| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Department of Internal Medicine, Division of Nephrology and
Laboratory of Host Defense and Germfree Life, Research Institute for Disease Mechanism and Control, Nagoya University Graduate School of Medicine, Nagoya, Japan;
Toyama Institute of Health, Toyama, Japan; and
Department of Host Defense, Research Institute for Microbial Disease, Osaka University, Osaka, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B inhibition, but unaffected by extracellular
signal-regulated kinase inhibition. In LPS-stimulated MTECs, inhibition
of c-Jun N-terminal kinase and p38 mitogen-activated protein kinase
significantly decreased RANTES, but did not affect MCP-1 mRNA
induction. Thus, MTECs have a distinct expression pattern of TLR and
secrete C-C chemokines in response to direct stimulation with a set of
bacterial components. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Toll-like receptors (TLRs) have been shown to play important roles in the recognition of bacterial components (7). Ten members of TLRs have been reported so far (7). Among TLRs, TLR4 mediates LPS signal transduction in collaboration with other molecules, such as CD14, MD-2, myeloid differentiation factor 88 (MyD88), and Toll receptor-IL-1R domain-containing adapter protein (TIRAP)/MyD88-adapter-like (Mal) (7, 8, 9, 10). On the other hand, TLR2 is considered to be an essential receptor for other bacterial components: lipoprotein, peptidoglycan (PGN), and lipoteichoic acid (7). It has recently been reported that TLR6 forms a heterodimer with TLR2 to mediate the responsiveness to PGNs and zymosan, but not lipoproteins (11). TLR3 (12), TLR5 (13), and TLR9 (14) have recently been shown to mediate signals from dsRNA, flagella, and bacterial DNA, respectively. Roles of TLRs, especially TLR2 and TLR4, have been examined mainly in professional immune cells such as monocytes (15), macrophages (16), T cells (17, 18), and dendritic cells (19), but also in other cell types, e.g., dermal endothelial cells (20), intestinal epithelial cells (21), hepatocytes (22), and osteoblasts (23). These findings raise the possibility that TLRs may be involved in C-C chemokine production in renal cells after direct exposure to bacterial components. Therefore, we examined the roles of TLRs in the C-C chemokine production by mouse primary renal tubular epithelial cell (MTEC) after stimulation with bacterial components including LPS/lipid A, lipoprotein, and bacterial DNA. Our results indicate that MTECs have a distinct expression pattern of TLR genes and directly respond to a set of bacterial components by secreting C-C chemokines. We have also shown that although both MCP-1 and RANTES are induced by LPS in MTECs, the molecular mechanisms controlling their expression are different.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
LPS from Escherichia coli (serotype B6:026) and
synthetic lipoprotein
(palmitoyl-Cys((RS)-2,3-di(palmitoyloxy)-propyl)-Ala-Gly-OH))
were obtained from Sigma-Aldrich (St. Louis, MO) and Bachem
(Bubendorf, Switzerland), respectively. Recombinant mouse TNF-
,
IFN-
, and IL-1
were purchased from PeproTech (Seattle, WA).
Synthetic lipid A analog (ONO-4007) was kindly provided by Ono
Pharmaceuticals (Osaka, Japan) (24). DMEM and DMEM
nutrient mixture F-12 Ham, cycloheximide, and curcumin were obtained
from Sigma-Aldrich. SP600125, PD98059, and SB203580 were obtained from
Calbiochem (San Diego, CA). Anti-mouse CD14 mAb and anti-MyD88
polyclonal Ab were purchased from BD PharMingen (San Diego, CA) and
Alexis Biotechnology (San Diego, CA), respectively. A polyclonal
anti-c-Jun N-terminal kinase (JNK) 1 Ab and a polyclonal
anti-p38 Ab were obtained from Santa Cruz Biotechnology (Santa
Cruz, CA). A polyclonal anti-extracellular signal-regulated kinase
(ERK)1/2, a phosphospecific anti-ERK1/2 polyclonal Ab and a
phospho-specific anti-p38 mitogen-activated protein kinase (MAPK)
polyclonal Ab were purchased from New England Biolabs (Beverly, MA).
Phosphorothioate-stabilized CpG-oligodeoxynucleotide (ODN)
(TCCATGACGTTCCTGATGCT) (14) was purchased from Rikaken
(Nagoya, Japan). For immunofluorescence studies, anti-mouse
cytokeratin mAb was obtained from Enzo Diagnostics (New York, NY) and
anti-rabbit brush border vesicle polyclonal Ab was gift a from Dr.
G. Andres (25).
Mice
C57BL/6, C3H/HeN, and C3H/HeJ mice were purchased from Japan SLC (Shizuoka, Japan). These mice were bred in our institute under specific pathogen-free conditions. Eight- to 10-wk-old female mice were used for the experiments. The mutant mouse (F2 interbred from 129/Ola x C57BL/6) strain deficient in TLR2 was generated by gene targeting, as described previously (26).
