in mice lacking CD28. These studies suggest that mature B cells from CD28-/- mice may have intrinsic deficiencies in their response to Ag. Whether an intrinsic defect in the mature B cells could result from a lack of CD28 costimulation to B cell precursors in the bone marrow has not been addressed. It is possible that CD28 contributes to both the development of B cells in the bone marrow as well as the function of B cells in the periphery. Thus, we proposed that CD80 and CD86 are expressed on B cell precursors and that CD28 on stromal cells participates in the ability of stromal cells to support B lymphopoiesis. In our studies we found that CD80 is expressed by a small percentage of B cell precursors, and both CD80 and CD86 could be induced on a subset of B cell precursors following treatment with IL-7. We also observed that stromal cell-dependent expansion of B cell precursors was enhanced on CD28-/- stromal cells or in medium obtained from CD28-/- stromal cells in vitro. In addition, we compared young and old wild-type (WT)4 and CD28-/- mice and discovered an age-related alteration in B-lineage cells in the bone marrow of aged CD28-/- mice. Together, our data provide evidence of a role for CD28 in the development of B cell precursors in the bone marrow.
| Materials and Methods |
|---|
|
|
|---|
One- to 24-mo-old BALB/c female mice were purchased from the National Institute on Aging (Bethesda, MD). C57BL/6CD28-/- mice were obtained from The Jackson Laboratory (Bar Harbor, ME) and were originally derived in the laboratory of Dr. T. Mak (17). Fifteen- to 19-mo-old C57BL/6CD28-/- were purchased from The Jackson Laboratory at 6 mo of age as retired breeders or at 8 wk of age and then housed in the Comparative Medicine Facility at Loyola University Medical Center until the time of the experiment. Where noted in Results, separate analyses were performed using 3- or 14- to 15-mo-old BALB/cCD28-/- mice obtained from the Naval Medical Research Institute (Bethesda, MD) and age-matched BALB/c controls (obtained from National Institute on Aging).
Antibodies
The following conjugated rat mAbs were purchased from BD
PharMingen (San Diego, CA): PE-anti-mouse CD45R/B220 (RA3-6B2),
biotin-anti-mouse CD43 (S7), and FITC-anti-mouse Ly-6G (Gr-1).
FITC-conjugated AffiniPure F(ab')2 donkey
anti-mouse IgM, µ-chain specific, biotin-SP-conjugated AffiniPure
F(ab')2 goat anti-Syrian hamster IgG, and
FITC-conjugated AffiniPure Fab rabbit anti-goat IgG were purchased
from Jackson ImmunoResearch Laboratories (West Grove, PA). Hamster
anti-mouse CD80 (clone 1610-A1) and rat anti-mouse CD86
(clone GL1) Abs were either purified by protein A affinity
chromatography and conjugated to FITC or purchased from BD PharMingen.
Hamster anti-mouse CD28 Ab (clone 37.51) was purchased from BD
PharMingen, and goat anti-mouse CD28 Ab (clone M-20) was purchased
from Santa Cruz Biotechnology (Santa Cruz, CA). Biotin-conjugated rat
anti-mouse IgD (SBA-1) was purchased from Southern Biotechnology
Associates (Birmingham, AL). Mouse anti-
smooth muscle actin-Cy3
(clone 1A4) was purchased from Sigma-Aldrich (St. Louis, MO).
Streptavidin-allophycocyanin and streptavidin-FITC (BD PharMingen) were
used to reveal the biotin-conjugated Abs.
FACS analysis of bone marrow cells
The strategy for discriminating bone marrow B-lineage subpopulations was modified from that described by Hardy et al. (19) and has been used by our laboratory in previous experiments (20). One million freshly isolated bone marrow cells were sequentially stained with one of the following combinations of Abs: 1) anti-B220, anti-CD43, and anti-IgM; 2) anti-B220, anti-IgM, and anti-IgD; or 3) anti-B220, anti-CD43, and anti-CD80 or anti-CD86 for 30 min at 4°C in the dark. Between all stainings the cells were washed three times with HBSS containing 5% heat-inactivated FBS. The developmental stages were defined as: pro-B, B220lowCD43+IgM-; pre-B, B220lowCD43-IgM-; newly formed B cells, B220lowIgM+IgD-; and mature B cells in the marrow, B220highIgM+IgD+. All analyses were performed on a dual laser FACStarPlus (BD Biosciences, San Jose, CA) gated on all viable cells. Calibration of the FACStarPlus was manually performed daily using Rainbow Calibration Particles (Spherotech, Libertyville, IL).
