|
|
||||||||
Institut National de la Santé et de la Recherche Médicale, Unité 437, Nantes, France and Institut de Transplantation et de Recherche en Transplantation, Nantes, France
| Abstract |
|---|
|
|
|---|
molecules. Both fresh
CD4- and CD4+ DC displayed an immature
phenotype, although CD4+ cells constitutively expressed
moderate levels of CD80. The half-life of the CD4-, but
not CD4+ DC in vitro was extremely short but cells could be
rescued from death by CD40 ligand, IL-3, or GM-CSF. The
CD4- DC produced large amounts of the proinflammatory
cytokines IL-12 and TNF-
and induced Th1 responses in allogeneic
CD4+ T cells, whereas the CD4+ DC produced low
amounts of IL-12 and no TNF-
, but induced Th1 and Th2 responses. As
compared with the CD4+ DC that strongly stimulated the
proliferation of purified CD8+ T cells, the
CD4- DC exhibited a poor CD8+ T cell
stimulatory capacity that was substantially increased by CD40
stimulation. Therefore, as previously shown in mice and humans, we have
identified the existence of a high IL-12-producing DC subset in the rat
that induces Th1 responses. The fact that both the CD4+ and
CD4- DC subsets produced low amounts of IFN-
upon viral
infection suggests that they are not related to plasmacytoid
DC. | Introduction |
|---|
|
|
|---|
Different subsets of DC have also been described in rats. MacPherson
and colleagues (10) first described that a
CD4+ and a CD4- subset of
DC can be purified from afferent lymph and more recently, we described
similar subsets in the spleen (11). The fact that
CD4+ DC isolated from both the afferent lymph and
spleen coexpress signal regulatory protein (SIRP)
(CD172a), which
was recently found to be the target of the OX41 mAb (12),
and CD90 suggest that they represent the same subset of DC.
Interestingly, both subsets were also found in lymph nodes but in
different proportions (11). Previous studies have shown
that CD4+ DC were better stimulators of
CD4+ and CD8+ T cells than
the CD4- cells in allogeneic MLR or in soluble
Ag presentation assays (10). However, it is not known
whether this difference is related to different costimulatory molecule
expression or cytokine production by these DC subsets. More recently,
the CD4- subset of rat DC has been shown to
exhibit two new and unusual functions. Huang et al. (13)
have shown that CD4-SIRP-
DC constitutively migrated through afferent lymph and, more
importantly, transported phagocytosed fragments of apoptotic gut
epithelial cells to the T cell area of mesenteric lymph nodes. It has
therefore been suggested that this pathway of self-Ag transport could
be involved in the maintenance of self-tolerance (14). In
addition, we found that
CD4-SIRP- DC in spleen
(11) but also in lymph nodes (B. Trinité and R.
Josien, unpublished observations) exhibited a potent cytotoxic activity
in vitro against selected tumor cell lines such as YAC-1 and Jurkat
cells. Several reports have now confirmed that myeloid human DC also
exhibited such a cytolytic function (15, 16, 17). Whether this
function plays a role in vivo in unknown; however, so far we have been
unable to detect any cytotoxic activity of DC against normal cells in
general or in particular against T cells.
Several arguments therefore suggest that the CD4- subset of DC in rats might be involved in T cell tolerance. The aim of this study was to analyze in detail the phenotype of splenic DC subsets and to assess their proinflammatory cytokine production and their T cell stimulatory activity in terms of Th and CD8+ T cell differentiation. We found that both CD4+ and CD4- splenic subsets exhibited an immature phenotype in spleen but induced a strong proliferative response in resting CD4+ allogeneic T cells. Freshly isolated CD4- DC were the main producers of IL-12p40 and drove potent Th1 cell differentiation, whereas CD4+ DC induced nonpolarized Th cell differentiation. In contrast, as compared with CD4+ DC, the CD4- subset was a poor stimulator of allogeneic CD8+ T cells.
| Materials and Methods |
|---|
|
|
|---|
Sprague Dawley and Lewis rats were obtained from the Centre dElevage Janvier (Le Genest Saint-Isles, France) and were used when 610 wk old.
Reagents
The CD40 ligand (CD40L)-human CD8 fusion molecule (supernatant
of transfected Sf9 insect cells) was kindly provided by Dr. Y. Choi
(Department of Pathology and Laboratory Medicine, University of
Pennsylvania School of Medicine, Philadelphia, PA). Poly(I:C) and LPS
were obtained from Sigma-Aldrich, (St. Louis, MO). Recombinant rat
IFN-
was obtained from R&D Systems (Minneapolis, MN). Recombinant
rat IFN-
and TNF-
were obtained from Serotec (Oxford, U.K.),
recombinant rat IL-3
was from PeproTech (Rocky Hill, NJ), and
Staphylococcus aureus Cowan I (SAC) strain Pansorbin cells
were purchased from Calbiochem (San Diego, CA). GM-CSF (supernatant of
COS cells transfected with murine GM-CSF) was used at a dilution of
1/1000.