Primary mouse renal TEC culture
TECs were harvested from murine renal cortex following microdissection and brief collagenase digestion. Cells were grown in hormonally defined K-1 medium (27) supplemented with epidermal growth factor (50 pg/ml), insulin-transferrin-sodium selenite media supplement (0.12 IU/ml), PGE1 (1.25 ng/ml), T3 (34 pg/ml), hydrocortisone (18 ng/ml), 10% decomplemented FBS, and 1% penicillin/streptomycin at 37°C. Expression of epithelial cell markers including cytokeratin and brush border vesicle was verified by immunofluorescence studies of subconfluent monolayers.
Cell lines
SV40-transformed murine mesangial cell line, Mes13, purchased from American Type Culture Collection (Manassas, VA) and a mouse macrophage cell line, RAW264.7, obtained from Riken Cell Bank (Tsukuba, Japan), were maintained in DMEM supplemented with 10% FCS (Sigma-Aldrich). Cells were cultured at 37°C in 5% CO2/95% air.
Northern blot analysis
cDNA was synthesized from 2 µg of total RNA derived from
RAW264.7 cells by RT-PCR. PCR of the synthesized cDNA was
performed as previously described (17). The synthesized
PCR products were used for specific probes. The primers were: mouse
TLR1 sense, CTGAAGGCTTTGTCGATACA; mouse TLR1 antisense,
GGGAAACTGAGTTATGGTCG; mouse TLR3 sense, ATGTTTCAGTGCATCGGATT; mouse
TLR3 antisense, AAACATTCCTCTTCGCAAAC; mouse TLR5 sense,
GAATTCCTTAAGCGACGTAA; mouse TLR5 antisense,
GAGAAGATAAAGCCGTGCGA; mouse TLR6 sense, AGTGCTGCCAAGTTCCGACA;
mouse TLR6 antisense, AGCAAACACCGAGTATAGCG; mouse TLR9 sense,
CCAGACGCTCTTCGAGAACC; mouse TLR9 antisense, GTTATAGAAGTGGCGGTTGT;
mouse MCP-1 sense, GCTGTTCACAGTTGCCGGCT; mouse MCP-1 antisense,
CATTAGCTTCAGATTTACGG; mouse RANTES sense, CCCTCTGCACCCCCGTACCT;
mouse RANTES antisense, CCATTTTCCCAGGACCGAGT; mouse macrophage
inflammatory protein (MIP)-1 sense, CTCAACATCATGAAGGTCTC; mouse
MIP-1 antisense, GGCATTCAGTTCCAGGTCAG; mouse MIP-1 sense,
CTCTCTCTCCTCTTGCTCGT; and mouse MIP-1 antisense,
CTCCATGGGAGACACGCGTC. cDNA fragments containing the
full coding regions of mouse TLR2, mouse TLR4
(16), mouse MyD88 (28), mouse TIRAP/Mal
(9, 10), and mouse MD-2 (29) were also
synthesized by RT-PCR and used for specific probes. Total cellular RNA
was prepared using TRIzol reagent (Life Technologies, Rockville, MD).
Total RNAs (5- to 15-µg aliquots) were used for Northern blot
analysis as previously described (17).
Cell extract preparation and immunoblotting
Cells were lysed in PLC buffer (50 mM HEPES (pH 7.0), 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1.5 mM MgCl2, 1 mM EGTA, 100 mM NaF, 10 mM NaPPi, 1 mM Na3VO4, 1 mM PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin) and analyzed by immunoblotting as previously described (17).
In vitro kinase assay
Cell lysates (107 cells/sample) were
immunoprecipitated with 0.4 µg of anti-JNK1 polyclonal Ab,
anti-ERK1/2 polyclonal Ab, and anti-p38 MAPK polyclonal Ab for
2 h at 4°C, respectively, followed by incubation with protein
A-Sepharose beads for an additional 1 h. The beads were
extensively washed with PLC buffer three times followed by kinase
buffer (20 mM Tris-HCl (pH 7.4), 20 mM MgCl2, and
2 mM EGTA) once. The kinase reaction was initiated by the addition of
30 ml of kinase buffer with 20 mM ATP, 5 µCi of
[-32P]ATP (New England Nuclear, Boston, MA)
and 0.5 µg of GST-c-Jun for JNK (16), myelin basic
protein (Sigma-Aldrich) for ERK or GST-ATF2 for p38 MAPK
(16), and was allowed to proceed for 15 min at 30°C. The
reaction was terminated by the addition of 2x SDS sample buffer,
resolved by SDS-PAGE, and the fixed gel was exposed to an x-ray
film.
EMSA
MTECs from C57BL/6 mice were pretreated with various
concentrations of curcumin for 30 min followed by a 30-min stimulation
with 1 µg/ml LPS. Subsequently, nuclear extracts were prepared from
cells as previously described (30). An oligonucleotide
containing the NF-B sense sequence (5'-AGT TGA GGG GAC TTT CCC AGG
C-3') was used as a probe for EMSA. Approximately 1 x
104 cpm of 32P-labeled
oligonucleotide, 10 µg of nuclear extract, and 1 µg of
poly(dI · dC) were added to the binding buffer (10 mM Tris-HCl (pH
7.5), 100 mM NaCl, and 4% glycerol) and incubated for 30 min at 4°C.
