HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Voisine, C. Articles by Josien, R. Search for Related Content PubMed PubMed Citation Articles by Voisine, C. Articles by Josien, R.

Two Phenotypically Distinct Subsets of Spleen Dendritic Cells in Rats Exhibit Different Cytokine Production and T Cell Stimulatory Activity¹

Institut National de la Santé et de la Recherche Médicale, Unité 437, Nantes, France and Institut de Transplantation et de Recherche en Transplantation, Nantes, France

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
We recently reported that splenic dendritic cells (DC) in rats can be separated into CD4⁺ and CD4^- subsets and that the CD4^- subset exhibited a natural cytotoxic activity in vitro against tumor cells. Moreover, a recent report suggests that CD4^- DC could have tolerogenic properties in vivo. In this study, we have analyzed the phenotype and in vitro T cell stimulatory activity of freshly isolated splenic DC subsets. Unlike the CD4^- subset, CD4⁺ splenic DC expressed CD5, CD90, and signal regulatory protein molecules. Both fresh CD4^- and CD4⁺ DC displayed an immature phenotype, although CD4⁺ cells constitutively expressed moderate levels of CD80. The half-life of the CD4^-, but not CD4⁺ DC in vitro was extremely short but cells could be rescued from death by CD40 ligand, IL-3, or GM-CSF. The CD4^- DC produced large amounts of the proinflammatory cytokines IL-12 and TNF- and induced Th1 responses in allogeneic CD4⁺ T cells, whereas the CD4⁺ DC produced low amounts of IL-12 and no TNF-, but induced Th1 and Th2 responses. As compared with the CD4⁺ DC that strongly stimulated the proliferation of purified CD8⁺ T cells, the CD4^- DC exhibited a poor CD8⁺ T cell stimulatory capacity that was substantially increased by CD40 stimulation. Therefore, as previously shown in mice and humans, we have identified the existence of a high IL-12-producing DC subset in the rat that induces Th1 responses. The fact that both the CD4⁺ and CD4^- DC subsets produced low amounts of IFN- upon viral infection suggests that they are not related to plasmacytoid DC.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Dendritic cells (DC)³ are a heterogeneous population of professional APC (1). Human blood contains a subset of CD11c⁺ DC, also called DC1, thought to be of myeloid origin and a subset of CD11c^- DC, also called DC2, thought to be of lymphoid origin (2). Beyond their distinct cell surface phenotype, these DC subsets exhibit different functions. DC1 can produce large amounts of IL-12 upon exposure to specific pathogens or activated T cells and drive the differentiation of Th1 cells (2). DC2 produce large amounts of type I IFNs upon exposure to virus (3) and drive the differentiation of Th2 cells (2). However, the Th cell differentiation capacity of both DC1 (4) and DC2 (2, 5) seems to depend on the nature of the stimulus. Murine DC subsets have also been described in lymphoid organs (1). CD8⁺CD4^- DC produce IL-12 and induce Th1 cell differentiation, whereas CD8^-CD4^- or CD4⁺ DC do not produce IL-12 and promote Th2 differentiation (6, 7). The precise origin of these subsets in vivo is not clear as both common myeloid and lymphoid progenitors can give rise to CD8^- and CD8⁺ DC in vivo (8, 9).

Different subsets of DC have also been described in rats. MacPherson and colleagues (10) first described that a CD4⁺ and a CD4^- subset of DC can be purified from afferent lymph and more recently, we described similar subsets in the spleen (11). The fact that CD4⁺ DC isolated from both the afferent lymph and spleen coexpress signal regulatory protein (SIRP) (CD172a), which was recently found to be the target of the OX41 mAb (12), and CD90 suggest that they represent the same subset of DC. Interestingly, both subsets were also found in lymph nodes but in different proportions (11). Previous studies have shown that CD4⁺ DC were better stimulators of CD4⁺ and CD8⁺ T cells than the CD4^- cells in allogeneic MLR or in soluble Ag presentation assays (10). However, it is not known whether this difference is related to different costimulatory molecule expression or cytokine production by these DC subsets. More recently, the CD4^- subset of rat DC has been shown to exhibit two new and unusual functions. Huang et al. (13) have shown that CD4^-SIRP^- DC constitutively migrated through afferent lymph and, more importantly, transported phagocytosed fragments of apoptotic gut epithelial cells to the T cell area of mesenteric lymph nodes. It has therefore been suggested that this pathway of self-Ag transport could be involved in the maintenance of self-tolerance (14). In addition, we found that CD4^-SIRP^- DC in spleen (11) but also in lymph nodes (B. Trinité and R. Josien, unpublished observations) exhibited a potent cytotoxic activity in vitro against selected tumor cell lines such as YAC-1 and Jurkat cells. Several reports have now confirmed that myeloid human DC also exhibited such a cytolytic function (15, 16, 17). Whether this function plays a role in vivo in unknown; however, so far we have been unable to detect any cytotoxic activity of DC against normal cells in general or in particular against T cells.

Several arguments therefore suggest that the CD4^- subset of DC in rats might be involved in T cell tolerance. The aim of this study was to analyze in detail the phenotype of splenic DC subsets and to assess their proinflammatory cytokine production and their T cell stimulatory activity in terms of Th and CD8⁺ T cell differentiation. We found that both CD4⁺ and CD4^- splenic subsets exhibited an immature phenotype in spleen but induced a strong proliferative response in resting CD4⁺ allogeneic T cells. Freshly isolated CD4^- DC were the main producers of IL-12p40 and drove potent Th1 cell differentiation, whereas CD4⁺ DC induced nonpolarized Th cell differentiation. In contrast, as compared with CD4⁺ DC, the CD4^- subset was a poor stimulator of allogeneic CD8⁺ T cells.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Animals

Sprague Dawley and Lewis rats were obtained from the Centre d’Elevage Janvier (Le Genest Saint-Isles, France) and were used when 6–10 wk old.

Reagents

The CD40 ligand (CD40L)-human CD8 fusion molecule (supernatant of transfected Sf9 insect cells) was kindly provided by Dr. Y. Choi (Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, Philadelphia, PA). Poly(I:C) and LPS were obtained from Sigma-Aldrich, (St. Louis, MO). Recombinant rat IFN- was obtained from R&D Systems (Minneapolis, MN). Recombinant rat IFN- and TNF- were obtained from Serotec (Oxford, U.K.), recombinant rat IL-3 was from PeproTech (Rocky Hill, NJ), and Staphylococcus aureus Cowan I (SAC) strain Pansorbin cells were purchased from Calbiochem (San Diego, CA). GM-CSF (supernatant of COS cells transfected with murine GM-CSF) was used at a dilution of 1/1000.