Monoclonal Abs
The following mouse anti-rat mAbs obtained from the
European Collection of Cell Culture (Salisbury, U.K.) were used in
cytofluorometric studies and cell sorting after coupling to FITC,
biotin, or PE (Bioatlantic, Nantes, France): OX6 (MHC class II RT1B),
OX17 (MHC class II RT1D), OX18 (MHC class I), W3/25 (CD4), OX8
(CD8
), R7.3 (TCR
), V65 (TCR
), OX7 (Thy1.1, CD90), OX19
(CD5), OX34 (CD2), OX33 (CD45R on B cells), OX42 (CD11b/c), integrin
2 chain (CD18), OX62 (integrin
E2 chain or CD103), OX85 (CD62L),
OX49 (CD44), ED1 (CD68), ED2, ED3 (sialoadhesin), OX41 (SIRP
), OX1
and OX30 (CD45), OX22 (CD45RC), OX2 (CD200) and OX39 (CD25, IL-2R
-chain). FITC-conjugated anti-CD3 (clone G4.18), anti-CD11a
(clone WT.1), anti-B7-2 (clone 24F), anti-B7-1 (clone
3H5), and hamster anti-mouse-CD40 (cross-reacting with rat CD40)
mAbs were purchased from BD PharMingen (San Diego, CA). FITC
anti-NKRP1A (CD161a) and purified anti-ICAM (CD54) were
purchased from Serotec.
Cell preparation
DC. Spleens were minced and digested in 2 mg/ml collagenase D (Roche Diagnostics, Meylan, France) in RPMI 1640/1% FCS for 30 min at 37°C. EDTA at 10 mM was added during the last 5 min and the cell suspension was then pipetted up and down several times and filtered. Cells were washed once in PBS/2 mM EDTA/1% FCS and low-density cells were obtained after centrifugation on a 14.5% Nycodenz (Nycomed, Oslo, Norway) gradient as previously described (18). Cells were then washed once and incubated with a saturating concentration of biotinylated OX62 mAb at 4°C for 20 min. After two washes, cells were mixed with streptavidin-conjugated MACS microbeads following the manufacturers instructions (Miltenyi Biotec, Paris, France). Positive selection was performed on MiniMACS type-positive selection columns (Miltenyi Biotec).
T cells.
CD4+ and CD8+ T cells were
prepared from lymph node cells by negative selection of class
II+, Ig+,
NKR-P1A+, and CD8+ or
CD4+ cells, respectively, with specific mAbs
followed by antimouse IgG-coated magnetic beads (Dynal, Oslo, Norway).
Purity was routinely
98 and
90% for CD4+ and
CD8+ T cells, respectively.
Flow cytometry and cell sorting
For cytofluorometric analyses, 5 x 104 cells were incubated with PE-conjugated OX6 or W3/25 mAb along with another FITC-conjugated mAb for 20 min at 4°C. Cells were washed twice and analyzed on a FACSCalibur (BD Biosciences, Mountain View, CA). For cell sorting of CD4+ and CD4- subsets of splenic DC, OX62+ cells were incubated with OX6-PE and W3/25-FITC-conjugated mAbs and sorted using a FACSVantage (BD Biosciences).
May-Grünwald-Giemsa coloration
Sorted DC (2 x 105) were cytospun onto a glass slide (800 rpm, 4 min) and air dried for 12 h. Cells were then stained using a classic Giemsa coloration.
Mixed leukocyte reaction
Increasing numbers of allogeneic DC were cultured with 5 x 104 purified CD4+ or CD8+ T cells in round-bottom 96-well plates in a final volume of 200 µl of IMDM (Sigma-Aldrich) supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 1 mM sodium pyruvate, 1 mM HEPES, 5 x 10-5 M 2-ME, and 1% normal rat serum for 4 days at 37°C in 5% CO2, and for the last 8 h in the presence of 0.5 µCi [3H]TdR (Amersham, Les Ulis, France). The cells were then harvested onto glass fiber filters and [3H]TdR incorporation was measured using a standard scintillation procedure (Packard Instrument, Meriden, CT).
Cytokine production assays
Stimulation of isolated DC for cytokine production.