Induction of CD80/CD86 on freshly isolated pro-B and pre-B cells
Pro-B cells (B220lowCD43+IgM-) and pre-B cells (B220lowCD43-IgM-) were FACS-sorted from freshly harvested bone marrow of BALB/c mice (4 wk of age). The staining procedure followed that described above. Ten thousand FACS-sorted pro-B or pre-B cells were cultured in the presence of the indicated factor in a 100-µl total volume at 37°C in 7.5% CO2 for 14 days. Recombinant murine IL-7 (Genzyme, Cambridge, MA) was used at 5.0 ng/ml; bacterial LPS (Sigma-Aldrich) was used at 25 µg/ml. The pre-B cells were examined 1 day after culture initiation, since pre-B cells undergo rapid spontaneous apoptosis (14) (R. P. Stephan, unpublished observations). After 14 days the lymphoid cells were harvested by washing each well with 0.02% EDTA. The cells were then stained with anti-B220 and anti-CD80 or anti-CD86. Propidium iodide (PI) was included in the samples at the time of analysis to ensure that only viable cells were analyzed.
Preparation of Whitlock-type long term bone marrow cultures for B lymphocytes (LTBMC-B)
LTBMC-B (21) were initiated from the pooled femoral and tibial bone marrow of BALB/c or C57BL/6 female mice, 13 mo of age, and were grown in RPMI 1640 supplemented with 5% FBS (selected lot 14 M73 (Summit, Fort Collins, CO) or selected lot AJM11262 (HyClone Laboratories, Logan, UT)), L-glutamine, penicillin, streptomycin, and 5 x 10-5 M 2-ME. By 4 wk, a complex adherent layer, consisting of stromal cells and macrophages, had formed and was supporting ongoing B lymphopoiesis.
Cell lines
The following stromal cells lines were maintained as previously described: BMS2, OP42, S17, CBA20, NX4, and NU14 (22, 23). CR3 and CR4 are stromal cells lines previously derived in our laboratory from LTBMC-B by R. Stephan and D. Lill-Elghanian. The dendritic cell line, GBE-16, was previously derived from the spleen of a 22-mo-old BALB/c mouse by Dr. H.-M. Jack and G. Beck-Engeser and maintained in medium used for LTBMC-B (described above).
Discrimination of CD28 on primary cultured stromal cells by flow cytometry
Using the FACS as previously described (24), reticular-type stromal cells from LTBMC-B were gated based on differential forward vs side scatter and the uptake of 1,1'-dioctadecyl-12,3,3',3-tetramethyl-indocarocyanine perchlorate-labeled acetylated low density lipoprotein (Biomedical Technologies (Stoughton, MA) or Molecular Probes (Eugene, OR)). Briefly, LTBMC-B were incubated for 3 h with 5 µg acetylated low density lipoprotein at 37°C in 7.5% CO2. Lymphoid cells were removed by addition of 0.02% EDTA. The adherent cells (stromal cells and macrophages) and any remaining lymphocytes were then harvested by treatment with 0.25% trypsin or by gently scraping with a silicon rubber policeman. Aliquots of the adherent cells from LTBMC-B were incubated on ice with biotinylated-anti-CD28, followed by streptavidin-allophycocyanin. Data were obtained using a live stromal cell gate in which adherent cells were distinguished from lymphocytes by high forward and side scatter, and stromal cells were distinguished from macrophages by lack of acetylated LDL uptake. All analyses were performed 47 wk after culture initiation.
Separation of bone marrow into aggregated and deaggregated populations
Isolation of the aggregated (stromal cell-enriched) and deaggregated (stromal-depleted) populations was performed as described previously (25). Briefly, dispersed femoral bone marrow cells were suspended at 3 femur equivalents/ml and vigorously pipetted to disrupt nonspecific clumping of the cells. One milliliter of this suspension was carefully layered over 3 ml cold FBS in a 5-ml tube. Cellular aggregates were allowed to settle by placing the tube on ice in a vertical position. After 15 min, the aggregated cells were collected as the lower-most 1 ml, and the top 1 ml was collected as the deaggregated population.
RT-PCR
Expression of CD28, CD80, CD86, and
-actin RNA was analyzed
by RT-PCR. Total RNA was isolated from bone marrow, the aggregated and
deaggregated bone marrow cell fractions, FACS-purified stromal cells
from LTBMC-B (as described above), and FACS-sorted pro- and pre-B cells
using guanidine isothiocyanate for lysis and separation on cesium
chloride gradients. cDNA was prepared by addition of 4 µg total RNA
into a 20-µl reaction mixture containing 200 U Moloney murine
leukemia virus reverse transcriptase, 94 pmol random hexamers, 975 U/ml
ribosomal RNasin, 10 mM DTT (Promega, Madison, WI), and 1 mM
each of dATP, dCTP, dGTP, and dTTP (PerkinElmer, Foster City, CA).
Samples were kept at room temperature for 10 min, followed by a 2-h
incubation at 37°C. Transcription was stopped by heating at 95°C
for 10 min. Samples were stored at -20°C until used in PCR
reactions.