Monoclonal Abs

The following mouse anti-rat mAbs obtained from the European Collection of Cell Culture (Salisbury, U.K.) were used in cytofluorometric studies and cell sorting after coupling to FITC, biotin, or PE (Bioatlantic, Nantes, France): OX6 (MHC class II RT1B), OX17 (MHC class II RT1D), OX18 (MHC class I), W3/25 (CD4), OX8 (CD8), R7.3 (TCR), V65 (TCR), OX7 (Thy1.1, CD90), OX19 (CD5), OX34 (CD2), OX33 (CD45R on B cells), OX42 (CD11b/c), integrin 2 chain (CD18), OX62 (integrin E2 chain or CD103), OX85 (CD62L), OX49 (CD44), ED1 (CD68), ED2, ED3 (sialoadhesin), OX41 (SIRP), OX1 and OX30 (CD45), OX22 (CD45RC), OX2 (CD200) and OX39 (CD25, IL-2R -chain). FITC-conjugated anti-CD3 (clone G4.18), anti-CD11a (clone WT.1), anti-B7-2 (clone 24F), anti-B7-1 (clone 3H5), and hamster anti-mouse-CD40 (cross-reacting with rat CD40) mAbs were purchased from BD PharMingen (San Diego, CA). FITC anti-NKRP1A (CD161a) and purified anti-ICAM (CD54) were purchased from Serotec.

Cell preparation

DC. Spleens were minced and digested in 2 mg/ml collagenase D (Roche Diagnostics, Meylan, France) in RPMI 1640/1% FCS for 30 min at 37°C. EDTA at 10 mM was added during the last 5 min and the cell suspension was then pipetted up and down several times and filtered. Cells were washed once in PBS/2 mM EDTA/1% FCS and low-density cells were obtained after centrifugation on a 14.5% Nycodenz (Nycomed, Oslo, Norway) gradient as previously described (18). Cells were then washed once and incubated with a saturating concentration of biotinylated OX62 mAb at 4°C for 20 min. After two washes, cells were mixed with streptavidin-conjugated MACS microbeads following the manufacturer’s instructions (Miltenyi Biotec, Paris, France). Positive selection was performed on MiniMACS type-positive selection columns (Miltenyi Biotec).

T cells. CD4⁺ and CD8⁺ T cells were prepared from lymph node cells by negative selection of class II⁺, Ig⁺, NKR-P1A⁺, and CD8⁺ or CD4⁺ cells, respectively, with specific mAbs followed by antimouse IgG-coated magnetic beads (Dynal, Oslo, Norway). Purity was routinely 98 and 90% for CD4⁺ and CD8⁺ T cells, respectively.

Flow cytometry and cell sorting

For cytofluorometric analyses, 5 x 10⁴ cells were incubated with PE-conjugated OX6 or W3/25 mAb along with another FITC-conjugated mAb for 20 min at 4°C. Cells were washed twice and analyzed on a FACSCalibur (BD Biosciences, Mountain View, CA). For cell sorting of CD4⁺ and CD4^- subsets of splenic DC, OX62⁺ cells were incubated with OX6-PE and W3/25-FITC-conjugated mAbs and sorted using a FACSVantage (BD Biosciences).

May-Grünwald-Giemsa coloration

Sorted DC (2 x 10⁵) were cytospun onto a glass slide (800 rpm, 4 min) and air dried for 1–2 h. Cells were then stained using a classic Giemsa coloration.

Mixed leukocyte reaction

Increasing numbers of allogeneic DC were cultured with 5 x 10⁴ purified CD4⁺ or CD8⁺ T cells in round-bottom 96-well plates in a final volume of 200 µl of IMDM (Sigma-Aldrich) supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 1 mM sodium pyruvate, 1 mM HEPES, 5 x 10^-5 M 2-ME, and 1% normal rat serum for 4 days at 37°C in 5% CO₂, and for the last 8 h in the presence of 0.5 µCi [³H]TdR (Amersham, Les Ulis, France). The cells were then harvested onto glass fiber filters and [³H]TdR incorporation was measured using a standard scintillation procedure (Packard Instrument, Meriden, CT).

Cytokine production assays

Stimulation of isolated DC for cytokine production. Sorted splenic rat DC (1.25 x 10⁵ cells) were cultured in 1 ml RPMI 1640 medium (Sigma-Aldrich), supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 1 mM sodium pyruvate, 5 x 10^-5 M 2-ME, and 10% FCS in 24-well plates. After 24 h, supernatants were collected and stored until analysis at -70°C. Stimuli were used at the following concentrations: CD40L, 1/300 dilution of the supernatant; LPS, 0.5 µg/ml; poly(I:C), 50 µg/ml; SAC, 20 µg/ml; IFN-, 20 U/ml; and inactivated influenza virus (kindly provided by F. Brière, Dardilly, France).

T cell cytokine production. A total of 2 x 10⁴ allogeneic sorted DC were cultured with 1 x 10⁵ purified CD4⁺ or CD8⁺ T cells in a final volume of 200 µl of IMDM with 1% rat serum. After 4 days of stimulation, the supernatant was collected and stored for cytokine assays. Cells were then washed and viable T cells were immediately restimulated in an anti-CD3 (5 µg/ml)-coated plate in the presence of anti-CD28 mAb (2.5 µg/ml) at a concentration of 2 x 10⁵ cells/ml. Twenty-four hours after restimulation, supernatants were collected and frozen until further use.

ELISA test. The amount of IL-2, IFN-, IL-10, and TNF- in the supernatants was measured using a rat ELISA kit (OptEIA set; BD PharMingen) according to the manufacturer’s instructions. Rat IL-13 and IL-12p40 were detected using a BioSource International (Fleurus, Belgium) ELISA kit according to the manufacturer’s instructions. IL-4 measurement was performed using a two-site sandwich ELISA. Anti-IL-4 hybridoma OX81 was obtained from the European Collection of Cell Culture, biotinylated anti IL-4 mAb (clone B11-3) and recombinant rat IL-4 were purchased from BD PharMingen. IFN- was detected using an ELISA kit specific for both mouse and rat IFN- (PBL Biomedical Laboratories, New Brunswick, NJ).

RT-PCR

Total RNA was extracted from 5 x 10⁵ resting or stimulated FACS-sorted DC using TRIzol (Life Technologies, Paisley, U.K.) and reverse transcribed into cDNA as described previously (19).