Sorted splenic rat DC (1.25 x 105 cells)
were cultured in 1 ml RPMI 1640 medium (Sigma-Aldrich), supplemented
with 2 mM L-glutamine, 100 U/ml penicillin, 0.1 mg/ml
streptomycin, 1 mM sodium pyruvate, 5 x
10-5 M 2-ME, and 10% FCS in 24-well plates.
After 24 h, supernatants were collected and stored until analysis
at -70°C. Stimuli were used at the following concentrations: CD40L,
1/300 dilution of the supernatant; LPS, 0.5 µg/ml; poly(I:C), 50
µg/ml; SAC, 20 µg/ml; IFN-
, 20 U/ml; and inactivated influenza
virus (kindly provided by F. Brière, Dardilly, France).
T cell cytokine production. A total of 2 x 104 allogeneic sorted DC were cultured with 1 x 105 purified CD4+ or CD8+ T cells in a final volume of 200 µl of IMDM with 1% rat serum. After 4 days of stimulation, the supernatant was collected and stored for cytokine assays. Cells were then washed and viable T cells were immediately restimulated in an anti-CD3 (5 µg/ml)-coated plate in the presence of anti-CD28 mAb (2.5 µg/ml) at a concentration of 2 x 105 cells/ml. Twenty-four hours after restimulation, supernatants were collected and frozen until further use.
ELISA test.
The amount of IL-2, IFN-
, IL-10, and TNF-
in the supernatants was
measured using a rat ELISA kit (OptEIA set; BD PharMingen) according to
the manufacturers instructions. Rat IL-13 and IL-12p40 were detected
using a BioSource International (Fleurus, Belgium) ELISA kit according
to the manufacturers instructions. IL-4 measurement was performed
using a two-site sandwich ELISA. Anti-IL-4 hybridoma OX81 was obtained
from the European Collection of Cell Culture, biotinylated anti IL-4
mAb (clone B11-3) and recombinant rat IL-4 were purchased from BD
PharMingen. IFN-
was detected using an ELISA kit specific for both
mouse and rat IFN-
(PBL Biomedical Laboratories, New Brunswick,
NJ).
RT-PCR
Total RNA was extracted from 5 x 105 resting or stimulated FACS-sorted DC using TRIzol (Life Technologies, Paisley, U.K.) and reverse transcribed into cDNA as described previously (19).
Nonquantitative PCR.
PCR primer sequences used were: rCD4 forward, CTTTCTCCACGCACAGCCTA;
rCD4 reverse, TGCCTTCCATCTCAACTCTCC, resulting in a 218-bp PCR
product; rCD5 forward, GTGCGGTCCTCTGATCTACAAG, rCD5 reverse,
GGCTGGCTGTACTCATTGTCC, resulting in a 180-bp PCR product; rSIRP
forward, GCATTTCACAGACAACAGGGAT; and rSIRP
reverse,
GCAGCCATCAGCAGGACTACT, resulting in a 273-bp PCR product. The
hypoxanthine phosphoribosyltransferase (HPRT) gene
was also amplified as a control. PCR amplification consisted of an
initial denaturation step at 94°C for 1 min, followed by 27 cycles at
94°C for 30 s, annealing for 30 s, and extension at 72°C
for 30 s in each cycle. PCR products were electrophoresed on an
ethidium bromide-stained 1% agarose gel.
Quantitative RT-PCR.
Real-time quantitative PCR was performed using an Applied Biosystems
GenAmp 7700 Sequence Detection System with the SYBR Green PCR Core
Reagent (Applied Biosystems, Foster City, CA). The following
oligonucleotides were used: rIL-12p40 forward, GAAACAGTGAACCTCACCTG;
rIL-12p40 reverse, TGCTTCACACTTCAGGAAAGT; rIL-12p35 forward,
TGATGATGACCCTGTGCCTT; rIL-12p35 reverse, GCATGGAGCAGGATACAGAGC; and as
a housekeeping gene HPRT forward, GCGAAAGTGGAAAAGCCAAGT; and
HPRT reverse, GCCACATCAACAGGACTCTTGTAG. Total cDNA was
amplified in 25 µl of PCR mix containing 300 nM of each primer; 200
µM dATP, dGTP, and dCTP; 400 µM dUTP; 3 mM
MgCl2; 0.25 U of uracil-N-glycosylase;
0.625 U of AmpliTaq Gold DNA polymerase, and 2.5 µl of the 10x SYBR
Green buffer. The reaction started with a step of 2 min at 55°C to
allow the uracil-N-glycosylase to eliminate putative PCR
contaminants, followed by 10 min at 95°C to activate the AmpliTaq
Gold DNA polymerase, and then 40 cycles each consisting of 15 s at
95°C and 1 min at 60°C. The real-time PCR data were plotted as the
Rn fluorescence signal vs the cycle number.