PCR amplifications were performed using the cDNA at an 1.0 µg RNA
equivalent. The final volume of each PCR reaction was 100 µl and
consisted of 1x PCR buffer containing 1.5 mM
MgCl2; 200 µM each of dATP, dCTP, dGTP, and
dTTP; 2.5 U AmpliTaq DNA polymerase (PerkinElmer); and 1 µM each of
5' and 3' primers. Primer oligonucleotides were: CD28 5' primer,
TACTTCTGCAAAATTGAGTTCATG; CD28 3' primer, GGGGAGTCATGTTCATGTAG;
-actin 5' primer, ATGGATGACGATATCGCT;
-actin 3' primer,
ATGAGGTAGTCTGTCAGGT; CD80 3' primer, CAGGAGGATTGCTGCAAGCT; CD80 5'
primer, CTGCAAACACGGTTCTCTAGGTG; CD86 3' primer,
TGTAGACGTGTTCCAGAACTTACGG; and CD86 5' primer,
CTTCTTAGGTTTCGGGTGACCTTG. cDNAs were amplified for 35 cycles,
consisting of 1 min at 94°C, 1 min at 54°C, and 2 min at 72°C,
followed by a 4°C soak. PCR products were resolved by electrophoresis
of 10 µl of each CD28 PCR reaction mixture precipitated from ethanol
and were redissolved in 20 µl TE buffer or 10 µl of each CD80,
CD86, or
-actin PCR reaction mixture on a 5% polyacrylamide gel and
were visualized by UV illumination after staining with ethidium
bromide. PCR products were compared against a 100-bp DNA m.w. marker
(Life Technologies, Grand Island, NY). Splenocytes treated with Con A
(4 µg/ml; Sigma-Aldrich) for 48 h served as a positive
control.
Confocal immunofluorescence microscopy
Total adherent cells, consisting of stromal cells and
macrophages, were removed from LTBMC-B using 0.25% trypsin and plated
at 5 x 104 cells/well in Permanox chamber
slides (Nunc, Naperville, IL). The adherent cells were cultured for 3
days before addition of B-lineage lymphocytes. Precursor B lymphocytes
were obtained from LTBMC-B by detaching the lymphocytes from the
adherent layer with 0.02% EDTA. The recovered lymphocytes were then
added directly to the adherent cells for 48 h. The cells were
fixed in acetone and blocked with goat IgG or rabbit IgG, respectively.
Then the cells were incubated with one of the following primary Abs:
hamster anti-mouse CD28, hamster IgG, goat anti-mouse CD28, or
goat IgG. Biotin-conjugated goat anti-hamster IgG and
strepavidin-FITC, or FITC-conjugated rabbit anti-goat IgG were used
to detect the primary Abs. In addition, mouse anti-
actin-Cy3
was used to define stromal cells where indicated. The slides were
mounted in Fluorosave reagent (Calbiochem, San Diego, CA) and stored at
4°C until analysis. Fluorescence confocal microscopy was performed on
a Zeiss LSM 510 microscope (New York, NY) with a x63 oil objective. An
HeNe laser at 543 nm was used to detect allophycocyanin fluorochrome,
and an argon laser at 458488 nm was used to detect FITC
fluorochrome.
Stromal-dependent survival and proliferation of pro-B cells
LTBMC-B were initiated with bone marrow from C57BL/6 (WT) and C57BL/6 CD28-/- (CD28-/-) mice. Stromal cells were FACS-sorted from LTBMC-B (as described above) into 96-well flat-bottom plates at 1 x 104 cells/well and incubated for 46 days. Pro-B cells were then FACS-sorted from fresh WT bone marrow and added to the stromal cells for 24, 48, 72, or 96 h. To harvest the B-lineage lymphocytes, medium was removed from the wells, and 0.02% EDTA was added to detach the B lymphocytes from the adherent stromal cells. The B lymphocytes from each well of an experimental group were pooled and counted to determine the average number of B lymphocytes per well. For experiments using stromal-conditioned medium, 50 µl medium was removed from the FACS-sorted WT or CD28-/- stromal cells after 46 days of culture. The conditioned medium was immediately added to FACS-sorted pro-B cells at a 1/1 dilution. The lymphocytes were then harvested after 96 h and counted.
Annexin V staining of B cell precursors
Purified pro-B cells and stromal cells were cocultured as indicated in Results. After being harvested from stromal cells, B-lineage lymphocytes were stained with annexin V-FITC (BD PharMingen) to determine the percentage of cells undergoing apoptosis (26). Briefly, B lymphocytes were washed in cold PBS and then resuspended in 100 µl binding buffer (10 mM HEPES/NaOH (pH 7.4) and 140 mM NaCl2). Five microliters of annexin V-FITC and 10 µl PI (50 µg/ml) were added and incubated at room temperature in the dark for 30 min before flow cytometric analysis. Cells that were positive for annexin V and negative for PI were recorded as undergoing apoptosis.
Bioassay for comparing production of IL-7 by WT and CD28-/-stromal cells
WT and CD28-/- stromal cells were FACS-sorted from respective LTBMC-B (as described above) at 1 x 104 cells/well. IL-7-dependent pre-B cell lines were added to the stromal cells at 1 x 104 cells/well and cultured for 96 h. Three IL-7-dependent pre-B cell lines, BC76, BC715, and BC77, were used in each experiment (donated by Dr. P. Kincade and previously characterized as solely dependent on IL-7, except BC76, which is responsive to IL-7 and an unknown stromal-derived factor (14)). The pre-B cells were then harvested using 0.02% EDTA and counted. Fold change was calculated as the number of harvested cells per starting cell number.