The reaction mixtures were run in a 5% nondenaturing polyacrylamide
gel at 4°C in Tris-borate-EDTA buffer (90 mM Tris-borate, 2 mM
EDTA).
Determination of chemokine production
Concentrations of MCP-1 and RANTES in the culture supernatants of MTECs were measured by commercial ELISA kits (R&D Systems, Minneapolis, MN) according to the manufacture’s instructions. All samples were assayed in triplicate and the data were presented as the mean ± SD.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
MCP-1, RANTES, MIP-1, and MIP-1 are major mononuclear
cell-directed chemokines expressed in the interstitium or glomeruli of
a variety of murine or human glomerulonephritis (6, 31, 32, 33). To examine the expression of these four chemokines in
LPS-treated renal cells, MTECs were isolated and grown in primary
culture as described in Materials and Methods. The purity of
the MTECs was verified by the expression of epithelial cell markers
such as cytokeratin (Fig. 1
A)
and brush border vesicle (data not shown) to be 95%. We also
analyzed a moue mesangial cell line (Mes13) for a comparison. These two
cell types were stimulated with LPS for 2 or 8 h, and the total
RNA was extracted for the Northern blot analysis (Fig. 1B).
As a control, we used RAW264.7, a mouse macrophage cell line, that
produces various cytokines and chemokines in response to LPS
(34, 35, 36). Among all C-C chemokines examined in the present
study, MCP-1 mRNA was significantly induced after LPS stimulation in
both MTECs and Mes13 cells. On the other hand, induction of RANTES mRNA
was detected only in MTECs. MIP-1 and MIP-1 were not expressed in
either MTECs or Mes13 cells even after LPS stimulation, whereas LPS
significantly induced these chemokine mRNAs in RAW264.7 cells. MTECs
were also stimulated for 2 h by several proinflammatory cytokines,
including TNF-, IFN-, and IL-1 and assessed for their
MCP-1 and RANTES gene transcripts. As shown in
Fig. 1C, these cytokines rapidly induced significant amounts
of MCP-1 and RANTES mRNA in MTECs. Together, these results suggest that
LPS, as well as inflammatory cytokines, directly affects MTECs to
express both MCP-1 and RANTES, but not MIP-1 or .
|
by LPS or proinflammatory cytokines. To evaluate the
possibility that LPS increases chemokine mRNA indirectly by inducing
cytokine secretion, MTECs were pretreated with cycloheximide, a protein
synthesis inhibitor, before LPS stimulation. As shown in Fig. 1
D, cycloheximide rather enhanced the LPS-mediated increase
of MCP-1 mRNA in MTECs, but partially inhibited RANTES mRNA induction.
Furthermore, neutralization of TNF- by a specific Ab did not impair
the LPS-induced MCP-1 and RANTES synthesis (Fig. 1E). MAPKs do not regulate MCP-1 mRNA after LPS stimulation, but JNK and p38 MAPK activation pathways are involved in LPS-mediated RANTES mRNA expression in MTECs
To examine the molecular mechanisms for chemokine production in
MTECs, we pretreated the cells with inhibitors of various signaling
molecules. It has been reported that curcumin inhibits JNK activation
at a concentration of 5 or 10 µM, whereas higher concentrations of
curcumin (50 µM or higher) inhibit NF-B activation in various cell
types (16). Consistent with the previous report,
LPS-mediated JNK activation was significantly inhibited at 10 µM
curcumin, while inhibition of NF-B activity needs 25 µM curcumin
in MTECs (Fig. 2A). MCP-1 and
RANTES mRNA induction by LPS was dramatically impaired by pretreatment
with 25 µM curcumin (Fig. 2A). Pretreatment with 10 µM
curcumin did not influence LPS-induced MCP-1 mRNA up-regulation, but
inhibited RANTES gene transcription after LPS stimulation
(Fig. 2A). SP600125 is a potent, cell-permeable, selective,
and reversible inhibitor of JNK (37, 38). In MTECs as
well, SP600125 inhibited LPS-induced JNK activation in a dose-dependent
manner, but not NF-B activity. When MTECs were preincubated with
SP600125, LPS-induced RANTES gene expression was
significantly decreased, whereas MCP-1 mRNA induction remained constant
(Fig. 2B). This is consistent with the result of curcumin,
clearly indicating that JNK activation is essential for LPS-mediated
RANTES mRNA induction. Next, MTECs were pretreated with a specific
inhibitor of ERK (PD98059) or p38 MAPK (SB203580) pathway followed by
LPS stimulation. As shown in Fig. 2C, PD98059 treatment did
not affect either chemokines mRNA induction. On the other hand,
pretreatment with SB203580 inhibited LPS-induced RANTES mRNA
up-regulation in a dose-dependent manner (Fig. 2D). Taken
together, these findings suggest that NF-B activation seems
essential for LPS-mediated up-regulation of both MCP-1 and RANTES mRNA.