The Applied Biosystems 7700 sequence detection software calculates the
Rn using the formula:
Rn =
(Rn+) -
(Rn-), where
Rn+ is the fluorescence signal of
the product at any given time and
Rn- is the mean fluorescence signal
during cycles 33 and referred to as the baseline. The Ct value is
defined as the cycle number at which the
Rn
crosses a threshold. The threshold is set above the background
fluorescence to intersect the exponential portion of the amplification
curve of a positive reaction. The Ct is inversely proportional to the
log amount of template in the PCR. HPRT was used as an
endogenous control gene to normalize for RNA amounts. The transcript
accumulation index (TAI) is expressed as the fold change between a
given sample (Q) and a calibrator (CB), where the calibrator represents
the 1-fold expression of each gene. The TAI is calculated as: TAI
= 2-
Ct, where 
Ct =
(CtTarget - CtHPRT)Q -
(CtTarget - CtHPRT)CB. A
prerequisite for using the 2-
Ct method is
to check that the efficacy of each gene-specific PCR is >96%, as
determined by the slope of the curve Ct = f(log(target DNA)).
Statistical analyses
Statistical analyses were performed using Students t test.
| Results |
|---|
|
|
|---|
DC were isolated from rat spleens by positive selection using the
OX62 mAb that was previously shown to recognize the rat
E2 integrin
chain or CD103 (20, 21). Of note, CD103 was recently shown
to be expressed by CD8+ spleen DC in mice
(22). We found that >85% of non-B class II-positive
cells in low-density spleen cells express CD103 (data not shown);
however, we were able to identify an OX62high and
an OX62low population (Fig. 1
A). As shown below, these two
subsets correspond to the CD4- and
CD4+ subsets of DC, respectively. Since the
positive selection method we used tended to select high- rather than
low-expressing cells, the relative percentage of
CD4+ and CD4- DC after
selection of OX62 cells that we previously described (11)
did not actually reflect in vivo settings. Indeed, the
CD4- DC:CD4+ DC ratio was
roughly 1:1 in low-density spleen cells as compared with 3:1 to 4:1 in
sorted OX62+ cells (Fig. 1
B). These
OX62-positive cells were negative for TCR
and are therefore DC
(21). This positive selection method avoids the classical
step of overnight culture that allows DC to mature in vitro and
therefore dramatically modify their cell surface phenotype and
function. The yield was 35 x 106
OX62-positive cells per spleen with a purity of 90%.
|
As we have previously shown, two subsets of splenic DC can be
identified in rats based on their expression of the CD4 molecule
(11). Similar subsets have been previously described by
others in afferent lymph (10). The phenotype of these
subsets is described in Table I
. We found
that, unlike in mice, no splenic DC in rats express CD8
. The
CD4+ subset of splenic DC coexpressed CD5 and
SIRP
and also exhibited high levels of CD90 (Thy1.1), whereas
CD4- cells were negative for CD5 and SIRP
but
expressed low levels of CD90. CD4+ DC expressed
slightly higher levels of NKR-P1A (CD161A), CD11c, class I, and lower
levels of the OX62 integrin than CD4- DC,
whereas both subsets expressed similar levels of CD11a and CD11b. Both
subsets were negative for the macrophage markers ED2 and sialoadhesin
(ED3). We found that CD4- DC expressed high
levels of the OX2 (CD200) molecule whereas CD4+
stained weakly for this Ag. This is, to our knowledge, the first
description of a potentially useful marker for rat
CD4- DC. Finally, we did not observe significant
changes in the expression of CD4, CD5, and SIRP on splenic DC subsets
after 3 days of in vitro culture (data not shown)
|
|
FACS analysis revealed that CD4- DC were
larger than CD4+ cells (data not shown). This was
confirmed when cytospun, freshly isolated splenic DC subsets were
examined after Giemsa staining (Fig. 3
).
CD4- DC exhibited a relative homogenous
myeloid-related morphology with a large and irregularly shaped nucleus
and a large cytoplasm containing inclusions (Fig. 3
A).