Data analysis
Statistical analysis of the results was performed using unpaired Students t test (GraphPad Software, San Diego, CA). Values of p < 0.05 were considered significant.
| Results |
|---|
|
|
|---|
To examine CD28 expression in the bone marrow, freshly isolated
murine bone marrow was separated into aggregated (stromal
cell-enriched) and deaggregated (stromal cell-depleted) fractions, as
previously described (22), and analyzed by RT-PCR. As
shown in Fig. 1
A
(lanes 3 and 4), CD28 mRNA was detected in
the aggregated bone marrow fraction, yet CD28 mRNA was greatly reduced
in the deaggregated bone marrow fraction. The aggregate fraction
contains reticular stromal cells tightly adhered to hemopoietic cells,
including B cell precursors (25). Although
CD28+ T cells may be present in the aggregates,
the amount of CD28 mRNA contributed by T cells would probably be
similar in the deaggregated and aggregated fractions, since the
frequency of lymphoid cells is similar in the two groups. Also, stromal
cells are enriched 50-fold in the aggregate fraction compared with the
deaggregated fraction. Thus, the stromal cells in the aggregates are
the most likely source of the CD28 mRNA. The adhesive nature of the
aggregates made it difficult to analyze CD28 Ag expression on stromal
cells isolated directly from the bone marrow (27).
Therefore, an alternative strategy was used to assess CD28 expression
on isolated bone marrow stromal cells from long term bone marrow
cultures. Primary cultured stromal cells were isolated by FACS-sorting
from LTBMC-B as previously described by our laboratory
(24). As shown in Fig. 1
A (lane
2), the FACS-purified stromal cells from LTBMC-B also expressed
CD28 mRNA. In addition, flow cytometry, using two different Abs against
CD28, confirmed that CD28 protein was expressed on the surface of most
primary-cultured stromal cells (Fig. 1
B). The level of CD28
on stromal cells was compared with that expressed by Con A-activated T
cells (Fig. 1
, lane 1) and thymocytes (Fig. 1
C).
As shown, the level of CD28 surface expression was more heterogeneous
on stromal cells compared with activated T cells and thymocytes. We
also observed that surface expression of CD28 was undetectable on
primary stromal cells after five passages in culture, and CD28 was
undetectable on the following stromal cell lines: CR3, CR4, BMS2, OP42,
S17, CBA20, NX4, and NU14 (data not shown). Thus, CD28 was detected on
primary stromal cells, and the level of CD28 expression was found to
diminish with consecutive in vitro passages.
|
To determine whether the distribution of CD28 on stromal cells
changes in the presence of B cell precursors, immunofluorescence was
performed on primary cultured stromal cells in the absence and the
presence of B cell precursors. Stromal cells were FACS-sorted into
chamber slides and double-stained for CD28 (FITC, green) and
-actin
(APC, red), which is typically expressed by marrow reticular stromal
cells (27). Two different Abs were used to detect CD28
protein: monoclonal hamster anti-mouse CD28 (17) and
polyclonal goat anti-mouse CD28 (10). Similar results
were obtained with both Abs. As shown,
-actin-positive cells were
large and reticular in shape, a common morphology previously described
for stromal cells (Fig. 2
). Approximately
7080% of the stromal cells expressed CD28 protein, and the relative
intensity of CD28 staining was heterogeneous among individual stromal
cells, which correlated with the flow cytometry results described in
Fig. 1
. In the absence of B cell precursors, CD28-positive stromal
cells displayed a heavier deposition of CD28 around the nucleus, with
patches of CD28 spreading out into the stromal cell body (Fig. 2
, A, D, and E). To determine whether the
distribution of CD28 on stromal cells changed in the presence of B cell
precursors, immunofluorescence was performed on stromal cells
cocultured with B-lineage cells for 48 h before fixation. Notably,
CD28 protein was localized in distinct, bright patches where the
B-lineage cells contacted the stromal cells (Fig. 2
, B,
D, and E). An extensive examination by
fluorescence and phase microscopy verified that each fluorescent patch
was associated with a lymphocyte contacting a stromal cell body or
process. Furthermore, flow cytometric analysis revealed that CD28 was
undetectable on B-lineage cells removed from the stromal cells (Fig. 1
D), indicating that the CD28 protein was associated with
the stromal cells and not the lymphocytes. Thus, the distribution of
CD28 on stromal cells changed in the presence of B cell precursors and
localized to the stromal cell:B cell precursor
interface.