Furthermore, activation of p38 MAPK and JNK by LPS were also involved
in mRNA induction of RANTES but not MCP-1, indicating that the
induction mechanisms of these two chemokines are different.
|
TLR4 has recently been revealed to work as a pattern recognition
receptor for LPS in various mammalian species including mouse. Thus, we
attempted to disclose TLR4 expression in renal cells at the
transcriptional level in comparison with that of a macrophage cell
line, RAW264.7, which constitutively expresses a significant amount
of TLR4 mRNA (16). As shown in Fig. 3A, both MTECs and Mes13 cells
constitutively expressed TLR4 mRNA at comparable levels to that of
RAW264.7 cells. Similarly to RAW264.7 cells, LPS stimulation did not
further increase TLR4 mRNA in these renal cells.
|
B). TLR2 mRNA was weakly expressed in both renal cell
types without stimulation, but significantly increased after LPS
treatment. TLR3 gene expression was constitutively detected
in MTECs and further increased with LPS treatment. Mes13 cells, on the
other hand, expressed barely detectable TLR3 mRNA, which did not
increase with LPS treatment. TLR5 gene expression was
constitutively identified in Mes13 cells, but almost undetectable in
MTEC. TLR6 was constitutively expressed at lower levels in both renal
cell types. Furthermore, TLR1 mRNA expression was constitutive but
rather weak. A recent report revealed that TLR9 recognizes bacterial
DNA (14). However, TLR9 gene expression was
undetectable in either renal cell type. It is of note that multiple mRNA bands were always detected using TLR6 and TLR9 probes. The nucleotide sequence of mammalian TLR6 is most similar to that of TLR1 (39). Especially, nucleotide sequence bases 1333–2251 of the mouse TLR6 cDNA has 98% identities to mouse TLR1 cDNA. To avoid cross-hybridization between TLR1 and TLR6 mRNA, we chose a mouse TLR6 cDNA region which is not homologous to mouse TLR1 as the probe. Multiple transcripts were also detected using another partial cDNA fragments encoding bases 1–450 and 883-1332 of mouse TLR6 cDNA (data not shown). Human TLR9 was reported to be expressed in at least two splice forms, one of which is monoexonic and the other is biexonic. The latter encodes a protein with 57 additional amino acids at the N terminus (40). In addition, Hemmi et al. (14) demonstrated two kinds of mouse TLR9 transcripts by Northern blot analysis. In the present study, we could detect two TLR9 transcripts. The same two TLR9 mRNA bands were detected by other TLR9 probes containing bases 1–1356 of the mouse TLR9 coding region (data not shown). These results indicates that both mouse TLR6 and TLR9 genes produce multiple mRNAs by alternative splicing.
Membranous CD14, MD-2, MyD88, and TIRAP/Mal expression in MTECs and Mes13
At least four molecules, including CD14, MD-2, MyD88,
andTIRAP/Mal, have been shown to be essential for LPS
signaling (7, 8, 9, 10). Thus, we examined their expression in
renal cells. Western blot analysis showed that MTECs expressed a
significant amount of membranous CD14 at the protein level. Mes13
cells, in contrast, expressed much less CD14 protein compared with
MTECs (Fig. 4A). As shown in
Fig. 4, B and C, gene expression of MD-2, MyD88,
and TIRAP/Mal was detected both in MTECs and Mes13 and induced after
LPS stimulation in a time-dependent manner. The protein level of MyD88,
however, did not increase in both renal cell types as well as in
RAW264.7 cells (Fig. 4D).
|
To investigate whether TLR4 expression in MTECs is responsible for
LPS-induced C-C chemokine production from MTECs, we isolated MTECs from
C3H/HeJ mice, which have a TLR4 mutation that substitutes
histidine for proline at position 712 (7). To eliminate
the effects of the possible contamination of commercial grade of LPS
with cell stimulatory substances, we stimulated MTECs with synthetic
lipid A. Lipid A has long been established as the bioactive component
of LPS and this is the common structural feature shared by every LPS
(7). As shown in Fig. 5A, synthetic lipid A induced
MCP-1 and RANTES mRNA in MTECs from C3H/HeN mice but not that from
C3H/HeJ mice. We further measured the concentration of MCP-1 and RANTES
protein in the culture supernatants after synthetic lipid A stimulation
and found that the secretion of both chemokines was significantly
induced in MTECs from control C3H/HeN mice, but not in those from
C3H/HeJ mice (Fig. 5, B and C). These results
clearly indicated that TLR4 expressed on MTECs played a critical role
in LPS-induced chemokine production.