Morphological features of CD4+ DC were much less
homogenous and very different from the CD4-
subset (Fig. 3
B). Most CD4+ DC had a
small and regular nucleus and a small cytoplasm that did not contain
large inclusions. Fine and long dendrites could be observed on some of
the CD4+ DC. A small percentage of
CD4+ splenic DC exhibited a morphology similar to
CD4- cells and, finally, a few cells had an
intermediate morphology.
|
mRNA are expressed in CD4+
splenic DC
As previously shown in mice, several surface markers that are
found on the surface of DC are actually not expressed by DC but rather
acquired from surrounding cells (23, 24). We therefore
analyzed the expression of CD4, CD5, and SIRP
mRNA in
CD4+ splenic DC by RT-PCR. As shown in Fig. 4
, mRNA for CD4, CD5, and SIRP was
expressed in CD4+ DC. As expected, CD4 and
SIRP
mRNA were not detected in CD4- DC;
however, a weak signal for CD5 mRNA was observed.
|
It is now well established that the duration of DC-T cell
interaction and therefore of DC half-life is an important parameter of
the T cell activation process (25). Therefore, specific
functions of DC subsets might be related to their survival. We thus
examined the in vitro survival of CD4+ and
CD4- splenic DC subsets. After 3 days of
culture, >80% of CD4- DC were dead, suggesting
a very short spontaneous half-life (Fig. 5
). In three independent experiments, a
substantial percentage of CD4- DC could be
rescued from programmed cell death by CD40 cross-linking, IL-3 or
GM-CSF (p < 0.05 as compared with untreated cells)
but not by LPS, poly(I:C), IFN-
, or TNF-
. In contrast, roughly
two-thirds of CD4+ splenic DC were still alive
after 3 days of culture (p < 0.01 as compared with
CD4- DC) and we could not observe any consistent
effect of soluble CD40L, LPS, poly(I:C), IL-3, GM-CSF, IFN-
, or
TNF-
on the survival of this DC subset (Fig. 5
).
|
by splenic DC
subsets
Previous reports have shown that human and mouse DC subsets
differentially influence the nature of the Th cell response
(1). This was in part related to the capacity of DC
subsets to produce IL-12 (26). We therefore examined the
production of the IL-12p40 subunit by rat splenic DC subsets. High
levels of IL-12p40 were detected in the supernatant of CD40L (range,
54270 pg/ml in four independent experiments)- and to a lesser extent
LPS-stimulated (range, 44167 pg/ml) CD4-
DC, whereas poly(I:C) did not induce IL-12p40 production (Fig. 6
). In contrast,
CD4+ DC did not produce detectable IL-12p40 in
response to CD40 cross-linking, LPS, or poly(I:C) stimulation in the
same experiments. However, stimulation of DC with SAC plus IFN-
induced variable but statistically comparable amounts of IL-12p40
production in both CD4- and
CD4+ spleen DC (CD4+ DC,
range, 46235 pg/ml; CD4- DC, range, 18482
pg/ml, p = 0.4). The expression of IL-12p40 and p35
chain mRNA was also analyzed in fresh and stimulated DC subsets by
real-time quantitative RT-PCR (Table II
).
Both chains were strongly up-regulated in SAC plus IFN-
- and to a
lesser extent LPS- or CD40L-stimulated CD4- DC,
indicating that CD4- DC have the capacity to
produce bioactive IL-12p70. In CD4+ DC, IL-12p40
mRNA was up-regulated by SAC plus IFN-
but not reproducibly by
CD40L, a finding consistent with IL-12p40 ELISA. However, unlike in
CD4- DC, IL-12p35 mRNA was not significantly
up-regulated upon stimulation of CD4+
DC.
|
|
upon stimulation by poly(I:C) but not LPS, CD40L,
or SAC plus IFN-
(Fig. 6
stimulation induced variable
amounts of IL-10 in both CD4+ (range, 093 pg/ml) and
CD4- DC (range, 0108 pg/ml) (Fig. 6
was detected in the supernatants of
poly(I:C)-stimulated CD4+ but not
CD4- DC (Fig. 6
(CD4+ DC,
range, 416 pg/ml; CD4- DC, range, 2376
pg/ml, p = 0.12), respectively, upon infection by
influenza virus, suggesting that CD4+ and
CD4- DC are not related to the plasmacytoid DC
previously described in humans and mice. Differential T cell stimulatory activity of fresh and mature splenic DC subsets in MLR
The T cell stimulatory activity of splenic DC subsets was analyzed
in allogeneic MLR. We previously reported that, at high DC:T cell
ratios, CD4- DC were slightly less potent APC in
MLR than CD4+ DC (11). Similar
experiments were repeated using more physiological conditions, i.e.,
using normal rat serum- instead of FCS-containing culture medium. In
these conditions, CD4+ DC subsets induced a
similar or slightly higher proliferation of allogeneic naive
CD4+ T cells than CD4- DC
(Fig. 7
). However, a major difference
between CD4+ and CD4- DC
subsets was the extremely low capacity of CD4-
DC to induce allogeneic naive CD8+ T cell
proliferation as compared with CD4+ DC (Fig. 7
).
|
|
We next analyzed the capacity of splenic DC subsets to
induce CD4+ and CD8+ T cell
differentiation in vitro. Freshly isolated and unstimulated
CD4+ and CD4- DC were
cultured with allogeneic CD4+ or
CD8+ lymph node T cells at a DC:T ratio of 1:5.