|
Since CD28 was found to be expressed on stromal cells, we wanted
to determine whether the ligands for CD28 were expressed on B lymphoid
precursors that contact stromal cells in the bone marrow (4, 28). Expression of CD80 and CD86, the known ligands for CD28,
was examined on developing B cells isolated from both bone marrow and
LTBMC-B using flow cytometry and RT-PCR analysis (Fig. 3
). CD80 was detected by flow cytometry
on 46% of pre-B cells and 24% of pro-B cells isolated directly
from bone marrow (Fig. 3
A). Likewise, 1417% of pre-B
cells and 914% of pro-B cells isolated from LTBMC-B expressed CD80
(Fig. 3
D). CD80 mRNA was detected by RT-PCR analysis in
B-lineage cells from LTBMC-B and pre-B cells isolated from bone marrow;
however, CD80 mRNA was undetectable in pro-B cells isolated from bone
marrow (Fig. 3
, C and F). Two different size CD80
mRNA products were detected in the pre-B cells from bone marrow and
probably represent alternatively spliced RNA (29). Unlike
CD80, CD86 was undetectable on pro- and pre-B cells, isolated from bone
marrow or LTBMC-B, by flow cytometric analysis (Fig. 3
, B
and E). However, small amounts of CD86 mRNA were detected by
RT-PCR in pro- and pre-B cells isolated from bone marrow (Fig. 3
B). CD80 and CD86 were both undetectable on freshly
isolated sIgM+ bone marrow cells (data not
shown).
|
|
Signals leading to the proliferation and survival of pro-B cells
are received from interacting stromal cells and soluble growth factors
produced by the stromal cells (1). On T cells, ligation of
CD28 increases the production of growth factors (9).
During stromal cell:B cell precursor interactions, ligation of CD28 on
stromal cells may similarly affect the secretion of growth factors
necessary for the proliferation and survival of developing B cells. To
address this possibility, an in vitro assay was used to compare the
abilities of WT and CD28-/- stromal cells to
support pro-B cell expansion (20). FACS-sorted WT pro-B
cells from fresh bone marrow were cultured with FACS-sorted WT or
CD28-/- stromal cells from LTBMC-B for 96
h. During this time, pro-B cells will proliferate, and some will
differentiate into IgM+ immature B cells
(19). In all six experiments (Fig. 5
A) the number of B-lineage
cells recovered from cultures with CD28-/-
stromal cells was greater (average, 132% of WT ± 12.7%) than
the number recovered from cultures with WT stromal cells. However, the
percentages of IgM+ cells recovered from WT
and CD28-/- stromal cells were similar,
indicating that the proportion of pro-B cells differentiating into
immature IgM+ B cells was not affected by the
absence of CD28 (data not shown). Thus, the expansion of pro-B cells
was greater on stromal cells lacking CD28 than on stromal cells that
expressed CD28.
|
IL-7 secreted by stromal cells is critical for both pro-B cell
proliferation and survival (34). To address the
possibility that CD28-/- stromal cells produce
more IL-7 than WT stromal cells, the relative amount of IL-7 released
by WT and CD28-/- stromal cells was assessed
using an IL-7/stromal cell bioassay. This bioassay uses IL-7-dependent
pre-B cell lines documented to respond exclusively to IL-7
(14). In six of seven independent experiments using
FACS-sorted primary stromal cells (Fig. 5
B), the
IL-7-dependent pre-B cell lines proliferated similarly on
CD28-/- stromal cells compared with WT stromal
cells, indicating that CD28-/- stromal cells
and WT stromal cells secrete similar amounts of IL-7. Thus, the results
stated above suggest that a lymphopoietic factor other than IL-7 may
enhance the expansion of B-lineage cells on
CD28-/- stromal cells.
Survival of pro-B cells on WT and CD28-/- stromal cells
To determine whether the enhanced expansion of pro-B cells on
CD28-/- stromal cells was due to either
enhanced proliferation or enhanced survival of pro-B cells, an in vitro
assay was performed. The assay was used to compare the kinetics of
pro-B cell expansion, including the total number and the percentage of
apoptotic B-lineage cells recovered from WT and
CD28-/- stromal cells at different time points.
Apoptotic cells were detected by flow cytometry using PI and annexin
V-FITC, which binds the plasma membrane of cells during the early
stages of apoptosis (26). Cells undergoing apoptosis were
defined as annexin V positive and PI negative. As shown in Fig. 6
, the numbers of cells harvested from WT
and CD28-/- stromal cells were similar at 24,
48, and 72 h, yet the number of cells harvested from
CD28-/- stromal cells was
50% greater than
the number of cells harvested from WT stromal cells at 96 h. In
addition, the percentage of cells undergoing apoptosis was similar
between cultures with WT stromal cells and cultures with
CD28-/- stromal cells at all harvest times.