|
Lipoprotein is one of cell wall components that exist in both
Gram-positive and Gram-negative bacteria. Bacterial lipoprotein acts
synergistically with LPS to induce proinflammatory cytokine production
and lethal shock (41). Previous reports have suggested
that TLR2, but not TLR4, is the required receptor for the cellular
response to bacterial lipoproteins (42, 43). In our
subsequent study, we investigated the role of TLR2 in
lipoprotein-mediated chemokine production by MTECs using TLR2-deficient
mouse. As shown in Fig. 6A,
MCP-1 and RANTES mRNA were not increased in MTECs from TLR2-deficient
mice after synthetic lipoprotein treatment. In contrast, they were
significantly induced in MTECs from wild-type mice. ELISA revealed that
the protein secretion of both MCP-1 and RANTES was significantly
induced from MTECs of wild-type mice, but not from those of
TLR2-deficient mice after synthetic lipoprotein stimulation (Fig. 6, B and C). These results indicate that TLR2 is
essential for C-C chemokine production induced by synthetic
lipoprotein.
|
A recent report revealed that TLR9 recognizes bacterial DNA
(14). We next assessed MCP-1 and RANTES production by
MTECs after stimulation with CpG-ODN. RAW264.7 cells expressed TLR9 at
the transcriptional level (Fig. 3B) and secreted significant
MCP-1 and RANTES proteins after CpG-ODN stimulation. In contrast, MTECs
did not produce either chemokine in response to CpG-ODN (Fig. 7). This is consistent with our finding
that MTECs are defective of TLR9 mRNA (Fig. 3B) and suggests
that MTECs are refractory to bacterial DNA for chemokine
production.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B, AP-1, and three distinct MAPKs:
p38 MAPK, ERK, and JNK (7). Recently, it has been
documented that LPS-induced MCP-1 gene expression in rat
tubular epithelial cells is NF-B dependent (46). In our
studies performed by using various inhibitors, the LPS-mediated MCP-1
mRNA increase was dependent on NF-B activation, but not on the three
MAPK signaling pathways. In contrast, much less is known about the
regulation of RANTES mRNA in MTECs. In LPS-stimulated macrophage cell
line, RAW264.7 cells, it was shown that JNK and NF-B response
elements were involved in RANTES gene activation
(47). Besides, both p38 MAPK and JNK signaling pathways
regulate RANTES production in influenza virus-infected human bronchial
epithelial cells (48). In our present study, we have shown
that LPS-mediated RANTES production in MTECs is at least partially
sensitive to JNK and p38 MAPK inhibition. Collectively, the signal
transduction pathway regulating RANTES gene transcription
may be cell and stimulus specific. Transcription of MCP-1 and RANTES was induced by synthetic lipid A stimulation in MTEC derived from C3H/HeN mice, but not from C3H/HeJ mice, which lacks functional TLR4. On the contrary, MTECs from TLR2-/- mouse failed to produce the two chemokines in response to lipoprotein. These findings clearly demonstrated that TLR4 and TLR2 are strictly required for chemokine production by MTECs in response to lipid A and lipoprotein, respectively.
In Northern blot analyses, both MTECs and Mes13 express TLR4 at a level comparable to that of a macrophage cell line, RAW264.7 cells. Several proteins other than TLR4 are also involved in LPS signaling. Both CD14 and MD-2 are helper molecules for TLR4 and required for LPS recognition (7). We found that CD14 was constitutively expressed on both MTECs and the mesangial cell line, although the expression level of the latter was significantly lower. MD-2 was also expressed on MTECs and Mes13 at the transcriptional level and, interestingly, the expression was rapidly induced after LPS stimulation. MyD88, an adapter molecule, is indicated as an essential component in the downstream signaling of TLRs (49). In addition, TIRAP/Mal is recently reported as another adapter protein that controls activation of MyD88-independent signaling pathways downstream of TLR4 (9). In both MTECs and Mes13, the expression of these adopter molecules was induced after LPS stimulation at the transcriptional level, although the protein level of MyD88 was not affected. Together, these data indicate that both MTECs and Mes13 cells contain essential components of LPS responsiveness. The existence of the LPS signaling pathway through TLR4 in renal interstitial and glomerular cells may be important as these renal cells are directly exposed to both retrograde and blood-derived Gram-negative bacteria.
We have also characterized gene expressions for TLR members other than
TLR4. TLR2 has previously been implicated in LPS signaling as well as
TLR4, but recent studies have suggested that TLR2 recognizes other
bacterial components such as PGN, lipoarabinomannan, lipoteichoic acid,
and mycobacterial lipoprotein (7). As demonstrated in our
previous report, mouse TLR2 gene transcription is inducible
after treatment of LPS in macrophages (16). We also
demonstrated that the two NF-B binding sites in the 5' upstream
region are essential for the responsiveness of TLR2 to LPS
(50). Because NF-B was also activated in MTECs after
LPS stimulation, our current data that LPS rapidly induces
TLR2 gene expression at 2 h is compatible to our
previous data in macrophages and T lymphocytes (16, 17, 50). In the process of nephritis, renal TECs, which express
excessive TLR2 in response to LPS, may become more responsive to
bacterial components.
TLR3 mRNA that recognizes dsRNA (12) were expressed in MTECs, but scarcely in Mes13. TLR3 mRNA increased in MTECs by LPS stimulation. In contrast, mRNA of TLR5, recently identified as a receptor for bacterial flagella (13), was present in Mes13 but undetectable in MTECs or in RAW264.7 cells. Also, TLR6, that was shown to enhance the TLR2-dependent response to phenol-soluble modulin (51) or zymosan (11), was expressed in all renal cell lines examined, but their transcriptional levels were not induced after LPS stimulation. TLR1 gene expression was inducible in RAW264.7 cells after LPS stimulation, but was weakly expressed in renal cells. TLR9, suggested as the receptor that recognizes bacterial DNA (14), was detected only in the macrophage cell line, but not in either renal cell type. Consistent with these findings, CpG-ODN did not induce MCP-1 or RANTES production by MTECs. Taken together, TLR mRNA expression patterns of renal cells are somewhat different from that of macrophages. Based on these findings, we can speculate that renal cells respond well to several bacterial components but not to the others. Recent studies have revealed that renal tubular cells play important roles in controlling immune responses by presenting Ags, expressing costimulatory proteins, and secreting cytokines/chemokines (52). As TLRs control these processes in professional APC, such as dendritic cells, immunogenic actions of renal tubular cells may also be affected by the presence of various bacterial components through TLRs expressed on the cell surface.
In summary, we have demonstrated that TLR2 and TLR4 expressed in MTECs mediate their direct responses to bacterial components. As excessive activation of TLRs in TECs may result in further influx of inflammatory cells to the renal interstitium and in subsequent development of renal dysfunction, the regulation of TLR function may be one of the therapeutic targets for renal diseases after bacterial infection. We have also found that MTECs, unlike macrophages, are defective of TLR9 expression and do not produce chemokines in response to CpG-ODN. This indicates that CpG-ODN may be used as a therapeutic adjuvant for vaccination without severe side effects of renal injury.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Tetsuya Matsuguchi, Laboratory of Host Defense and Germfree Life, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550, Japan. E-mail address: tmatsugu{at}med.nagoya-u.ac.jp
3 Abbreviations used in this paper: TEC, tubular epithelial cell; MCP-1, monocyte chemoattractant protein 1; TLR, Toll-like receptor; MyD88, myeloid differentiation factor 88; TIRAP, Toll receptor-IL-1R domain-containing adapter protein; Mal, MyD88-adapter-like; PGN, peptidoglycan; MTEC, mouse primary renal TEC; JNK, c-Jun N-terminal kinase; MAPK, mitogen-activated protein kinase; ODN, oligodeoxynucleotide; ERK, extracellular signal-regulated kinase; MIP, macrophage inflammatory protein.
Received for publication February 2, 2002. Accepted for publication June 12, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B activation: a phylogenetically conserved paradigm in innate immunity. J. Clin. Invest. 107:13.[Medline]
B by Toll-like receptor 3. Nature 413:732.[Medline]
T cells bearing invariant V6/V1 induced by Escherichia coli infection in mice. J. Immunol. 165:931.B through Toll-like receptor 4 (TLR-4) in cultured human dermal endothelial cells: differential expression of TLR-4 and TLR-2 in endothelial cells. J. Biol. Chem. 275:11058.B and c-Jun N-terminal kinase. J. Biol. Chem. 274:19368. production in lipopolysaccharide-stimulated RAW264.7 cells from Amorpha fruticosa. J. Ethnopharmacol. 70:127.[Medline]
B-3 binding protein. Cytokine 12:207.[Medline]
regulation of human renal cortical epithelial cell-derived monocyte chemotactic peptide-1. Kidney Int. 44:43.[Medline]
B dependent. Kidney Int. 57:2011.[Medline]
B kinase cascade: implications for exacerbation of allergic inflammation by environmental pollutants. Clin. Immunol. 90:287.[Medline]
B and STAT5 play important roles in the regulation of mouse Toll-like receptor 2 gene expression. J. Immunol. 166:4516.This article has been cited by other articles:
|
|
 |
|
  T. Jia, I. Leiner, G. Dorothee, K. Brandl, and E. G. Pamer MyD88 and Type I Interferon Receptor-Mediated Chemokine Induction and Monocyte Recruitment during Listeria monocytogenes Infection J. Immunol., July 15, 2009; 183(2): 1271 - 1278. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. B. Mkaddem, C. Werts, J.-M. Goujon, M. Bens, E. Pedruzzi, E. Ogier-Denis, and A. Vandewalle Heat Shock Protein gp96 Interacts with Protein Phosphatase 5 and Controls Toll-like Receptor 2 (TLR2)-mediated Activation of Extracellular Signal-regulated Kinase (ERK) 1/2 in Post-hypoxic Kidney Cells J. Biol. Chem., May 1, 2009; 284(18): 12541 - 12549. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. C. Shirali and D. R. Goldstein Tracking the Toll of Kidney Disease J. Am. Soc. Nephrol., August 1, 2008; 19(8): 1444 - 1450. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. El-Achkar, X.-R. Wu, M. Rauchman, R. McCracken, S. Kiefer, and P. C. Dagher Tamm-Horsfall protein protects the kidney from ischemic injury by decreasing inflammation and altering TLR4 expression Am J Physiol Renal Physiol, August 1, 2008; 295(2): F534 - F544. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Zhang, G. Ramesh, S. Uematsu, S. Akira, and W. B. Reeves TLR4 Signaling Mediates Inflammation and Tissue Injury in Nephrotoxicity J. Am. Soc. Nephrol., May 1, 2008; 19(5): 923 - 932. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Banas, B. Banas, K. L. Hudkins, T. A. Wietecha, M. Iyoda, E. Bock, P. Hauser, J. W. Pippin, S. J. Shankland, K. D. Smith, et al. TLR4 Links Podocytes with the Innate Immune System to Mediate Glomerular Injury J. Am. Soc. Nephrol., April 1, 2008; 19(4): 704 - 713. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. J. Brown, H. R. Lock, T. G.A.M. Wolfs, W. A. Buurman, S. H. Sacks, and M. G. Robson Toll-Like Receptor 4 Ligation on Intrinsic Renal Cells Contributes to the Induction of Antibody-Mediated Glomerulonephritis via CXCL1 and CXCL2 J. Am. Soc. Nephrol., June 1, 2007; 18(6): 1732 - 1739. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. A. Shigeoka, T. D. Holscher, A. J. King, F. W. Hall, W. B. Kiosses, P. S. Tobias, N. Mackman, and D. B. McKay TLR2 Is Constitutively Expressed within the Kidney and Participates in Ischemic Renal Injury through Both MyD88-Dependent and -Independent Pathways J. Immunol., May 15, 2007; 178(10): 6252 - 6258. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. S. Patole, R. D. Pawar, M. Lech, D. Zecher, H. Schmidt, S. Segerer, A. Ellwart, A. Henger, M. Kretzler, and H.-J. Anders Expression and regulation of Toll-like receptors in lupus-like immune complex glomerulonephritis of MRL-Fas(lpr) mice Nephrol. Dial. Transplant., November 1, 2006; 21(11): 3062 - 3073. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Chassin, J.-M. Goujon, S. Darche, L. du Merle, M. Bens, F. Cluzeaud, C. Werts, E. Ogier-Denis, C. Le Bouguenec, D. Buzoni-Gatel, et al. Renal Collecting Duct Epithelial Cells React to Pyelonephritis-Associated Escherichia coli by Activating Distinct TLR4-Dependent and -Independent Inflammatory Pathways J. Immunol., October 1, 2006; 177(7): 4773 - 4784. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. D. Pawar, P. S. Patole, M. Wornle, and H.-J. Anders Microbial nucleic acids pay a Toll in kidney disease Am J Physiol Renal Physiol, September 1, 2006; 291(3): F509 - F516. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. J. Brown, H. R. Lock, S. H. Sacks, and M. G. Robson TLR2 Stimulation of Intrinsic Renal Cells in the Induction of Immune-Mediated Glomerulonephritis J. Immunol., August 1, 2006; 177(3): 1925 - 1931. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. J. Brown, S. H. Sacks, and M. G. Robson Toll-Like Receptor 2 Agonists Exacerbate Accelerated Nephrotoxic Nephritis J. Am. Soc. Nephrol., July 1, 2006; 17(7): 1931 - 1939. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. G. Tipping Toll-Like Receptors: The Interface between Innate and Adaptive Immunity J. Am. Soc. Nephrol., July 1, 2006; 17(7): 1769 - 1771. [Full Text] [PDF]
|
|
|
|
|
|
G. Wolf, J. Bohlender, T. Bondeva, T. Roger, F. Thaiss, and U. O. Wenzel Angiotensin II Upregulates Toll-Like Receptor 4 on Mesangial Cells J. Am. Soc. Nephrol., June 1, 2006; 17(6): 1585 - 1593. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. M. El-Achkar, X. Huang, Z. Plotkin, R. M. Sandoval, G. J. Rhodes, and P. C. Dagher Sepsis induces changes in the expression and distribution of Toll-like receptor 4 in the rat kidney Am J Physiol Renal Physiol, May 1, 2006; 290(5): F1034 - F1043. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-C. Hung, C.-T. Chang, Y.-C. Tian, M.-S. Wu, C.-C. Yu, M.-J. Pan, A. Vandewalle, and C.-W. Yang Leptospiral membrane proteins stimulate pro-inflammatory chemokines secretion by renal tubule epithelial cells through toll-like receptor 2 and p38 mitogen activated protein kinase Nephrol. Dial. Transplant., April 1, 2006; 21(4): 898 - 910. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Wornle, H. Schmid, B. Banas, M. Merkle, A. Henger, M. Roeder, S. Blattner, E. Bock, M. Kretzler, H.-J. Grone, et al. Novel Role of Toll-Like Receptor 3 in Hepatitis C-Associated Glomerulonephritis Am. J. Pathol., February 1, 2006; 168(2): 370 - 385. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. C. Rice, T. Peng, J. S. Spence, H.-Q. Wang, R. M. Goldblum, B. Corthesy, and B. J. Nowicki Pyelonephritic Escherichia coli Expressing P Fimbriae Decrease Immune Response of the Mouse Kidney J. Am. Soc. Nephrol., December 1, 2005; 16(12): 3583 - 3591. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Colombara, V. Antonini, A. P. Riviera, F. Mainiero, R. Strippoli, M. Merola, G. Fracasso, O. Poffe, N. Brutti, G. Tridente, et al. Constitutive Activation of p38 and ERK1/2 MAPKs in Epithelial Cells of Myasthenic Thymus Leads to IL-6 and RANTES Overexpression: Effects on Survival and Migration of Peripheral T and B Cells J. Immunol., November 15, 2005; 175(10): 7021 - 7028. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Svensson, S. Zubairi, A. Maroof, F. Kazi, M. Taniguchi, and P. M. Kaye Invariant NKT Cells Are Essential for the Regulation of Hepatic CXCL10 Gene Expression during Leishmania donovani Infection Infect. Immun., November 1, 2005; 73(11): 7541 - 7547. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. McCord, A. W. O. Burgess, M. J. Whaley, and B. E. Anderson Interaction of Bartonella henselae with Endothelial Cells Promotes Monocyte/Macrophage Chemoattractant Protein 1 Gene Expression and Protein Production and Triggers Monocyte Migration Infect. Immun., September 1, 2005; 73(9): 5735 - 5742. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-J. Anders and P. S. Patole Toll-like receptors recognize uropathogenic Escherichia coli and trigger inflammation in the urinary tract Nephrol. Dial. Transplant., August 1, 2005; 20(8): 1529 - 1532. [Full Text] [PDF]
|
|
|
|
|
|
S. de Haij, A. C. Bakker, R. N. van der Geest, G. Haegeman, W. Vanden Berghe, J. Aarbiou, M. R. Daha, and C. van Kooten NF-{kappa}B Mediated IL-6 Production by Renal Epithelial Cells Is Regulated by C-Jun NH2-Terminal Kinase J. Am. Soc. Nephrol., June 1, 2005; 16(6): 1603 - 1611. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. S. Patole, H.-J. Grone, S. Segerer, R. Ciubar, E. Belemezova, A. Henger, M. Kretzler, D. Schlondorff, and H.-J. Anders Viral Double-Stranded RNA Aggravates Lupus Nephritis through Toll-Like Receptor 3 on Glomerular Mesangial Cells and Antigen-Presenting Cells J. Am. Soc. Nephrol., May 1, 2005; 16(5): 1326 - 1338. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Feulner, M. Lu, JohnM. Shelton, M. Zhang, J. A. Richardson, and R. S. Munford Identification of Acyloxyacyl Hydrolase, a Lipopolysaccharide- Detoxifying Enzyme, in the Murine Urinary Tract Infect. Immun., June 1, 2004; 72(6): 3171 - 3178. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kato, Y. Yuzawa, N. Tsuboi, S. Maruyama, Y. Morita, T. Matsuguchi, and S. Matsuo Endotoxin-Induced Chemokine Expression in Murine Peritoneal Mesothelial Cells: The Role of Toll-Like Receptor 4 J. Am. Soc. Nephrol., May 1, 2004; 15(5): 1289 - 1299. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-J. Anders, B. Banas, and D. Schlondorff Signaling Danger: Toll-Like Receptors and their Potential Roles in Kidney Disease J. Am. Soc. Nephrol., April 1, 2004; 15(4): 854 - 867. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. F. Benjamim, C. M. Hogaboam, and S. L. Kunkel The chronic consequences of severe sepsis J. Leukoc. Biol., March 1, 2004; 75(3): 408 - 412. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. F. Benjamim, C. M. Hogaboam, N. W. Lukacs, and S. L. Kunkel Septic Mice Are Susceptible to Pulmonary Aspergillosis Am. J. Pathol., December 1, 2003; 163(6): 2605 - 2617. [Abstract] [Full Text]
|
|
|
|
|
|
L. A. B. Joosten, M. I. Koenders, R. L. Smeets, M. Heuvelmans-Jacobs, M. M. A. Helsen, K. Takeda, S. Akira, E. Lubberts, F. A. J. van de Loo, and W. B. van den Berg Toll-Like Receptor 2 Pathway Drives Streptococcal Cell Wall-Induced Joint Inflammation: Critical Role of Myeloid Differentiation Factor 88 J. Immunol., December 1, 2003; 171(11): 6145 - 6153. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Bourke, D. Bosisio, J. Golay, N. Polentarutti, and A. Mantovani The toll-like receptor repertoire of human B lymphocytes: inducible and selective expression of TLR9 and TLR10 in normal and transformed cells Blood, August 1, 2003; 102(3): 956 - 963. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. F. Ortega-Cava, S. Ishihara, M. A. K. Rumi, K. Kawashima, N. Ishimura, H. Kazumori, J. Udagawa, Y. Kadowaki, and Y. Kinoshita Strategic Compartmentalization of Toll-Like Receptor 4 in the Mouse Gut J. Immunol., April 15, 2003; 170(8): 3977 - 3985. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