Four days later, T cells were restimulated with anti-CD3 and
anti-CD28 mAbs and supernatants were harvested after 24 h for
cytokine analyses. As shown in Fig. 9
A, both
CD4- and CD4+ DC promoted
the differentiation of CD4+ T cells consistently
producing large amounts of IFN-
(mean ± SD of five independent
experiments: CD4+ DC, 70.1 ± 19.5 ng/ml;
CD4- DC, 58.2 ± 19.3, NS) and IL-2
(CD4+ DC, 8.9 ± 5.5 ng/ml;
CD4- DC, 9.7 ± 6.1, NS) (Th1). The amounts
of IL-10 produced by CD4+ T cells upon
restimulation were quite variable (ranges, 4715,000 pg/ml for
CD4+ DC, 5410,700 for
CD4- DC in five independent experiments) but not
significantly different between supernatants of
CD4+ or CD4- DC-stimulated
T cells. Although IL-4 was never detected, substantial amounts of IL-13
(250 ± 167 pg/ml), another typical Th2 cytokine, were produced by
CD4+ T cells that had been stimulated by
CD4+ DC. In contrast, CD4-
DC were unable to promote the differentiation of IL-13-producing Th
cells (Th2). CD4+ splenic DC promoted the
differentiation of CD8+ T cells producing large
amounts of IFN-
(49 ± 35 ng/ml; Fig. 9
B). In
contrast and according to the inability of CD4-
DC to induce strong proliferation of allogeneic
CD8+ T cells (Fig. 7
), these
CD8+ T cells produced very low amounts of IFN-
upon in vitro restimulation as compared with CD4+
DCstimulated CD8+ T cells (4.2 ± 8 ng/ml,
p = 0.026 as compared with CD4+
DC). In control experiments, we could not detect IL-2, IFN-
, IL-10,
or IL-13 production in the supernatants of naive
CD4+ or CD8+ Tcells that
had been stimulated for 24 h by anti-CD3 and anti-CD28
mAbs (data not shown).
|
| Discussion |
|---|
|
|
|---|
, and lymphoid-related Ags, such as CD5
and CD90 (Thy1.1). Although freshly isolated CD4+
and CD4- DC exhibit an immature phenotype, both
subsets induce strong proliferation of allogeneic
CD4+ T cells. CD4- DC can
produce large amounts of the proinflammatory cytokines IL-12 and
TNF-
whereas CD4+ cells were found to produce
low amounts of IL-12 but no TNF-
. CD4+ DC
induce strong proliferation and Th1/Th2 and Tc1 differentiation in
CD4+ and CD8+ T cells,
respectively, whereas CD4- DC promote Th1 but
not Th2 differentiation and were poor stimulators of
CD8+ T cells.
Recently, it was shown that a
CD4-SIRP
- subset of DC
in rat intestinal afferent lymph transport apoptotic fragments of
epithelial intestinal cells from the gut to T cell areas of mesenteric
lymph nodes (13). Several data suggest that
CD4-SIRP
- DC in lymph
nodes and spleen represent the same subset. CD4-
DC isolated from both lymph (10) and spleen (in this
report) exhibit a very short half-life in vitro. Moreover,
CD4-/SIRP
- DC isolated
from the spleen (11) and lymph nodes (our unpublished
observations) exhibited an in vitro cytotoxic activity against tumor
cells. It is also likely that CD4+ DC in the
afferent lymph and in the spleen represent the same subset of DC
because in both tissues these cells coexpress SIRP
and Thy1
molecules (this report and Ref. 10). However, CD4 and
SIRP
markers are not always coexpressed on rat DC as, for instance,
Langerhans cells express SIRP
but not CD4 (30). Taken
together, these data suggest that CD4- DC in the
spleen, lymph node, and afferent lymph represent the same subset of DC
in different locations, whereas CD4 expression might be restricted to a
specific subset of DC that traffic from certain tissues to lymph nodes
or the spleen or might be temporally regulated on rat DC. However, we
did not observe CD4, CD5, or SIRP
expression on
CD4- DC upon in vitro culture (data not
shown).