Thus, the lower number of cells harvested from WT stromal cells at
96 h was not due to an increase in cells undergoing apoptosis in
these cultures. These results suggest that the increased production of
developing B cells on CD28-/- stromal cells is
not due to an increase in pro-B cell survival on
CD28-/- stromal cells. In addition, the large
increase in the number of B lymphocytes harvested from
CD28-/- stromal cells between 72 and 96 h
of culture suggests the B-lineage cells proliferated more rapidly
during this time period on CD28-/- stromal
cells vs the B lymphocytes on WT stromal cells. Thus, in vitro CD28
appears to negatively regulate the ability of stromal cells to support
pro-B cell expansion.
|
If CD28 negatively regulates the ability of stromal cells to
support pro-B cell expansion in vitro, the absence of CD28 may also
lead to increased expansion of pro-B cells in vivo. To determine
whether CD28 affects pro-B cell expansion in vivo, we compared the
numbers of B-lineage cells in young WT and
CD28-/- mice. An earlier report using young
mice noted no significant differences between the frequencies of total
bone marrow B-lineage cells in CD28-/- and WT
mice (17); however, changes in individual subsets of B
cell precursors were not addressed in that study. To re-examine whether
a lack of CD28 expression affects B lymphopoiesis in vivo, flow
cytometric analysis was used to compare relative numbers of B cell
precursors in WT and CD28-/- mice. As shown in
Fig. 7
A, the frequency and
absolute number of the different stages of B-lineage cells were not
significantly different between young WT and young
CD28-/- mice. These data suggest that either
CD28 does not affect the ability of stromal cells to support pro-B cell
expansion in vivo or other factors compensate for the lack of CD28 in
vivo and conceal any effect linked to the lack of CD28.
|
50%
compared with those in age-matched WT mice. The frequency and absolute
number of immature B cells in the bone marrow were not significantly
reduced in aged CD28-/- mice; however, the
average frequency and absolute number of mature B cells in the bone
marrow of aged CD28-/- mice were increased by
4050% compared with those in aged-matched WT mice (Fig. 7| Discussion |
|---|
|
|
|---|
20% less in CD28-/- mice
compared with control littermates. This decreased level of Ig may be
due to a lack of costimulation by T cells to mature B cells. However,
Ferguson et al. (18) observed that germinal centers were
not formed in CD28-/- mice in response to a
T-independent Ag, suggesting that the B cells in
CD28-/- mice may have an intrinsic defect in
their ability to respond to Ags. An intrinsic defect in the B cells of
CD28-/- mice may result from a lack of
costimulation of immature B cells in the periphery or, alternatively, a
lack of costimulation of developing B cells in the bone marrow. Thus,
CD28 and its ligands, CD80 and CD86, which are critical in regulating
activation of mature B cells, may also regulate the development of
precursor B cells. We found that CD28 is present on bone marrow stromal
cells, which contact and provide essential stimuli for precursor B
cells, and that CD28 regulates the ability of stromal cells to support
expansion of B cell precursors. In our studies the distribution of CD28 on bone marrow stromal cells varied depending on whether B-lineage cells were contacting stromal cells. In the absence of B-lineage cells, CD28 was localized in patches across the surface of the stromal cell; however, in the presence of B-lineage cells, CD28 localized to the B cell precursor:stromal cell interface. CD80, one ligand for CD28, was detectable on freshly isolated pre-B cells, and surface expression of CD86, a second ligand for CD28, was induced on a subset of B cell precursors following exposure to IL-7. Additional experiments were performed to determine whether CD28 affected the ability of stromal cells to support developing B cells. The production of B cells was found to be greater on stromal cells lacking CD28 than on CD28-expressing stromal cells. This effect was at least partly due to a difference in soluble factors produced by the stromal cells, because the increased expansion of B cell precursors also occurred in stromal-conditioned medium from CD28-/- stromal cells. The results obtained from the experiments with stromal-conditioned medium could argue against a specific interaction between stromal cells and B cell precursors involving CD28. However, the stromal cells used in these experiments were isolated from LTBMC-B in which the stromal cells contact B cell precursors. The differences between medium from WT and CD28-/- stromal cells could have thus resulted from a previous lack of CD28 engagement on the stromal cells by CD80/CD86 on B cell precursors in the LTBMC. Taken together, our results suggest that CD28 expression on bone marrow stromal cells contributes to stromal-dependent regulation of B-lineage cells.
The studies presented here provide evidence for a parallel between B cell-T cell interactions in the peripheral lymphoid tissues and B cell precursor-stromal cell associations in the bone marrow. Upon interaction with a B cell, the cytoskeleton of the T cell rearranges to localize the TCR, costimulatory molecules, and adhesion and signaling molecules to the T cell:B cell interface (35). This reorganization provides a mechanism for optimal signal transduction and subsequent activation of the T cell, leading to directional release of cytokines toward the interacting B cell. CD28 provides an essential costimulatory signal during this process and localizes to the T cell:B cell interface, particularly in the central region where the TCR also localizes (10). The results from the present study suggest that CD28 may localize in a similar manner on stromal cells by aggregating at the stromal cell:B cell precursor interface. If CD28 participates in regulating the production of developing B cells by interacting with CD80/CD86 on the precursor B cells, one may predict that CD80 and/or CD86 to also localize to the stromal cell:B cell precursor interface. This possibility will be addressed in future experiments using B cell precursors from CD80/CD86-/- mice. It would also be interesting to examine the localization of the pre- B cell Ag receptor (pre-BCR) on pre-B cells and determine whether this molecule aggregates at the stromal cell:B cell precursor interface. To date, a ligand for the pre-BCR has not been identified, but it has been recently reported that soluble pre-BCR molecules bind to stromal cells (36). Aggregation of the pre-BCR at the stromal cell:B cell precursor interface would support the possibility that a ligand for the pre-BCR may be present on stromal cells in addition to supporting a functional role for localization of CD28 at the stromal cell:B cell precursor interface.