Nonquantitative PCR. PCR primer sequences used were: rCD4 forward, CTTTCTCCACGCACAGCCTA; rCD4 reverse, TGCCTTCCATCTCAACTCTCC, resulting in a 218-bp PCR product; rCD5 forward, GTGCGGTCCTCTGATCTACAAG, rCD5 reverse, GGCTGGCTGTACTCATTGTCC, resulting in a 180-bp PCR product; rSIRP forward, GCATTTCACAGACAACAGGGAT; and rSIRP reverse, GCAGCCATCAGCAGGACTACT, resulting in a 273-bp PCR product. The hypoxanthine phosphoribosyltransferase (HPRT) gene was also amplified as a control. PCR amplification consisted of an initial denaturation step at 94°C for 1 min, followed by 27 cycles at 94°C for 30 s, annealing for 30 s, and extension at 72°C for 30 s in each cycle. PCR products were electrophoresed on an ethidium bromide-stained 1% agarose gel.

Quantitative RT-PCR. Real-time quantitative PCR was performed using an Applied Biosystems GenAmp 7700 Sequence Detection System with the SYBR Green PCR Core Reagent (Applied Biosystems, Foster City, CA). The following oligonucleotides were used: rIL-12p40 forward, GAAACAGTGAACCTCACCTG; rIL-12p40 reverse, TGCTTCACACTTCAGGAAAGT; rIL-12p35 forward, TGATGATGACCCTGTGCCTT; rIL-12p35 reverse, GCATGGAGCAGGATACAGAGC; and as a housekeeping gene HPRT forward, GCGAAAGTGGAAAAGCCAAGT; and HPRT reverse, GCCACATCAACAGGACTCTTGTAG. Total cDNA was amplified in 25 µl of PCR mix containing 300 nM of each primer; 200 µM dATP, dGTP, and dCTP; 400 µM dUTP; 3 mM MgCl₂; 0.25 U of uracil-N-glycosylase; 0.625 U of AmpliTaq Gold DNA polymerase, and 2.5 µl of the 10x SYBR Green buffer. The reaction started with a step of 2 min at 55°C to allow the uracil-N-glycosylase to eliminate putative PCR contaminants, followed by 10 min at 95°C to activate the AmpliTaq Gold DNA polymerase, and then 40 cycles each consisting of 15 s at 95°C and 1 min at 60°C. The real-time PCR data were plotted as the R_n fluorescence signal vs the cycle number. The Applied Biosystems 7700 sequence detection software calculates the R_n using the formula: R_n = (R_n⁺) - (R_n^-), where R_n⁺ is the fluorescence signal of the product at any given time and R_n^- is the mean fluorescence signal during cycles 3–3 and referred to as the baseline. The Ct value is defined as the cycle number at which the R_n crosses a threshold. The threshold is set above the background fluorescence to intersect the exponential portion of the amplification curve of a positive reaction. The Ct is inversely proportional to the log amount of template in the PCR. HPRT was used as an endogenous control gene to normalize for RNA amounts. The transcript accumulation index (TAI) is expressed as the fold change between a given sample (Q) and a calibrator (CB), where the calibrator represents the 1-fold expression of each gene. The TAI is calculated as: TAI = 2^-Ct, where Ct = (Ct_Target - Ct_HPRT)_Q - (Ct_Target - Ct_HPRT)_CB. A prerequisite for using the 2^-Ct method is to check that the efficacy of each gene-specific PCR is >96%, as determined by the slope of the curve Ct = f(log(target DNA)).

Statistical analyses

Statistical analyses were performed using Student’s t test.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Purification procedure

DC were isolated from rat spleens by positive selection using the OX62 mAb that was previously shown to recognize the rat E2 integrin chain or CD103 (20, 21). Of note, CD103 was recently shown to be expressed by CD8⁺ spleen DC in mice (22). We found that >85% of non-B class II-positive cells in low-density spleen cells express CD103 (data not shown); however, we were able to identify an OX62^high and an OX62^low population (Fig. 1A). As shown below, these two subsets correspond to the CD4^- and CD4⁺ subsets of DC, respectively. Since the positive selection method we used tended to select high- rather than low-expressing cells, the relative percentage of CD4⁺ and CD4^- DC after selection of OX62 cells that we previously described (11) did not actually reflect in vivo settings. Indeed, the CD4^- DC:CD4⁺ DC ratio was roughly 1:1 in low-density spleen cells as compared with 3:1 to 4:1 in sorted OX62⁺ cells (Fig. 1B). These OX62-positive cells were negative for TCR and are therefore DC (21). This positive selection method avoids the classical step of overnight culture that allows DC to mature in vitro and therefore dramatically modify their cell surface phenotype and function. The yield was 3–5 x 10⁶ OX62-positive cells per spleen with a purity of 90%.

View larger version (33K): [in this window] [in a new window]   FIGURE 1. Two subset of OX62+ splenic DC. Spleen fragments were digested in collagenase and low-density cells were harvested. A, B cells, T cells, and macrophages were depleted by magnetic beads and remaining cells were stained with OX6-FITC, W3/25-PE, and OX62-biotin followed by streptavidin-Tri-Color. The dot plots represents the expression of CD4 and OX62 on class II-positive cells (gated). Note the similar percentage of OX62highCD4- and OX62lowCD4+ DC in low-density cells and therefore in vivo. B, OX62-positive DC were positively selected using biotinylated OX62 and magnetic beads (Miltenyi Biotec) and stained with W3/25-PE and streptavidin-Tricolor. OX62 expression levels are lower on sorted cells than on low-density cells because the streptavidin binding sites are already occupied by streptavidin microbeads. Positive selection of OX62+ DC led to an artificial increase in the OX62highCD4- DC percentage.

As we have previously shown, two subsets of splenic DC can be identified in rats based on their expression of the CD4 molecule (11). Similar subsets have been previously described by others in afferent lymph (10). The phenotype of these subsets is described in Table I. We found that, unlike in mice, no splenic DC in rats express CD8. The CD4⁺ subset of splenic DC coexpressed CD5 and SIRP and also exhibited high levels of CD90 (Thy1.1), whereas CD4^- cells were negative for CD5 and SIRP but expressed low levels of CD90. CD4⁺ DC expressed slightly higher levels of NKR-P1A (CD161A), CD11c, class I, and lower levels of the OX62 integrin than CD4^- DC, whereas both subsets expressed similar levels of CD11a and CD11b. Both subsets were negative for the macrophage markers ED2 and sialoadhesin (ED3). We found that CD4^- DC expressed high levels of the OX2 (CD200) molecule whereas CD4⁺ stained weakly for this Ag. This is, to our knowledge, the first description of a potentially useful marker for rat CD4^- DC. Finally, we did not observe significant changes in the expression of CD4, CD5, and SIRP on splenic DC subsets after 3 days of in vitro culture (data not shown)

View larger version (39K): [in this window] [in a new window]   FIGURE 2. Freshly isolated splenic DC subsets exhibit an immature phenotype and mature spontaneously in vitro. Freshly isolated and overnight cultured OX62+ cells were labeled with directly conjugated MHC class II-, B7-1-, B7-2-, CD40-, Thy-1, or CD25- and CD4-specific mAbs and analyzed by FACS. Histograms represent the relative expression of indicated Ags on gated CD4+ (upper) and CD4- (lower) splenic DC.