We found that CD4- but not
CD4+ DC produce IL-12 upon CD40L or LPS exposure
although both subsets produce IL-12p40 upon SAC exposure. However, the
fact that IL-12p35 mRNA was strongly up-regulated in stimulated
CD4- but not CD4+ DC
suggest that CD4- DC are the main source of
bioactive IL-12. Moreover, the Toll-like receptor 3 ligand poly(I:C)
(31) induced TNF-
but not IL-12 production in
CD4- DC. These results suggest that spleen DC
subsets differentially respond to a pathogen-associated molecular
pattern and therefore express a different set of Toll-like receptors
(32) as recently reported for human DC subsets
(33). Monocytes and myeloid-derived DC express numerous
Toll-like receptors whereas lymphoid DC and immediate precursors
(preDC2) appear to express a limited set of receptors
(33). To our knowledge, the ontogeny of DC subsets in rats
has not been clearly studied; however, our results do not suggest a
clear myeloid and lymphoid dichotomy of splenic DC subsets.
CD4- DC appear to be a homogenous population of
cells with myeloid-like morphological features and do not express
lymphoid-related Ags. Splenic CD4+ DC appeared
much more heterogeneous regarding their morphology and to a lesser
extent their phenotype. Moreover, both typical lymphoid-related markers
such as CD5 and myeloid-related markers such as SIRP
are expressed
by CD4+ DC. In the murine spleen, two subsets of
DC were initially described by Shortmans group (34), one
CD8- and one CD8+. More
recently, the CD8- subset was shown to contain
CD4+ and CD8- DC
(23). Because CD8 is not expressed on rat splenic DC, it
is not possible to make a direct link between mouse and rat DC subsets.
However, the poor viability and spontaneous maturation, the large size,
the high IL-12 production, and the low capacity to stimulate
CD8+ T cells of the CD4-
subset of DC are properties reminiscent of mouse splenic
CD8+ DC (6, 35, 36). Finally, the
fact that total OX62+ DC as well as sorted
CD4+ and CD4- DC subsets
produce low amounts of IFN-
upon viral infection suggest that rat
plasmacytoid DC do not express OX62 or CD103.
Whether CD4+ T cell differentiation is influenced
by specific DC subsets or by the maturation stage of DC remains
controversial (4, 26, 37). As previously reported in
humans (1), our study shows the existence of a high
IL-12-producing DC subset in rats
(CD4-SIRP-) that induce
Th1 responses and exhibit a myeloid-like morphology. Although the
production of both IFN-
and IL-10 by CD4+ T
cells stimulated with CD4- DC is reminiscent of
T regulatory type 1 cells previously described in mice
(38), the associated high production of IL-2 rather
suggests a Th1 differentiation, a phenotype consistent with the high
production of IL-12 by CD4- DC. In contrast to
CD4- DC,
CD4+SIRP+ DC induced
CD4+ T cells to produce IL-13 but also large
amounts of IFN-
and IL-2, despite a low production of IL-12,
suggesting IL-12-independent Th1-priming capacity. However, it is not
known whether IL-13, IL-2, and IFN-
are produced by the same Th0
cells or by differentiated Th1 and Th2 cells. It is also possible that
CD4+ DC are actually a heterogeneous population
of DC with different Th cell-priming capacities.
A recent study by Huang et al. (13) suggested that in the
steady state, rat CD4- DC may play a role in the
maintenance of self-tolerance by transporting apoptotic tissue cells
and presenting self-peptides in a tolerogenic fashion in draining lymph
nodes (14). Although freshly isolated
CD4- splenic DC exhibit an immature phenotype, a
maturation, probably due to the cell extraction procedure, occurs upon
culture. Therefore, results obtained from in vitro studies, such as
ours, performed with DC extracted from lymphoid organs, do not fully
reflect the actual role of DC in their in vivo steady state. Indeed, it
has been postulated that steady-state immature DC may tolerize and
mature DC may immunize (39). Our results indicate that
both immature and mature CD4- DC are poor
stimulators of CD8+ T cells in our experimental
conditions. However, the fact that CD40 stimulation or GM-CSF increased
their capacity to stimulate CD8+ T cells suggest
that, in vivo, CD4- DC might be able to prime
CD8+ T cells providing that an additional
maturation signal or help from CD4+ T cells is
present. In contrast, CD4+ DC are potent
stimulators of CD8+ T cells even in the absence
of maturation signal or CD4+ T cells. The
mechanisms underlying this different CD8+ T cell
stimulatory capacity between CD4+ and
CD4- DC are currently under investigation.
Although CD4- DC exhibit a potent cytotoxic
activity against tumor cells in vitro, they are unable to induce
cytolysis in resting or activated T cells (11), suggesting
that this activity is not involved in the low capacity of
CD4- DC to stimulate CD8+
T cells. It is interesting to note that CD4-
spleen DC express high levels of CD200, a molecule that has recently
been involved in T cell tolerance (40).
SIRP
+ and SIRP
- DC
subsets have been described in bovine afferent lymph (41).
Similar to rat DC, bovine SIRP
- DC were found
to be poor stimulators of CD8+ T cell responses,
as compared with SIRP
+ DC, and this difference
was related to the lack of IL-1 secretion by
SIRP
- DC (41).
In conclusion, we have described the phenotype of two splenic DC subsets in rats and characterized, for the first time, their cytokine production and their capacity to induce CD4+ and CD8+ T cell differentiation. As previously described in humans and mice, we have identified a DC subset in rats that lack CD4 expression and that produce high levels of IL-12 and induce Th1 differentiation in vitro. We have recently shown that the same subset of DC also exhibit a cytotoxic activity against selected tumor cells in vitro (11). CD4- DC might therefore directly bridge innate and adaptive immune responses against tumors by directly killing tumor cells and inducing Th1 responses to tumor Ags. Finally, our study will be useful to decipher the complex role of DC subsets in rat models of autoimmunity, tumor, and transplantation immunity as well as tolerance.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Régis Josien, Institut National de la Santé et de la Recherche Médicale, Unité 437, Centre Hospitalier Régional Universitaire de Nantes, 30 Boulevard Jean Monnet, 44093 Nantes, Cedex 1, France. E-mail address: rjosien{at}nantes.inserm.fr ![]()
3 Abbreviations used in this paper: DC, dendritic cell; CD40L, CD40 ligand; SAC, Staphylococcus aureus Cowan I; SIRP, signal regulatory protein; HPRT, hypoxanthine phosphoribosyltransferase; TAI, transcript accumulation index; Ct, cycle threshold. ![]()
Received for publication December 20, 2001. Accepted for publication June 21, 2002.
| References |
|---|
|
|
|---|
/
-producing cells link innate and adaptive immunity. J. Exp. Med. 192:219.
+ and CD8
- subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J. Exp. Med. 189:587.
-positive dendritic cells from a common myeloid progenitor. Science 290:2152.
E1 and
E2 subunits: tissue expression reveals phenotypic similarities between intraepithelial lymphocytes and dendritic cells in lymph. [Published erratum appears in 1998 Eur. J. Immunol. 28:3891.]. Eur. J. Immunol. 27:3070.[Medline]
B by Toll-like receptor 3. Nature 413:732.[Medline]
, and IFN-
by mouse dendritic cell subsets. J. Immunol. 166:5448.
secretion. J. Leukocyte Biol. 69:271.This article has been cited by other articles:
![]() |
A.-S. Dugast, T. Haudebourg, F. Coulon, M. Heslan, F. Haspot, N. Poirier, R. Vuillefroy de Silly, C. Usal, H. Smit, B. Martinet, et al. Myeloid-Derived Suppressor Cells Accumulate in Kidney Allograft Tolerance and Specifically Suppress Effector T Cell Expansion J. Immunol., June 15, 2008; 180(12): 7898 - 7906. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ouabed, F.-X. Hubert, D. Chabannes, L. Gautreau, M. Heslan, and R. Josien Differential Control of T Regulatory Cell Proliferation and Suppressive Activity by Mature Plasmacytoid versus Conventional Spleen Dendritic Cells J. Immunol., May 1, 2008; 180(9): 5862 - 5870. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nicolas, D. Cathelin, N. Larmonier, J. Fraszczak, P.-E. Puig, A. Bouchot, A. Bateman, E. Solary, and B. Bonnotte Dendritic Cells Trigger Tumor Cell Death by a Nitric Oxide-Dependent Mechanism J. Immunol., July 15, 2007; 179(2): 812 - 818. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Yrlid, V. Cerovic, S. Milling, C. D. Jenkins, J. Zhang, P. R. Crocker, L. S. Klavinskis, and G. G. MacPherson Plasmacytoid Dendritic Cells Do Not Migrate in Intestinal or Hepatic Lymph J. Immunol., November 1, 2006; 177(9): 6115 - 6121. [Abstract] [Full Text] [PDF] |
||||
|
|