Aggregation of specific cell surface molecules at the stromal cell:B
cell precursor interface may allow stromal cells to distinguish
B-lineage precursors from other lineages in the bone marrow to release
B-lineage-specific cytokines. This concept was introduced by Jacobsen
et al. (15), who reported that
1
integrin (identified by KMI6 mAb) localized to the stromal
cell-lymphoid cell contact site in native bone marrow. The authors
suggested that the expression of specific molecules, such as
1 integrin, at the stromal cell/lymphoid cell
interface may lead to directional secretion of lymphoid-specific
cytokines. Support for this concept comes from other studies that
showed that IL-7 is released from stromal cells upon contact with pro-B
cells and stromal cells (14, 34). It is possible that
aggregation of CD28 and its ligands at the stromal cell:B cell
precursor contact area may lead to signaling that regulates secretion
of B-lineage-specific growth factors from the stromal cells. Indeed,
our observation that stromal-conditioned medium from
CD28-/- stromal cells led to greater production
of B cells supports this hypothesis. This observation suggests that
CD28-/- stromal cells produce either a greater
amount of soluble factors that stimulate the expansion of B cell
precursors or a smaller amount of soluble factors that inhibit the
expansion of B cell precursors.
To date, it is not known which growth factors produced by stromal cells
may be regulated by CD28. Although IL-7 production appears to be
similar from WT and CD28-/- stromal cells, the
production factors that synergize with IL-7, such as stem cell factor,
IGF-I, and Flt-3 ligand (37, 38, 39, 40), may be greater in the
absence of CD28. Alternatively, the production of inhibitory factors
such as IFN-
, TGF-
, or IFN-
(41, 42, 43), may be
decreased from stromal cells lacking CD28. It is also possible that
CD28 may indirectly regulate the expression of growth factor receptors
on developing B cells by interacting with CD80/CD86 or an alternative
ligand on the B cells. For example, engagement of CD80/CD86 on B cell
precursors by CD28 on stromal cells may lead to down-regulation of the
IL-7R on B cell precursors and decreased proliferation of the
developing B cells. Thus, CD28 may regulate the production of B cells
in the bone marrow by directly regulating the production of growth
factors by stromal cells or indirectly regulating the expression of
growth factor receptors on the B cell precursors.
Although our studies did not directly address the role of CD80/CD86 in the production of developing B cells, previous studies by Parijis et al. (7) and Fournier et al. (8) provide evidence for roles for CD80 and CD86 in B cell development and selection of B cell precursors. Both groups reported that overexpression of CD80 or CD86 led to a decrease in the number of B220+ IgM- (pre- and pro-B cells) and B220+IgM+ immature B cells in the bone marrow. In fact, the few immature B cells present in these mice did not express CD80 or CD86. The authors speculated that CD80 and CD86 might be up-regulated on immature B cells upon recognition of self Ag, targeting these cells for elimination. If true, this hypothesis may explain the low levels of CD80/CD86 detected on pro- and pre-B cells in our studies. During development, CD80/CD86 may be up-regulated on pro-and pre-B cells following exposure to IL-7 for a short period of time and then down-regulated in functional cells. In contrast, continued expression of CD80 and CD86 may occur in developing B cells with intrinsic defects and thus target these cells for deletion.
The results from our in vitro experiments suggest that CD28 on stromal cells negatively regulates the production of developing B cells. Based on these results, we predicted that CD28-/- mice might have an increased number of B-lineage cells in the bone marrow compared with WT mice. On the contrary, the number of B-lineage cells was similar in the bone marrow of young CD28-/- mice and that of WT control mice. One of the many possible explanations for the differences between the in vitro and in vivo data is a compensatory mechanism acting in vivo that is absent in vitro. For example, the number of B-lineage cells produced in the bone marrow of the young CD28-/- mice may be higher than that in WT mice, yet this increase in B cell production may be counteracted by an increase in the number of B-lineage cells undergoing cell death in CD28-/- mice. We addressed the possibility of increased B cell production in CD28-/- mice using in vivo bromodeoxyuridine labeling and did not observe a significant difference between the number of pro- and pre-B cells produced per day in WT and CD28-/- mice (data not shown). Unfortunately, we were unable to accurately compare apoptosis in the bone marrow of WT and CD28-/- mice due to the presence of macrophages in the bone marrow that quickly phagocytose dying and dead cells (44). The data from the bromodeoxyuridine experiments, however, suggest that in vivo the production rate of B cell precursors was not affected by the absence of CD28.