FACS analysis revealed that CD4^- DC were larger than CD4⁺ cells (data not shown). This was confirmed when cytospun, freshly isolated splenic DC subsets were examined after Giemsa staining (Fig. 3). CD4^- DC exhibited a relative homogenous myeloid-related morphology with a large and irregularly shaped nucleus and a large cytoplasm containing inclusions (Fig. 3A). Morphological features of CD4⁺ DC were much less homogenous and very different from the CD4^- subset (Fig. 3B). Most CD4⁺ DC had a small and regular nucleus and a small cytoplasm that did not contain large inclusions. Fine and long dendrites could be observed on some of the CD4⁺ DC. A small percentage of CD4⁺ splenic DC exhibited a morphology similar to CD4^- cells and, finally, a few cells had an intermediate morphology.

View larger version (58K): [in this window] [in a new window]   FIGURE 3. Morphology of splenic DC subsets. Freshly isolated OX62+ cells were stained with W3/25-FITC and OX6-PE. CD4+class II+ and CD4-class II + cells were then sorted immediately by FACS. Cells were then cytopsun onto a glass slide, air dried, and stained using Giemsa coloration (original magnification, x400).

CD4, CD5, and SIRP mRNA are expressed in CD4⁺ splenic DC

As previously shown in mice, several surface markers that are found on the surface of DC are actually not expressed by DC but rather acquired from surrounding cells (23, 24). We therefore analyzed the expression of CD4, CD5, and SIRP mRNA in CD4⁺ splenic DC by RT-PCR. As shown in Fig. 4, mRNA for CD4, CD5, and SIRP was expressed in CD4⁺ DC. As expected, CD4 and SIRP mRNA were not detected in CD4^- DC; however, a weak signal for CD5 mRNA was observed.

View larger version (14K): [in this window] [in a new window]   FIGURE 4. CD4, CD5, and SIRP mRNA expression in CD4+ and CD4- splenic DC subsets. PCR for CD4, CD5, and SIRP was performed on cDNA from FACS-sorted CD4+ and CD4- splenic DC as described in Materials and Methods. Similar results were obtained in three independent experiments.

It is now well established that the duration of DC-T cell interaction and therefore of DC half-life is an important parameter of the T cell activation process (25). Therefore, specific functions of DC subsets might be related to their survival. We thus examined the in vitro survival of CD4⁺ and CD4^- splenic DC subsets. After 3 days of culture, >80% of CD4^- DC were dead, suggesting a very short spontaneous half-life (Fig. 5). In three independent experiments, a substantial percentage of CD4^- DC could be rescued from programmed cell death by CD40 cross-linking, IL-3 or GM-CSF (p < 0.05 as compared with untreated cells) but not by LPS, poly(I:C), IFN-, or TNF-. In contrast, roughly two-thirds of CD4⁺ splenic DC were still alive after 3 days of culture (p < 0.01 as compared with CD4^- DC) and we could not observe any consistent effect of soluble CD40L, LPS, poly(I:C), IL-3, GM-CSF, IFN-, or TNF- on the survival of this DC subset (Fig. 5).

View larger version (34K): [in this window] [in a new window]   FIGURE 5. In vitro survival of splenic DC subsets. A total of 2.5 x 104 FACS-sorted DC were cultured in duplicate for 3 days in 100 µl culture medium in the absence or presence of CD40L (1/300 dilution of culture supernatant), GM-CSF (1/1000 dilution), IL-3 (100 ng/ml), TNF- (500 U/ml), IFN- (500 U/ml), LPS (0.5 µg/ml), or poly(I:C) (50 µg/ml). Live cells were then counted using eosin exclusion. Similar results were obtained in three independent experiments.

Differential production of IL-12p40 and TNF- by splenic DC subsets

Previous reports have shown that human and mouse DC subsets differentially influence the nature of the Th cell response (1). This was in part related to the capacity of DC subsets to produce IL-12 (26). We therefore examined the production of the IL-12p40 subunit by rat splenic DC subsets. High levels of IL-12p40 were detected in the supernatant of CD40L (range, 54–270 pg/ml in four independent experiments)- and to a lesser extent LPS-stimulated (range, 44–167 pg/ml) CD4^- DC, whereas poly(I:C) did not induce IL-12p40 production (Fig. 6). In contrast, CD4⁺ DC did not produce detectable IL-12p40 in response to CD40 cross-linking, LPS, or poly(I:C) stimulation in the same experiments. However, stimulation of DC with SAC plus IFN- induced variable but statistically comparable amounts of IL-12p40 production in both CD4^- and CD4⁺ spleen DC (CD4⁺ DC, range, 46–235 pg/ml; CD4^- DC, range, 18–482 pg/ml, p = 0.4). The expression of IL-12p40 and p35 chain mRNA was also analyzed in fresh and stimulated DC subsets by real-time quantitative RT-PCR (Table II). Both chains were strongly up-regulated in SAC plus IFN-- and to a lesser extent LPS- or CD40L-stimulated CD4^- DC, indicating that CD4^- DC have the capacity to produce bioactive IL-12p70. In CD4⁺ DC, IL-12p40 mRNA was up-regulated by SAC plus IFN- but not reproducibly by CD40L, a finding consistent with IL-12p40 ELISA. However, unlike in CD4^- DC, IL-12p35 mRNA was not significantly up-regulated upon stimulation of CD4⁺ DC.

View larger version (10K): [in this window] [in a new window]   FIGURE 6. Cytokine production by splenic DC subsets in vitro. CD4+ and CD4- splenic DC (1.25 x 105 cells) were cultured in 1 ml complete RPMI 1640 medium/10% FCS, in 24-well plates at 37°C in 5% CO2 in the absence or presence of CD40L (1/300 dilution of supernatant), LPS (0.5 µg/ml), poly(I:C) (50 µg/ml), or SAC (20 µg/ml) plus IFN- (20 U/ml). After 24 h of culture, supernatants were collected, and IL-12p40, TNF-, IL-10, and IFN- production was measured by ELISA. Results of one experiment representative of three to four are shown. Note that the amounts of IL-10 induced by SAC-IFN- was highly variable from one experiment to another but not statistically significant between CD4- (range, 0–108 pg/ml in three experiments) and CD4+ DC (0–93 pg/ml).

Differential T cell stimulatory activity of fresh and mature splenic DC subsets in MLR

The T cell stimulatory activity of splenic DC subsets was analyzed in allogeneic MLR. We previously reported that, at high DC:T cell ratios, CD4^- DC were slightly less potent APC in MLR than CD4⁺ DC (11). Similar experiments were repeated using more physiological conditions, i.e., using normal rat serum- instead of FCS-containing culture medium. In these conditions, CD4⁺ DC subsets induced a similar or slightly higher proliferation of allogeneic naive CD4⁺ T cells than CD4^- DC (Fig. 7). However, a major difference between CD4⁺ and CD4^- DC subsets was the extremely low capacity of CD4^- DC to induce allogeneic naive CD8⁺ T cell proliferation as compared with CD4⁺ DC (Fig. 7).

View larger version (24K): [in this window] [in a new window]   FIGURE 7. Allostimulatory activity of fresh CD4+ and CD4- splenic DC subsets in MLR. Increasing numbers of FACS-sorted CD4+ or CD4- splenic DC were cultured in complete IMDM supplemented with 1% normal rat serum with 1 x 105 purified allogeneic CD4+ or CD8+ T cells in triplicate in round-bottom 96-well plates for 4 days. T cell proliferation was assessed by [3H]TdR incorporation. SD were always <15% and are not represented. Similar results were obtained in four independent experiments.

View larger version (59K): [in this window] [in a new window]   FIGURE 8. Allostimulatory activity of mature CD4+ and CD4- splenic DC subsets in MLR. FACS-sorted CD4+ and CD4- spleen DC (2 x 104) were used either fresh or after overnight culture in the absence or presence of soluble CD40L as stimulator cells in MLR with purified allogeneic CD4+ (A) or CD8+ (B) T cells (1 x 105) as responders. Cultured DC were extensively washed and viable cells were counted before mixing with T cells. Cultures were performed in complete IMDM supplemented with 1% normal rat serum in triplicate in round-bottom 96-well plates for 4 days. T cell proliferation was assessed by [3H]TdR incorporation. Similar results were obtained in three independent experiments.

We next analyzed the capacity of splenic DC subsets to induce CD4⁺ and CD8⁺ T cell differentiation in vitro. Freshly isolated and unstimulated CD4⁺ and CD4^- DC were cultured with allogeneic CD4⁺ or CD8⁺ lymph node T cells at a DC:T ratio of 1:5. Four days later, T cells were restimulated with anti-CD3 and anti-CD28 mAbs and supernatants were harvested after 24 h for cytokine analyses. As shown in Fig. 9A, both CD4^- and CD4⁺ DC promoted the differentiation of CD4⁺ T cells consistently producing large amounts of IFN- (mean ± SD of five independent experiments: CD4⁺ DC, 70.1 ± 19.5 ng/ml; CD4^- DC, 58.2 ± 19.3, NS) and IL-2 (CD4⁺ DC, 8.9 ± 5.5 ng/ml; CD4^- DC, 9.7 ± 6.1, NS) (Th1). The amounts of IL-10 produced by CD4⁺ T cells upon restimulation were quite variable (ranges, 47–15,000 pg/ml for CD4⁺ DC, 54–10,700 for CD4^- DC in five independent experiments) but not significantly different between supernatants of CD4⁺ or CD4^- DC-stimulated T cells. Although IL-4 was never detected, substantial amounts of IL-13 (250 ± 167 pg/ml), another typical Th2 cytokine, were produced by CD4⁺ T cells that had been stimulated by CD4⁺ DC. In contrast, CD4^- DC were unable to promote the differentiation of IL-13-producing Th cells (Th2). CD4⁺ splenic DC promoted the differentiation of CD8⁺ T cells producing large amounts of IFN- (49 ± 35 ng/ml; Fig. 9B). In contrast and according to the inability of CD4^- DC to induce strong proliferation of allogeneic CD8⁺ T cells (Fig. 7), these CD8⁺ T cells produced very low amounts of IFN- upon in vitro restimulation as compared with CD4⁺ DC–stimulated CD8⁺ T cells (4.2 ± 8 ng/ml, p = 0.026 as compared with CD4⁺ DC). In control experiments, we could not detect IL-2, IFN-, IL-10, or IL-13 production in the supernatants of naive CD4⁺ or CD8⁺ Tcells that had been stimulated for 24 h by anti-CD3 and anti-CD28 mAbs (data not shown).

View larger version (47K): [in this window] [in a new window]   FIGURE 9. The influence of splenic DC subsets on allogeneic Th and CD8+ T cells differentiation in vitro. Freshly isolated CD4+ () or CD4- () splenic DC were cultured with purified allogeneic CD4+ (A) or CD8+ (B) T cells at a ratio of 5:1 for 4 days in complete RPMI 1640 supplemented with 1% normal rat serum in 24-well plates. Viable T cells were then harvested and immediately restimulated on anti-CD3-coated plates in the presence of anti-CD28 mAb at 1 x 105/ml for 24 h. The production of IL-2, IFN-, IL-10, and IL-13 was assessed by ELISA. Similar results were obtained in five independent experiments except for IL-10 whose production was highly variable from one experiment to another.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

Recently, it was shown that a CD4^-SIRP^- subset of DC in rat intestinal afferent lymph transport apoptotic fragments of epithelial intestinal cells from the gut to T cell areas of mesenteric lymph nodes (13). Several data suggest that CD4^-SIRP^- DC in lymph nodes and spleen represent the same subset. CD4^- DC isolated from both lymph (10) and spleen (in this report) exhibit a very short half-life in vitro. Moreover, CD4^-/SIRP^- DC isolated from the spleen (11) and lymph nodes (our unpublished observations) exhibited an in vitro cytotoxic activity against tumor cells. It is also likely that CD4⁺ DC in the afferent lymph and in the spleen represent the same subset of DC because in both tissues these cells coexpress SIRP and Thy1 molecules (this report and Ref. 10). However, CD4 and SIRP markers are not always coexpressed on rat DC as, for instance, Langerhans cells express SIRP but not CD4 (30). Taken together, these data suggest that CD4^- DC in the spleen, lymph node, and afferent lymph represent the same subset of DC in different locations, whereas CD4 expression might be restricted to a specific subset of DC that traffic from certain tissues to lymph nodes or the spleen or might be temporally regulated on rat DC. However, we did not observe CD4, CD5, or SIRP expression on CD4^- DC upon in vitro culture (data not shown).

We found that CD4^- but not CD4⁺ DC produce IL-12 upon CD40L or LPS exposure although both subsets produce IL-12p40 upon SAC exposure. However, the fact that IL-12p35 mRNA was strongly up-regulated in stimulated CD4^- but not CD4⁺ DC suggest that CD4^- DC are the main source of bioactive IL-12. Moreover, the Toll-like receptor 3 ligand poly(I:C) (31) induced TNF- but not IL-12 production in CD4^- DC. These results suggest that spleen DC subsets differentially respond to a pathogen-associated molecular pattern and therefore express a different set of Toll-like receptors (32) as recently reported for human DC subsets (33). Monocytes and myeloid-derived DC express numerous Toll-like receptors whereas lymphoid DC and immediate precursors (preDC2) appear to express a limited set of receptors (33). To our knowledge, the ontogeny of DC subsets in rats has not been clearly studied; however, our results do not suggest a clear myeloid and lymphoid dichotomy of splenic DC subsets. CD4^- DC appear to be a homogenous population of cells with myeloid-like morphological features and do not express lymphoid-related Ags. Splenic CD4⁺ DC appeared much more heterogeneous regarding their morphology and to a lesser extent their phenotype. Moreover, both typical lymphoid-related markers such as CD5 and myeloid-related markers such as SIRP are expressed by CD4⁺ DC. In the murine spleen, two subsets of DC were initially described by Shortman’s group (34), one CD8^- and one CD8⁺. More recently, the CD8^- subset was shown to contain CD4⁺ and CD8^- DC (23). Because CD8 is not expressed on rat splenic DC, it is not possible to make a direct link between mouse and rat DC subsets. However, the poor viability and spontaneous maturation, the large size, the high IL-12 production, and the low capacity to stimulate CD8⁺ T cells of the CD4^- subset of DC are properties reminiscent of mouse splenic CD8⁺ DC (6, 35, 36). Finally, the fact that total OX62⁺ DC as well as sorted CD4⁺ and CD4^- DC subsets produce low amounts of IFN- upon viral infection suggest that rat plasmacytoid DC do not express OX62 or CD103.

Whether CD4⁺ T cell differentiation is influenced by specific DC subsets or by the maturation stage of DC remains controversial (4, 26, 37). As previously reported in humans (1), our study shows the existence of a high IL-12-producing DC subset in rats (CD4^-SIRP^-) that induce Th1 responses and exhibit a myeloid-like morphology. Although the production of both IFN- and IL-10 by CD4⁺ T cells stimulated with CD4^- DC is reminiscent of T regulatory type 1 cells previously described in mice (38), the associated high production of IL-2 rather suggests a Th1 differentiation, a phenotype consistent with the high production of IL-12 by CD4^- DC. In contrast to CD4^- DC, CD4⁺SIRP⁺ DC induced CD4⁺ T cells to produce IL-13 but also large amounts of IFN- and IL-2, despite a low production of IL-12, suggesting IL-12-independent Th1-priming capacity. However, it is not known whether IL-13, IL-2, and IFN- are produced by the same Th0 cells or by differentiated Th1 and Th2 cells. It is also possible that CD4⁺ DC are actually a heterogeneous population of DC with different Th cell-priming capacities.

A recent study by Huang et al. (13) suggested that in the steady state, rat CD4^- DC may play a role in the maintenance of self-tolerance by transporting apoptotic tissue cells and presenting self-peptides in a tolerogenic fashion in draining lymph nodes (14). Although freshly isolated CD4^- splenic DC exhibit an immature phenotype, a maturation, probably due to the cell extraction procedure, occurs upon culture. Therefore, results obtained from in vitro studies, such as ours, performed with DC extracted from lymphoid organs, do not fully reflect the actual role of DC in their in vivo steady state. Indeed, it has been postulated that steady-state immature DC may tolerize and mature DC may immunize (39). Our results indicate that both immature and mature CD4^- DC are poor stimulators of CD8⁺ T cells in our experimental conditions. However, the fact that CD40 stimulation or GM-CSF increased their capacity to stimulate CD8⁺ T cells suggest that, in vivo, CD4^- DC might be able to prime CD8⁺ T cells providing that an additional maturation signal or help from CD4⁺ T cells is present. In contrast, CD4⁺ DC are potent stimulators of CD8⁺ T cells even in the absence of maturation signal or CD4⁺ T cells. The mechanisms underlying this different CD8⁺ T cell stimulatory capacity between CD4⁺ and CD4^- DC are currently under investigation. Although CD4^- DC exhibit a potent cytotoxic activity against tumor cells in vitro, they are unable to induce cytolysis in resting or activated T cells (11), suggesting that this activity is not involved in the low capacity of CD4^- DC to stimulate CD8⁺ T cells. It is interesting to note that CD4^- spleen DC express high levels of CD200, a molecule that has recently been involved in T cell tolerance (40). SIRP⁺ and SIRP^- DC subsets have been described in bovine afferent lymph (41). Similar to rat DC, bovine SIRP^- DC were found to be poor stimulators of CD8⁺ T cell responses, as compared with SIRP⁺ DC, and this difference was related to the lack of IL-1 secretion by SIRP^- DC (41).

In conclusion, we have described the phenotype of two splenic DC subsets in rats and characterized, for the first time, their cytokine production and their capacity to induce CD4⁺ and CD8⁺ T cell differentiation. As previously described in humans and mice, we have identified a DC subset in rats that lack CD4 expression and that produce high levels of IL-12 and induce Th1 differentiation in vitro. We have recently shown that the same subset of DC also exhibit a cytotoxic activity against selected tumor cells in vitro (11). CD4^- DC might therefore directly bridge innate and adaptive immune responses against tumors by directly killing tumor cells and inducing Th1 responses to tumor Ags. Finally, our study will be useful to decipher the complex role of DC subsets in rat models of autoimmunity, tumor, and transplantation immunity as well as tolerance.

	Acknowledgments

 
We are grateful to Nelly Robillard for cell sorting and we thank Francine Brière and Cristina Cuturi for critically reviewing this manuscript.

	Footnotes

 
¹ This work was supported by Institut National de la Santé et de la Recherche Médicale and by grants from La Ligue Nationale Contre le Cancer (to C.V.), from the Société Francophone de Transplantation (to B.T.), from the Etablissement Francais des Greffes (EGF 2000), and from the Association pour la Recherche sur le Cancer (ARC 5901 to R.J.).

² Address correspondence and reprint requests to Dr. Régis Josien, Institut National de la Santé et de la Recherche Médicale, Unité 437, Centre Hospitalier Régional Universitaire de Nantes, 30 Boulevard Jean Monnet, 44093 Nantes, Cedex 1, France. E-mail address: rjosien{at}nantes.inserm.fr

³ Abbreviations used in this paper: DC, dendritic cell; CD40L, CD40 ligand; SAC, Staphylococcus aureus Cowan I; SIRP, signal regulatory protein; HPRT, hypoxanthine phosphoribosyltransferase; TAI, transcript accumulation index; Ct, cycle threshold.

Received for publication December 20, 2001. Accepted for publication June 21, 2002.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Liu, Y.-J.. 2001. Dendritic cell subsets and lineages, and their functions in innate and adaptive immunity. Cell 106:259.[Medline]
2. Rissoan, M. C., V. Soumelis, N. Kadowaki, G. Grouard, F. Briere, R. de Waal Malefyt, Y. J. Liu. 1999. Reciprocal control of T helper cell and dendritic cell differentiation. Science 283:1183.[Abstract/Free Full Text]
3. Siegal, F. P., N. Kadowaki, M. Shodell, P. A. Fitzgerald-Bocarsly, K. Shah, S. Ho, S. Antonenko, Y. J. Liu. 1999. The nature of the principal type 1 interferon-producing cells in human blood. Science 284:1835.[Abstract/Free Full Text]
4. Kalinski, P., C. M. Hilkens, E. A. Wierenga, M. L. Kapsenberg. 1999. T-cell priming by type-1 and type-2 polarized dendritic cells: the concept of a third signal. Immunol. Today 20:561.[Medline]
5. Kadowaki, N., S. Antonenko, J. Y. Lau, Y. J. Liu. 2000. Natural interferon /-producing cells link innate and adaptive immunity. J. Exp. Med. 192:219.[Abstract/Free Full Text]
6. Maldonado-Lopez, R., T. De Smedt, P. Michel, J. Godfroid, B. Pajak, C. Heirman, K. Thielemans, O. Leo, J. Urbain, M. Moser. 1999. CD8⁺ and CD8^- subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J. Exp. Med. 189:587.[Abstract/Free Full Text]
7. Pulendran, B., J. L. Smith, G. Caspary, K. Brasel, D. Pettit, E. Maraskovsky, C. R. Maliszewski. 1999. Distinct dendritic cell subsets differentially regulate the class of immune response in vivo. Proc. Natl. Acad. Sci. USA 96:1036.[Abstract/Free Full Text]
8. Traver, D., K. Akashi, M. Manz, M. Merad, T. Miyamoto, E. G. Engleman, I. L. Weissman. 2000. Development of CD8-positive dendritic cells from a common myeloid progenitor. Science 290:2152.[Abstract/Free Full Text]
9. Manz, M. G., D. Traver, T. Miyamoto, I. L. Weissman, K. Akashi. 2001. Dendritic cell potentials of early lymphoid and myeloid progenitors. Blood 97:3333.[Abstract/Free Full Text]
10. Liu, L., M. Zhang, C. Jenkins, G. G. MacPherson. 1998. Dendritic cell heterogeneity in vivo: two functionally different dendritic cell populations in rat intestinal lymph can be distinguished by CD4 expression. J. Immunol. 161:1146.[Abstract/Free Full Text]
11. Trinite, B., C. Voisine, H. Yagita, R. Josien. 2000. A subset of cytolytic dendritic cells in rat. J. Immunol. 165:4202.[Abstract/Free Full Text]
12. Adams, S., L. J. van der Laan, E. Vernon-Wilson, C. Renardel de Lavalette, E. A. Dopp, C. D. Dijkstra, D. L. Simmons, T. K. van den Berg. 1998. :Signal-regulatory protein is selectively expressed by myeloid and neuronal cells. J. Immunol. 161:1853.[Abstract/Free Full Text]
13. Huang, F. P., N. Platt, M. Wykes, J. R. Major, T. J. Powell, C. D. Jenkins, G. G. MacPherson. 2000. A discrete subpopulation of dendritic cells Transports apoptotic intestinal epithelial cells to T cell areas of mesenteric lymph nodes. J. Exp. Med. 191:435.[Abstract/Free Full Text]
14. Steinman, R. M., S. Turley, I. Mellman, K. Inaba. 2000. The induction of tolerance by dendritic cells that have captured apoptotic cells. J. Exp. Med. 191:411.[Free Full Text]
15. Fanger, N. A., C. R. Maliszewski, K. Schooley, T. S. Griffith. 1999. Human dendritic cells mediate cellular apoptosis via tumor necrosis factor-related apoptosis-inducing ligand (TRAIL). J. Exp. Med. 190:1155.[Abstract/Free Full Text]
16. Vidalain, P. O., O. Azocar, H. Yagita, C. Rabourdin-Combe, C. Servet-Delprat. 2001. Cytotoxic activity of human dendritic cells is differentially regulated by double-stranded RNA and CD40 ligand. J. Immunol. 167:3765.[Abstract/Free Full Text]
17. Vanderheyde, N., E. Aksoy, Z. Amraoui, P. Vandenabeele, M. Goldman, F. Willems. 2001. Tumoricidal activity of monocyte-derived dendritic cells: evidence for a caspase-8-dependent, Fas-associated death domain-independent mechanism. J. Immunol. 167:3565.[Abstract/Free Full Text]
18. Josien, R., M. Heslan, J. P. Soulillou, M. C. Cuturi. 1997. Rat spleen dendritic cells express natural killer cell receptor protein 1 (NKR-P1) and have cytotoxic activity to select targets via a Ca2⁺-dependent mechanism. J. Exp. Med. 186:467.[Abstract/Free Full Text]
19. Josien, R., C. Pannetier, P. Douillard, D. Cantarovich, S. Menoret, L. Bugeon, P. Kourilsky, J. P. Soulillou, M. C. Cuturi. 1995. Graft-infiltrating T helper cells, CD45RC phenotype, and Th1/Th2-related cytokines in donor-specific transfusion-induced tolerance in adult rats. Transplantation 60:1131.[Medline]
20. Brenan, M., D. J. Rees. 1997. Sequence analysis of rat integrin _E1 and _E2 subunits: tissue expression reveals phenotypic similarities between intraepithelial lymphocytes and dendritic cells in lymph. [Published erratum appears in 1998 Eur. J. Immunol. 28:3891.]. Eur. J. Immunol. 27:3070.[Medline]
21. Brenan, M., M. Puklavec. 1992. The MRC OX-62 antigen: a useful marker in the purification of rat veiled cells with the biochemical properties of an integrin. J. Exp. Med. 175:1457.[Abstract/Free Full Text]
22. McLellan, A. D., M. Kapp, A. Eggert, C. Linden, U. Bommhardt, E. B. Brocker, U. Kammerer, E. Kampgen. 2002. Anatomic location and T-cell stimulatory functions of mouse dendritic cell subsets defined by CD4 and CD8 expression. Blood 99:2084.[Abstract/Free Full Text]
23. Vremec, D., J. Pooley, H. Hochrein, L. Wu, K. Shortman. 2000. CD4 and CD8 expression by dendritic cell subtypes in mouse thymus and spleen. J. Immunol. 164:2978.[Abstract/Free Full Text]
24. Wu, L., D. Vremec, C. Ardavin, K. Winkel, G. Suss, H. Georgiou, E. Maraskovsky, W. Cook, K. Shortman. 1995. Mouse thymus dendritic cells: kinetics of development and changes in surface markers during maturation. Eur. J. Immunol. 25:418.[Medline]
25. Josien, R., H. L. Li, E. Ingulli, S. Sarma, B. R. Wong, M. Vologodskaia, R. M. Steinman, Y. Choi. 2000. TRANCE, a tumor necrosis factor family member, enhances the longevity and adjuvant properties of dendritic cells in vivo. J. Exp. Med. 191:495.[Abstract/Free Full Text]
26. Moser, M., K. M. Murphy. 2000. Dendritic cell regulation of TH1-TH2 development. Nat. Immunol 1:199.[Medline]
27. Banchereau, J., R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245.[Medline]
28. Asselin-Paturel, C., A. Boonstra, M. Dalod, I. Durand, N. Yessaad, C. Dezutter-Dambuyant, A. Vicari, A. O’Garra, C. Biron, F. Briere, G. Trinchieri. 2001. Mouse type I IFN-producing cells are immature APCs with plasmacytoid morphology. Nat. Immunol. 2:1144.[Medline]
29. Nakano, H., M. Yanagita, M. D. Gunn. 2001. Cd11c⁺b220⁺gr-1⁺ cells in mouse lymph nodes and spleen display characteristics of plasmacytoid dendritic cells. J. Exp. Med. 194:1171.[Abstract/Free Full Text]
30. Robinson, A. P., T. M. White, D. W. Mason. 1986. Macrophage heterogeneity in the rat as delineated by two monoclonal antibodies MRC OX-41 and MRC OX-42, the latter recognizing complement receptor type 3. Immunology 57:239.[Medline]
31. Alexopoulou, L., A. C. Holt, R. Medzhitov, R. A. Flavell. 2001. Recognition of double-stranded RNA and activation of NF-B by Toll-like receptor 3. Nature 413:732.[Medline]
32. Medzhitov, R., Jr C. Janeway. 2000. Innate immune recognition: mechanisms and pathways. Immunol. Rev. 173:89.[Medline]
33. Kadowaki, N., S. Ho, S. Antonenko, R. W. Malefyt, R. A. Kastelein, F. Bazan, Y. J. Liu. 2001. Subsets of human dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens. J. Exp. Med. 194:863.[Abstract/Free Full Text]
34. Vremec, D., M. Zorbas, R. Scollay, D. J. Saunders, C. F. Ardavin, L. Wu, K. Shortman. 1992. The surface phenotype of dendritic cells purified from mouse thymus and spleen: investigation of the CD8 expression by a subpopulation of dendritic cells. J. Exp. Med. 176:47.[Abstract/Free Full Text]
35. Hochrein, H., K. Shortman, D. Vremec, B. Scott, P. Hertzog, M. O’Keeffe. 2001. Differential production of IL-12, IFN-, and IFN- by mouse dendritic cell subsets. J. Immunol. 166:5448.[Abstract/Free Full Text]
36. Kronin, V., K. Winkel, G. Suss, A. Kelso, W. Heath, J. Kirberg, H. von Boehmer, K. Shortman. 1996. A subclass of dendritic cells regulates the response of naive CD8 T cells by limiting their IL-2 production. J. Immunol. 157:3819.[Abstract]
37. Langenkamp, A., M. Messi, A. Lanzavecchia, F. Sallusto. 2000. Kinetics of dendritic cell activation: impact on priming of TH1, TH2 and nonpolarized T cells. Nat. Immunol. 1:311.[Medline]
38. Groux, H., A. O’Garra, M. Bigler, M. Rouleau, S. Antonenko, J. E. de Vries, M. G. Roncarolo. 1997. A CD4⁺ T-cell subset inhibits antigen-specific T-cell responses and prevents colitis. Nature 389:737.[Medline]
39. Steinman, R. M., M. C. Nussenzweig. 2002. Avoiding horror autotoxicus: the importance of dendritic cells in peripheral T cell tolerance. Proc. Natl. Acad. Sci. USA 99:351.[Abstract/Free Full Text]
40. Gorczynski, R. M., K. Yu, D. Clark. 2000. Receptor engagement on cells expressing a ligand for the tolerance-inducing molecule OX2 induces an immunoregulatory population that inhibits alloreactivity in vitro and in vivo. J. Immunol. 165:4854.[Abstract/Free Full Text]
41. Hope, J. C., P. Sopp, R. A. Collins, C. J. Howard. 2001. Differences in the induction of CD8⁺ T cell responses by subpopulations of dendritic cells from afferent lymph are related to IL-1 secretion. J. Leukocyte Biol. 69:271.[Abstract/Free Full Text]

This article has been cited by other articles:

				A.-S. Dugast, T. Haudebourg, F. Coulon, M. Heslan, F. Haspot, N. Poirier, R. Vuillefroy de Silly, C. Usal, H. Smit, B. Martinet, et al. Myeloid-Derived Suppressor Cells Accumulate in Kidney Allograft Tolerance and Specifically Suppress Effector T Cell Expansion J. Immunol., June 15, 2008; 180(12): 7898 - 7906. [Abstract] [Full Text] [PDF]

				A. Ouabed, F.-X. Hubert, D. Chabannes, L. Gautreau, M. Heslan, and R. Josien Differential Control of T Regulatory Cell Proliferation and Suppressive Activity by Mature Plasmacytoid versus Conventional Spleen Dendritic Cells J. Immunol., May 1, 2008; 180(9): 5862 - 5870. [Abstract] [Full Text] [PDF]

				A. Nicolas, D. Cathelin, N. Larmonier, J. Fraszczak, P.-E. Puig, A. Bouchot, A. Bateman, E. Solary, and B. Bonnotte Dendritic Cells Trigger Tumor Cell Death by a Nitric Oxide-Dependent Mechanism J. Immunol., July 15, 2007; 179(2): 812 - 818. [Abstract] [Full Text] [PDF]

				U. Yrlid, V. Cerovic, S. Milling, C. D. Jenkins, J. Zhang, P. R. Crocker, L. S. Klavinskis, and G. G. MacPherson Plasmacytoid Dendritic Cells Do Not Migrate in Intestinal or Hepatic Lymph J. Immunol., November 1, 2006; 177(9): 6115 - 6121. [Abstract] [Full Text] [PDF]