If B lymphopoiesis is not altered in CD28-/- mice under homeostatic conditions, it is possible that a lack of CD28 may affect B lymphopoiesis under conditions in which B lymphopoiesis is stressed. One example of a stressful condition is the bone marrow of a normal aged animal in which the number of B cell precursors is altered compared with that in young animals (20, 45). Thus, we decided to compare the numbers of B cell precursors in the bone marrow of aged CD28-/- mice and age-matched WT mice. At 1519 mo of age CD28-/- mice exhibited a significant decrease in the number of pro- and pre-B cells in the bone marrow compared with age-matched WT mice. Therefore, the decline in pre-B cells previously reported to occur in the bone marrow of aged WT animals is augmented in animals lacking CD28. One explanation for the decline in pro- and pre-B cells is a defect in the ability of bone marrow stromal cells in aged CD28-/- mice to support expansion of B-lineage cells. Previous studies reported that the ability of stromal cells to support in vitro proliferation of pro-B cells declines with age in WT animals (14). It is possible that signaling through CD28 provides stimulation to maintain the functional capability of stromal cells, and the absence of this signal over time leads to a greater decline in the ability of stromal cells to support B lymphopoiesis. Yet, as seen in both the aged WT and CD28-/- mice, B cells continue to be produced despite possible defects in the stromal cells.
Another explanation for the decline in pro- and pre-B cells in aged CD28-/- mice may be the increase in mature B cells recirculating back and residing in the bone marrow of these mice. To maintain a homeostatic number of B-lineage cells in the bone marrow, an increase in mature B cells may be compensated by a decrease in B cell precursors. Likewise, mature B cells may compete for growth factors and ligands, such as a possible ligand for the pre-BCR, which are needed by precursor B cells to survive and proliferate. The increased number of mature B cells in the bone marrow may be a downstream effect of increased numbers of mature B cells in the spleen (data not shown), as observed in the aged CD28-/- mice. In that case, mature B cells recirculating back to the bone marrow may create a feedback loop in which the number of B cells in the spleen indirectly controls the number of B cell precursors being produced in the bone marrow.
The results from the present study provide evidence that parallels exist between mature B cell:T cell interactions and precursor B cell: stromal cell interactions. We found that CD28, which has been previously characterized on T cells, is also expressed on bone marrow stromal cells and affects the ability of the stromal cells to support B lymphopoiesis. Future studies will be performed to determine whether CD80/CD86, the ligands for CD28, also regulate B lymphopoiesis. The parallels between T cell:B cell interactions and stromal cell:B cell precursor interactions may not be limited to CD28 and CD80/CD86, but may also include other costimulatory molecules. For example, the costimulatory molecules CD40 and CD40 ligand have been suggested to regulate B lymphopoiesis in previous studies (46, 47); however, whether CD40 ligand is expressed on bone marrow stromal cells and/or affects the function of bone marrow stromal cells is still unknown. The results from our studies may lead to future experiments addressing whether the ability of B cell precursors to respond to costimulation in the bone marrow relates to the ability of mature B cells to respond to costimulation in the periphery.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Papanicolaou Building, Room 211 (M710), University of Miami Medical School, 1550 NW 10th Avenue, Miami, FL 33136. ![]()
3 Address correspondence and reprint requests to Dr. Pamela L. Witte, Department of Cell Biology, Neurobiology, and Anatomy, Loyola University Medical Center, 2160 South First Avenue, Maywood, IL 60153. E-mail address: pwitte{at}lumc.edu ![]()
4 Abbreviations used in this paper: WT, wild type; BCR, B cell Ag receptor; LTBMC-B, long term bone marrow culture for B lineage; PI, propidium iodide. ![]()
Received for publication October 18, 2001. Accepted for publication June 25, 2002.
| References |
|---|
|
|
|---|
interferon: direct and indirect action on lymphoid and stromal cells. [Published erratum appears in 1993 Exp. Hematol. 21:594]. Exp. Hematol. 21:224.[Medline]
. J. Immunol. 142:3875.[Abstract]
This article has been cited by other articles:
![]() |
M. A. Linterman, R. J. Rigby, Raphael. K. Wong, D. Yu, R. Brink, J. L. Cannons, P. L. Schwartzberg, M. C. Cook, G. D. Walters, and C. G. Vinuesa Follicular helper T cells are required for systemic autoimmunity J. Exp. Med., March 16, 2009; 206(3): 561 - 576. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. Minges Wols, J. A. Ippolito, Z. Yu, J. L. Palmer, F. A. White, P. T. Le, and P. L. Witte The effects of microenvironment and internal programming on plasma cell survival Int. Immunol., July 2, 2007; (2007) dxm051v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Bahlis, A. M. King, D. Kolonias, L. M. Carlson, H. Y. Liu, M. A. Hussein, H. R. Terebelo, G. E. Byrne Jr, B. L. Levine, L. H. Boise, et al. CD28-mediated regulation of multiple myeloma cell proliferation and survival Blood, June 1, 2007; 109(11): 5002 - 5010. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Riley and C. H. June The CD28 family: a T-cell rheostat for therapeutic control of T-cell activation Blood, January 1, 2005; 105(1): 13 - 21. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |