| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Cancer Research U.K. Institute for Cancer Studies and
Department of Geriatric Medicine, University of Birmingham, Edgbaston, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CMV is a species-specific 
-herpesvirus that is present in the
majority of the population (60–90%) and causes significant disease in
immunocompromised hosts such as stem cell transplant recipients,
HIV-positive subjects, and congenitally infected newborns. However, in
the immunocompetent host, primary infection is usually asymptomatic,
followed by a period of lifelong persistence. Although CMV may enter a
state of viral latency in some cell types, studies in animal models and
immunosuppressed humans suggest that the cellular immune response is a
key component in protection against CMV-related disease
(17, 18, 19). CD8 T cells are particularly important in
controlling viral replication, and the viral gene products pp65 and IE
appear to be the major targets for the CD8 T cell response (reviewed in
Ref. 20).
Work with novel reagents, such as fluorescent HLA-peptide tetramers (21), has shown that the CMV-specific CD8 T cell response can measure up to several percent of the CD8 T cell subset (22). These T cells are often derived from a few clones that have undergone extensive expansion in vivo (11). Phenotypic and functional studies have shown that CMV epitope-specific CD8 T cells are also high in CD57 expression and low in CD28 (22), which implies that these cells are highly differentiated long-lived populations. These data form the basis for our hypothesis that CMV-seropositive elderly individuals will have accumulated high frequencies of oligoclonal CMV epitope-specific CD8 T cells.
HLA-peptide tetramers incorporating immunodominant pp65 epitopes were
used to measure epitope-specific CD8 T cell frequencies and also for
immunophenotyping. TCR -chain V region
(TCRBV)3 usage was
determined with TCRBV mAb and later by sorting tetramer-binding cells
and performing TCRBV family-specific PCR and DNA sequencing. Results
indicate very high frequencies of CMV epitope-specific CD8 T cells in
old age donors, which are monoclonal or oligoclonal. Analyses of total
CD8 subsets in CMV-seropositive and CMV-seronegative donors showed a
higher number of clonal expansions in seropositive donors, suggesting
that CMV indeed plays a major role in driving the host CD8 T cell
repertoire toward oligoclonality.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Study donors were healthy local individuals aged between 60 and 95 years, recruited with formal consent. Initial bleeds were used to screen for CMV status and HLA-A2 and HLA-B7 seropositivity. A latex agglutination kit (CMVScan; BD Biosciences, Oxford, U.K.) determined CMV serostatus using plasma samples. HLA-A*0201+ donors were identified by immunofluorescence using the mouse anti-human HLA-A2 mAb BB7.2 (BD Biosciences). HLA-B*0702+ donors were identified by direct immunofluorescence using a PE-conjugated anti-HLA-B7 mAb (Serotec, Oxford, U.K.). Donors of interest were then selected for further bleeds. These were then tissue typed for HLA class I alleles by the Blood Transfusion Service using DNA extracted from EDTA-blood samples. Volunteers from the laboratory aged 20–55 years were also recruited and used as a control population.
Peptides
CMV pp65 peptides corresponding to residues 495–503 (NLVPMVATV) and 417–426 (TPRVTGGGAM) were synthesized by Research Genetics (Huntsville, AL). Peptides were dissolved in DMSO at a concentration of 5 mg/ml and stored at -20°C.
Generation of HLA-peptide tetramers
HLA-A*0201 and HLA-B*0702 tetramers incorporating pp65 residues 495–503 (NLVPMVATV) and 417–426 (TPRVTGGGAM), respectively, were synthesized using standard methods, as described (21). The HLA-A*0201 and HLA-B*0702 tetramers are hereafter referred to as NLV and TPR tetramers, respectively.
Cell staining with Abs and tetramers
PBMC were isolated from heparinized blood samples by Ficoll density gradient centrifugation (Lymphoprep; Axis Shield, Oslo, Norway). Cells were used immediately or cryopreserved. For staining experiments, 2 x 105 PBMC were incubated with NLV or TPR tetramer at 37°C for 30 min. After washing with PBS (containing 2% FCS), cells were incubated with tricolor-conjugated anti-CD8 mAb (Caltag Laboratories, San Francisco, CA) for another 30 min on ice. Cells were washed and then fixed in PBS containing 2% formaldehyde and 2% FCS. Samples were analyzed on a Coulter Pharmaceutical (Seattle, WA) XL flow cytometer and later using WinMDI version 2.8 software (available from The Scripps Research Institute, website at http://facs.scripps.edu/software.html).
For three-color immunofluorescence, one of a panel of mAb directly conjugated to FITC was added at the same time as the anti-CD8 tricolor Ab. The panel included anti-CD57 (Serotec), anti-CD45RA, anti-CD45RO, anti-CD27, anti-CD28, anti-HLA-DR, anti-CD38, and anti-CD69 (all BD PharMingen, San Diego, CA). TCRBV usage was determined by indirect immunofluorescence. After tetramer staining at 37°C, cells were incubated on ice with saturating amounts of one of a panel of mouse anti-human TCRBV mAb (BV1, BV2, BV3, BV4, BV5.1, BV5.2, BV5.3, BV6.7, BV7, BV8, BV9, BV11, BV12, BV13.1, BV13.6, BV14, BV16, BV17, BV18, BV20, BV21.3, BV22, and BV23; Immunotech, Luminy, France). Cells were washed and then incubated with a goat anti-mouse IgG-FITC mAb (DAKO, Ely, U.K.). Consequently, incubation with the mouse anti-human CD8 tricolor mAb was performed last. Mouse serum (Serotec) was used to block binding of anti-mouse IgG-FITC mAb to the mouse anti-human CD8 mAb. Compensation and isotype controls were conducted simultaneously. PBMC from HLA-matched CMV-seronegative donors and HLA-mismatched CMV-seropositive donors were also used as controls. Tetramer staining did not exceed background levels (<0.02% of CD8 T cells).
ELISPOT for IFN-
ELISPOT assays for peptide-induced IFN--producing cells were
conducted, as described elsewhere (23), using undepleted
PBMC and also PBMC depleted of Ag-specific CD8 T cells by magnetic
selection. Spots were counted and expressed as percentage of PBMC that
produce IFN- in response to peptide.
51Cr release assays
Freshly isolated PBMC of donors with high frequencies of tetramer-binding cells were tested for cytotoxicity in standard 51Cr release assays, as described (24).
Enrichment of Ag-specific T cells
This was conducted using the miniMACS system, according to the
manufacturer’s instructions (Miltenyi Biotec, Bisley, U.K.).
Ag-specific CD8 T cells were enriched to greater than 97% of the
positively selected cell population. These cells were used for RT-PCR,
as described below. Negatively selected cells, depleted of Ag-specific
CD8 T cells, were used alongside nondepleted cells (PBMC) in IFN-
ELISPOT assays as controls.
RNA extraction and cDNA synthesis
RNA from 1–5 x 105 magnetically sorted Ag-specific cells was extracted using TRIzol (Life Technologies, Grand Island, NY), according to the supplier’s instructions, and dissolved in a final volume of 15 µl. cDNA synthesis was performed using the reverse-iT first strand synthesis kit (ABgene, Epsom, U.K.). A total of 11 µl RNA solution was reverse transcribed at 42°C for 1 h using an anchored oligo(dT) primer in a 20 µl final volume.
Molecular cloning and sequencing of TCR from purified tetramer-binding cells
cDNA derived from magnetically selected Ag-specific CD8 T cells
was used as template in PCR with TCRBV and TCR -chain C region
(TCRBC) primers incorporating NotI and
SalI restriction sites, respectively (TCRBV6,
GCATTCAGCTGCGGCCGCAAGGGATCTTTCTCCACCT; TCRBV8,
GCATTCAGCTGCGGCCGCTGAAGATCCAGCCCTCAGAACCC; TCRBV13.1,
GCATTCAGCTGCGGCCGCTCAGGCTGCTGTCGGCTG; TCRBV14,
GCATTCAGCTGCGGCCGCACTGATAAGGGAGATGTTCCTGAAG; and TCRBC,
CGTTTGTCGTCGACCTCCTTCCCATTCACC). For TCR 
-chain analysis, cDNA
was poly(G) tailed using TdT and used as template for anchor PCR using
a 3'C primer containing a SalI site
(TGACCGCAGTCGACAGACTTGTCACTGGATT) and a 5'poly(C) primer containing a
NotI site (GCATTCAGCTGCGGCCGCCCCCCCCCCCCCCC), as
described elsewhere (25). PCR amplifications were
performed in 50 µl reaction volumes containing 50 mM KCl, 10 mM
Tris-HCl (pH 8.5), 2.5 mM MgCl2, 0.5% DMSO, 10
mM dNTPs, 1.0 µM each primer, and 1 U AmpliTaq DNA polymerase
(PerkinElmer, Wellesley, MA). PCR parameters used were: 5-min initial
denaturation at 94°C, then 5 cycles of 94°C (1 min), 65°C (1
min), and 72°C (2 min), followed by 30 cycles of 94°C (1 min),
58°C (1 min), 72°C (2 min), and a final extension of 72°C for 5
min. Products were purified and then digested overnight with
NotI and SalI restriction enzymes (Roche,
Lewes, U.K.). The digested PCR products were then cloned into M13
phagescript (Stratagene, La Jolla, CA) and sequenced using a Bigdye DNA
sequencing kit (PE Applied Biosystems, Foster City, CA).
Clonotype analysis by denaturing gradient gel electrophoresis (DGGE)
For clonotype analysis of total CD8 subsets in CMV-seropositive
and CMV-seronegative donors, 
10 x 106
PBMC were depleted of CD4 T cells using CD4 dynabeads (Dynal,
Wirral, U.K.). cDNA was synthesized from CD8-enriched PBMC, as
described above, and used as template for PCR using primers specific
for TCRBV regions 1–24 (26) together with the
GC-clamped TCRBC primer. PCR amplifications were performed in 30
µl reaction volumes containing 50 mM KCl, 10 mM Tris-HCl (pH 9.0),
1.5 mM MgCl2, 0.5% DMSO, 10 M dNTPs, 0.5 µM
each primer, and 1 U AmpliTaq DNA polymerase (PerkinElmer). PCR
parameters used were: 1-min initial denaturation at 94°C, then 40
cycles of 94°C (30 s), 60°C (30 s), and 72°C (40 s), followed by
final extension of 72°C for 5 min. DGGE analysis was conducted using
12 µl PCR product, as described by thor Straten et al.
(26). Gels contained 6% polyacrylamide (Acrylogel
S solution; BDH-Merck, Poole, U.K.) and a gradient of urea
(Sigma-Aldrich, St. Louis, MO) and formamide (Fluka, Gillingham,
U.K.) from 20–80%, and were run at 160 V for 4.5 h in 1 x
TAE (0.04 M Tris-HCl, 0.04 M acetate, 1 µM EDTA, pH 8.3) running
buffer maintained at 58°C in a temperature-controlled bath. Gels were
then stained with ethidium bromide and visualized under UV light. Each
visible discreet band was interpreted as a clonal expansion and
recorded. The reproducibility was very good, as indicated by gels
loaded with independent PCR products on separate occasions.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Of the 100 healthy subjects recruited, 56 donors were either
HLA-A*0201+ and/or
HLA-B*0702+ (38 donors were
HLA-A*0201+, 32 were
HLA-B*0702+, and 14 were both
HLA-A*0201+ and
HLA-B*0702+). Thirty-two of these fifty-six
donors were CMV seropositive (57%). Tetramer staining was performed on
these donors using the two tetramers (named A2-NLV and B7-TPR), and the
results are shown in Table I
. PBMC from
CMV-seronegative individuals or donors of irrelevant HLA type did not
stain more than background (0.02% of CD8 T cells). Fig. 1A shows tetramer-staining
profiles of selected donors. Where possible, donors were studied at six
monthly intervals and tetramer staining was repeated. Donors aged
20–55 were bled as a control group and tested in the same way. Fig. 1B shows a comparison of the tetramer-staining profiles of
the two groups of donors.
|
|
Data from experiments with the two tetramers were pooled and compared between the age groups for differences. The observed difference in CMV tetramer staining was found to be statistically significant (p < 0.003) using the Mann-Whitney U test. This supported our hypothesis that higher frequencies of CMV epitope-specific T cells can be detected in older individuals.
Functional analysis of CMV epitope-specific CD8 T cells in old age donors
Tetramer staining can accurately determine the frequency of CMV
epitope-specific CD8 T cells, but does not provide information on the
functions of such cells. One such function is the production of
IFN-, and this can be measured using the ELISPOT method. We
conducted ELISPOTs using PBMC incubated with the two immunodominant
peptides NLV and TPR. By indirect calculation, between 5 and 60% (mean
35%) of tetramer-binding cells were able to produce IFN- (Fig. 2A), demonstrating that a
large proportion of Ag-specific cells is indeed functional. Similar
values have been reported with other Ag (23) and
demonstrate that not all Ag-specific CD8 T cells are able to produce
IFN- in an in vitro assay.
|
) and so were expected to demonstrate lysis at E:T ratios
without enrichment of Ag-specific T cells. Our results demonstrated
that cells from two of the three CMV-seropositive donors were
cytotoxic, as significantly high levels of lysis were observed using
LCL targets loaded with the relevant peptide with minimal lysis against
irrelevant peptide or DMSO. No killing was observed in assays using the
seronegative donor (Fig. 2B). These results confirmed that
elderly individuals possess circulating CMV-specific CD8 T cells that
are functional through both cytolytic and noncytolytic mechanisms. Phenotypic analysis of CMV-specific CD8 T cells
The cell surface phenotype of tetramer-binding cells was studied
using three-color immunofluorescence. The complete data are displayed
in the table section of Fig. 3 with flow
cytometric plots from two selected donors also shown. With regard to
the membrane tyrosine phosphatase CD45, tetramer-staining binding cells
generally expressed more of the high m.w. isoform CD45RA than the low
m.w. isoform CD45RO. CMV-specific CD8 T cells from all donors tested
were predominantly CCR7-, implying that they are
mainly effector memory cells according to a recent model
(27). Tetramer-binding cells are also largely
CD57+, which is a marker that represents an
increased fraction of the CD8 T cell subset in CMV-seropositive donors.
Lack of CD27 and CD28 expression is thought to mark highly
differentiated long-lived populations, and in all but one case (as
described later) tetramer-binding cells were mainly
CD28-. CD27 expression patterns were not as
polarized, although generally most donors had more
CD27- cells than CD27+.
Staining with CD69, HLA-DR, and CD38 was conducted to determine whether
tetramer-staining cells had a phenotype associated with activated T
cells, but the vast majority (>90%) of cells were negative for all
three markers. Intracellular staining revealed that the majority of
tetramer-binding cells expressed high levels of perforin, indicative of
cytotoxicity. Furthermore, there was high expression of Bcl-2 and
minimal ki67, implying resistance to apoptosis and low levels of
proliferation, respectively. So the common feature was that the
majority of CMV epitope-specific CD8 T cells were highly differentiated
effector memory T cells, although not activated and not in cell
cycle.
|
B). The level of TPR tetramer staining in this
donor fell over a period of 12 mo from 12 to 4% of CD8 T cells. It is
possible that this donor was only recently infected with CMV and the
12% observed early on was in fact the initial expansion during a
primary immune response. Between the second and third bleeds, the drop
in staining may have reflected culling of TPR-specific CD8 T cells.
Unfortunately, cells from the early time points were not available for
Bcl-2 staining to confirm this. TCR usage
TCRBV expression of tetramer-binding cells was initially studied
using TCRBV-specific mAb. For A2-NLV tetramer binding, our results
showed that a few common -chains were used (Fig. 4A). The most commonly
expressed -chain was TCRBV13.1, and other -chains used were
TCRBV14, TCRBV8, TCRBV20, TCRBV3, TCRBV22, and TCRBV6.7.
TCRBV13.1 was also the predominant -chain used in donors with larger
tetramer-staining populations (Fig. 4C).
|
). This differs by only 2 aa in the
complementarity-determining region 3 (CDR3) of a published clonotype
with identical J segment and C region (11). Donor 001
appeared to use this common BV13.1 clonotype exclusively, as all
recombinant plaques sequenced were the same. In contrast, two TCRBV13.1
transcripts were identified in donors 002, 004, and 005. Donors 004 and
005 also used TCRBV8 and TCRBV14, respectively, and it was discovered
that these also included just one or two transcripts.
|
-chain involved (Fig. 4B). For the other 6 donors, B7-TPR tetramer-staining cells
were purified magnetically and used for RT-PCR with TCRBV-specific
primers. In each case, PCR product was observed in the reaction with
BV6 primer. Sequencing of the TCRBV6 PCR products showed that 5 of 6
donors appeared to use a single TCRBV6.4 sequence (Table II). In 2
donors (025 and 029), this sequence differed by only 1 aa in the CDR3
region. The transcript used by donor 025 was compared with a series of
published clonotypes (11) and found to match one
common clonotype exactly at the nucleotide level. The other four
donors used quite different TCRBV6.4 clonotypes, of which two were very
similar (donor 027 and 041) to reported sequences.
Analysis of TCR -chain V region (TCRAV) usage was also carried in
three donors (025, 040, and 041). Results from anchor PCR showed that
there was also restriction in TCRAV sequence, which displayed homology
with those reported elsewhere (11). Two donors used a
single TCRAV transcript (donors 025 and 040 used TCRAV3.1 and
TCRAV16.1, respectively), and the third donor used two transcripts
(TCRAV6.1 and TCRAV16.1), which only differed by a few amino acids in
the CDR3 region (Table II). Interestingly, although different TCRAV
usage was observed between individuals, there was conservation of usage
of the TCRAJ segment, which is a common pattern for Ag-specific
CD8 T cell clones (28). Combined with the data on TCRBV
usage, this showed that CMV-specific CD8 T cells were composed of a few
clones that had undergone massive expansion in vivo.
Analysis of CD8 T cell clonality between CMV-seropositive and CMV-seronegative donors
As we had shown that individual CMV epitope-specific CD8 T cells
could represent up to 23% of the total CD8 subset and that these were
often oligoclonal, it was felt likely that such populations could
represent a major contribution to the clonal CD8 repertoire that is
observed in elderly individuals. Therefore, we asked whether there was
a difference in total numbers of clonal expansions between individuals
who have been exposed to CMV and those who have not. This comparison
was made using CD8-enriched PBMC after depletion of CD4 T cells by
magnetic selection (CD4 T cells were less than 1% of negatively
selected cells), RT-PCR of TCR sequences, and subsequent clonotype
analysis by DGGE, a method that can differentiate reliably between DNA
sequences with different sequences. Initial experiments confirmed the
validity of the technique using both cloned TCRBV DNA and polyclonal T
cell populations such as CD4 T cells derived from a young donor (both
CMV and EBV seronegative). Clonal expansions are represented by the
presence of a discreet band due to the abundance of identical DNA
molecules derived from a T cell clone in a background of other
different T cells. The absence of any bands is interpreted as a
population being polyclonal and not containing significantly large
clonal expansions. The sensitivity of detection of a clonal band was
determined using cDNA from serial dilutions of a T cell clone in a
polyclonal background (purified CD4 T cells derived from a healthy
laboratory donor). In our hands, the detection limit was 10% of a
given TCRBV subset (not shown), which can represent between 0.2 and
0.5% of CD8 T cells.
Seven CMV-seropositive and seven CMV-seronegative donors were studied,
and examples of gels are shown in Fig. 5A. Bands were counted in each
donor (Fig. 5B), and the results demonstrate that a
significantly greater number of clonal expansions are observed in
seropositive donors (mean 23.9) than in seronegative donors (mean 16.9)
(p = 0.03). The difference between the means
shows that over 30% more clonal expansions are observed in
seropositive donors.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The use of fluorescent HLA-peptide tetramers allowed us to demonstrate
that CMV epitope-specific CD8 T cells do indeed contribute a large
fraction of the CD8 repertoire in elderly humans. The average frequency
of CD8 T cells recognized by the two tetramers used in this study was
1.4 and 4.1%, respectively, but in several individuals staining was
over 5% of all CD8 T cells. In one donor, 23% of CD8 T cells were
specific for a single CMV epitope, and this is among the highest
reported CD8 T cell frequency for any Ag outside the setting of acute
viral infection. We also measured responses to a recently discovered
IE-1 epitope restricted by HLA-B*0702 (30) in some of our
donors using the IFN- ELISPOT assay, as we were unable to generate
the tetramer. Extremely high responses were observed, and these often
exceeded those against the pp65 epitope TPR (data not shown). Together
these data reinforce the view that CMV may be the most immunodominant
of the human viruses (31).
As previously reported in younger donors (22), higher frequencies of B7-TPR-specific CD8 T cells are detected in comparison with A2-NLV-specific CD8 T cells. This immunodominance of the B7-TPR epitope is particularly marked in HLA-A*0201+/HLA-B*0702+ donors in whom these lowest levels of A2-NLV-specific cells were seen. The reasons for this extreme immunodominance are not clear, but may include higher frequencies of naive precursor cells before CMV exposure or differences in processing that result in higher levels of TPR peptide than NLV peptide on the surface of infected cells. Wide variation was seen in the frequency of tetramer staining between individuals, and this is likely to reflect factors such as HLA type, duration of seropositivity, or viral strain differences.
How such large expansions arise is currently unclear. CMV is never cleared by the host, and although transcriptional viral latency may play a role in persistence (32), it is believed by some that periodical viral reactivation is quite common (33). This could lead to repeated stimulation of cognate T cells and the eventual accumulation of large populations of CMV-specific CTL. Whether such reactivations occur more frequently with aging is unknown, although the higher prevalence of CMV-specific IgM serology in the elderly suggests that this may indeed be the case (34).
One striking observation in the study was the phenotype of CMV-specific CTL. First, there was less heterogeneity than reported previously (22). Second, with the exception of donor 040, the phenotype was that of highly differentiated effector CTL that are perforin+, which has previously only been reported as the dominant phenotype in immunosuppressed patients (35). Donor 040 had CTL with a less differentiated phenotype, and interestingly, ex vivo peptide-specific cytotoxicity could not be demonstrated in this case. Such properties of perforin- T cells have been reported previously (36). It is possible that this donor had experienced a recent primary infection, as the gradual development of CD8 T cells from a CD57- phenotype to CD57+ phenotype has been documented following primary infection (37).
The phenotype of the CMV-specific CTL supports the notion that the general increase in size of the CD57+ CD28- T cell subset observed in old age donors may largely reflect increases in CMV-specific CD8 T cell frequencies. This phenotype has been reported in other settings such as rheumatoid arthritis and HIV-1 infection (38, 39) and may be associated with the presence of increases in CMV-specific CTL. There was a common picture of high CD45RA expression with lower levels of CD45RO, indicating probable reversion of Ag-experienced CTL from a CD45RO+ state back to a CD45RA+ phenotype (40, 41). Furthermore, CTL displayed minimal levels of recent T cell activation markers and did not appear to be in cell cycle. These populations may indeed be poorly proliferative, as others have indicated that CD28- T cells have a distinct replicative history and shorter telomeres than CD28+ T cells (39, 42, 43).
A recent report indicated that, in contrast to what we have demonstrated for CD8 immunity to CMV, the varicella zoster virus-specific CD4 T cell response in old age donors was actually smaller than that seen in young donors (44). This difference may perhaps be explained by the site of viral persistence for varicella zoster virus being in a nonprofessional APC. It would be of great interest to determine the CD4 response against CMV in our elderly population. Indeed, absolute CD4 counts do diminish with aging, and CD4 hyporesponsiveness is well documented in such individuals (45). We have also observed that CMV-specific T cells are uniformly bcl-2+, indicating resistance to apoptosis, which is reminiscent of cells that have reached replicative senescence in cell culture (46). Whether immune homeostatic mechanisms are dysfunctional is unclear from our data, but arguable considering the reported decline in IL-2 production by CD4 T cells with age (45). This may result in diminished Ag-induced cell death of virus-specific cells during the resolution of an immune response later in life, leading to a persistence of CD8 T cell clones.
Analysis of TCR usage indicated that CMV-specific T cells were
invariably oligoclonal, with several cases showing a single T cell
comprising over 90% of the total population. The data confirm that
CMV-specific CTL can undergo dramatic expansion in vivo
(11). Moreover, when the clonality of CMV-specific
populations was correlated with the magnitude of each expansion, it was
clear that the larger expansions were more restricted in their
clonality than smaller expansions. NLV tetramer-binding cells in donors
001 and 002 represented 8.5 and 7% of the CD8 population and were
dominated by a single TCR -chain in both cases. In contrast, those
donors with lower frequencies of NLV-specific CTL had more heterogenous
clonality with at least three sizeable clones. These data imply that
clonal selection occurs during infection, possibly as a result of
competition for Ag on APC.
TCR sequence analysis showed some conservation of TCR usage between different donors, although this was not as marked as observed with certain other viral epitopes (9, 10). Interestingly, comparison of TCR sequences isolated from this study with those reported in a group of younger donors shows great similarities (11). This suggests that the same T cells that are stimulated upon initial presentation of CMV Ag during primary infection may well be maintained in the repertoire throughout the lifetime of the host. This would argue against a major role for immune exhaustion (47) in the immune response to these peptides.
Comparisons of the global CD8 repertoires of CMV-seropositive and CMV-seronegative donors showed that CMV-seropositive individuals have, on average, seven more CD8 T cell expansions than CMV-seronegative persons. This equates to 32% more clonal expansions than the seronegative donors, suggesting that CMV seropositivity may contribute significantly to the development of clonal CD8 T cells with aging.
One problem with this interpretation is the limited knowledge of actual clone size as a proportion of the CD8 repertoire. The presence of larger clonal expansions may result in the presence of fewer clonal bands than in other cases in which smaller expansions exist due to homeostatic constraints. Moreover, the Ag specificity of this excess number of clones was not determined; however, the observation that individual CMV epitope-specific responses can comprise several percent of the CD8 T cell subset and are invariably oligoclonal suggests that such clones may indeed be CMV specific. Further detailed analysis should be conducted to confirm this hypothesis.
The finding that such a large proportion of the CD8 T cell subset can be focused on a single virus is of some surprise. Whether such a high investment in the CD8 T cell repertoire to a single pathogen is detrimental to the host remains unclear, although it is possible that it may impair the efficiency of immune response to other Ag. In this case, CMV-seropositive individuals may be at greater risk of morbidity and mortality from heterologous infections such as influenza. Although such an idea may appear exaggerated, recent epidemiological evidence has indeed identified CMV seropositivity as being associated with shortened survival in very elderly individuals (16). Our data provide one potential explanation for this finding, and together these data suggest that we may need to reconsider our current views on the benign nature of CMV carriage. In this case, greater attention may need to be given toward control of CMV replication in the general population, either by vaccination or perhaps drug therapy.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Paul A. H. Moss, Cancer Research U.K. Institute for Cancer Studies, University of Birmingham, Edgbaston B13 2TA U.K. E-mail address: mossp{at}cancer.bham.ac.uk
3 Abbreviations used in this paper: TCRBV, TCR -chain V region; CDR, complementarity-determining region; DGGE, denaturing gradient gel electrophoresis; LCL, lymphoblastoid cell line; TCRAV, TCR -chain V region; TCRBC, TCR -chain C region.
Received for publication March 13, 2002. Accepted for publication May 31, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
17 gene segment. J. Exp. Med. 181:79.-chain repertoire and demonstration of a genetic influence on V usage. Eur. J. Immunol. 23:1153.[Medline]
- T cell clonality by denaturing gradient gel electrophoresis (DGGE). BioTechniques 25:244.[Medline]
This article has been cited by other articles:
|
|
 |
|
  P. G. Stevenson, J. P. Simas, and S. Efstathiou Immune control of mammalian gamma-herpesviruses: lessons from murid herpesvirus-4 J. Gen. Virol., October 1, 2009; 90(10): 2317 - 2330. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Cantisan, J. Torre-Cisneros, R. Lara, A. Rodriguez-Benot, F. Santos, J. Gutierrez-Aroca, I. Gayoso, M. Gonzalez-Padilla, M. Casal, A. Rivero, et al. Age-Dependent Association between Low Frequency of CD27/CD28 Expression on pp65 CD8+ T Cells and Cytomegalovirus Replication after Transplantation Clin. Vaccine Immunol., October 1, 2009; 16(10): 1429 - 1438. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Henson, O. Franzese, R. Macaulay, V. Libri, R. I. Azevedo, S. Kiani-Alikhan, F. J. Plunkett, J. E. Masters, S. Jackson, S. J. Griffiths, et al. KLRG1 signaling induces defective Akt (ser473) phosphorylation and proliferative dysfunction of highly differentiated CD8+ T cells Blood, June 25, 2009; 113(26): 6619 - 6628. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Babel, G. Brestrich, L. P. Gondek, A. Sattler, M. W. Wlodarski, N. Poliak, N. Bethke, A. Thiel, M. H. Hammer, P. Reinke, et al. Clonotype Analysis of Cytomegalovirus-Specific Cytotoxic T Lymphocytes J. Am. Soc. Nephrol., February 1, 2009; 20(2): 344 - 352. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Ahmed, K. G. Lanzer, E. J. Yager, P. S. Adams, L. L. Johnson, and M. A. Blackman Clonal Expansions and Loss of Receptor Diversity in the Naive CD8 T Cell Repertoire of Aged Mice J. Immunol., January 15, 2009; 182(2): 784 - 792. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Crough and R. Khanna Immunobiology of Human Cytomegalovirus: from Bench to Bedside Clin. Microbiol. Rev., January 1, 2009; 22(1): 76 - 98. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Simone, A. Zicca, and D. Saverino The frequency of regulatory CD3+CD8+CD28-CD25+ T lymphocytes in human peripheral blood increases with age J. Leukoc. Biol., December 1, 2008; 84(6): 1454 - 1461. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Venturi, H. Y. Chin, T. E. Asher, K. Ladell, P. Scheinberg, E. Bornstein, D. van Bockel, A. D. Kelleher, D. C. Douek, D. A. Price, et al. TCR {beta}-Chain Sharing in Human CD8+ T Cell Responses to Cytomegalovirus and EBV J. Immunol., December 1, 2008; 181(11): 7853 - 7862. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Palendira, R. Chinn, W. Raza, K. Piper, G. Pratt, L. Machado, A. Bell, N. Khan, A. D. Hislop, R. Steyn, et al. Selective accumulation of virus-specific CD8+ T cells with unique homing phenotype within the human bone marrow Blood, October 15, 2008; 112(8): 3293 - 3302. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Caligaris-Cappio and P. Ghia Novel Insights in Chronic Lymphocytic Leukemia: Are We Getting Closer to Understanding the Pathogenesis of the Disease? J. Clin. Oncol., September 20, 2008; 26(27): 4497 - 4503. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Venturi, H. Y. Chin, D. A. Price, D. C. Douek, and M. P. Davenport The Role of Production Frequency in the Sharing of Simian Immunodeficiency Virus-Specific CD8+ TCRs between Macaques J. Immunol., August 15, 2008; 181(4): 2597 - 2609. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. B. Walker, D. Haley, U. Petrausch, K. Floyd, W. Miller, N. Sanjuan, G. Alvord, B. A. Fox, and W. J. Urba Phenotype and Functional Characterization of Long-term gp100-Specific Memory CD8+ T Cells in Disease-Free Melanoma Patients Before and After Boosting Immunization Clin. Cancer Res., August 15, 2008; 14(16): 5270 - 5283. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Pitard, D. Roumanes, X. Lafarge, L. Couzi, I. Garrigue, M.-E. Lafon, P. Merville, J.-F. Moreau, and J. Dechanet-Merville Long-term expansion of effector/memory V{delta}2- {gamma}{delta} T cells is a specific blood signature of CMV infection Blood, August 15, 2008; 112(4): 1317 - 1324. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Walton, P. Wyrsch, M. W. Munks, A. Zimmermann, H. Hengel, A. B. Hill, and A. Oxenius The Dynamics of Mouse Cytomegalovirus-Specific CD4 T Cell Responses during Acute and Latent Infection J. Immunol., July 15, 2008; 181(2): 1128 - 1134. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Jilek, M. Schluep, P. Meylan, F. Vingerhoets, L. Guignard, A. Monney, J. Kleeberg, G. Le Goff, G. Pantaleo, and R. A. Du Pasquier Strong EBV-specific CD8+ T-cell response in patients with early multiple sclerosis Brain, July 1, 2008; 131(7): 1712 - 1721. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Bourgeois, Z. Hao, K. Rajewsky, A. J. Potocnik, and B. Stockinger Ablation of thymic export causes accelerated decay of naive CD4 T cells in the periphery because of activation by environmental antigen PNAS, June 24, 2008; 105(25): 8691 - 8696. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. K. Wynn, Z. Fulton, L. Cooper, S. L. Silins, S. Gras, J. K. Archbold, F. E. Tynan, J. J. Miles, J. McCluskey, S. R. Burrows, et al. Impact of clonal competition for peptide-MHC complexes on the CD8+ T-cell repertoire selection in a persistent viral infection Blood, April 15, 2008; 111(8): 4283 - 4292. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Larbi, C. Franceschi, D. Mazzatti, R. Solana, A. Wikby, and G. Pawelec Aging of the Immune System as a Prognostic Factor for Human Longevity Physiology, April 1, 2008; 23(2): 64 - 74. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Crompton, N. Khan, R. Khanna, L. Nayak, and P. A. H. Moss CD4+ T cells specific for glycoprotein B from cytomegalovirus exhibit extreme conservation of T-cell receptor usage between different individuals Blood, February 15, 2008; 111(4): 2053 - 2061. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Gros, M. Pelegrin, H.-A. Michaud, S. Bianco, J. Hernandez, C. Jacquet, and M. Piechaczyk Endogenous Cytotoxic T-Cell Response Contributes to the Long-Term Antiretroviral Protection Induced by a Short Period of Antibody-Based Immunotherapy of Neonatally Infected Mice J. Virol., February 1, 2008; 82(3): 1339 - 1349. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. H. Lemster, J. J. Michel, D. T. Montag, J. J. Paat, S. A. Studenski, A. B. Newman, and A. N. Vallejo Induction of CD56 and TCR-Independent Activation of T Cells with Aging J. Immunol., February 1, 2008; 180(3): 1979 - 1990. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. R. Sompuram, G. Bastas, K. Vani, and S. A. Bogen Accurate identification of paraprotein antigen targets by epitope reconstruction Blood, January 1, 2008; 111(1): 302 - 308. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. H. Ely, M. Ahmed, J. E. Kohlmeier, A. D. Roberts, S. T. Wittmer, M. A. Blackman, and D. L. Woodland Antigen-Specific CD8+ T Cell Clonal Expansions Develop from Memory T Cell Pools Established by Acute Respiratory Virus Infections J. Immunol., September 15, 2007; 179(6): 3535 - 3542. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Vescovini, C. Biasini, F. F. Fagnoni, A. R. Telera, L. Zanlari, M. Pedrazzoni, L. Bucci, D. Monti, M. C. Medici, C. Chezzi, et al. Massive Load of Functional Effector CD4+ and CD8+ T Cells against Cytomegalovirus in Very Old Subjects J. Immunol., September 15, 2007; 179(6): 4283 - 4291. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. R. Humphreys, A. Loewendorf, C. de Trez, K. Schneider, C. A. Benedict, M. W. Munks, C. F. Ware, and M. Croft OX40 Costimulation Promotes Persistence of Cytomegalovirus-Specific CD8 T Cells: A CD4-Dependent Mechanism J. Immunol., August 15, 2007; 179(4): 2195 - 2202. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Heffner and D. T. Fearon Loss of T cell receptor-induced Bmi-1 in the KLRG1+ senescent CD8+ T lymphocyte PNAS, August 14, 2007; 104(33): 13414 - 13419. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Pourgheysari, N. Khan, D. Best, R. Bruton, L. Nayak, and P. A. H. Moss The Cytomegalovirus-Specific CD4+ T-Cell Response Expands with Age and Markedly Alters the CD4+ T-Cell Repertoire J. Virol., July 15, 2007; 81(14): 7759 - 7765. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. M. Brennan, J. J. Miles, S. L. Silins, M. J. Bell, J. M. Burrows, and S. R. Burrows Predictable {alpha}{beta} T-Cell Receptor Selection toward an HLA-B*3501-Restricted Human Cytomegalovirus Epitope J. Virol., July 1, 2007; 81(13): 7269 - 7273. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Wodarz, S. Sierro, and P. Klenerman Dynamics of killer T cell inflation in viral infections J R Soc Interface, June 22, 2007; 4(14): 533 - 543. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. J. Plunkett, O. Franzese, H. M. Finney, J. M. Fletcher, L. L. Belaramani, M. Salmon, I. Dokal, D. Webster, A. D. G. Lawson, and A. N. Akbar The Loss of Telomerase Activity in Highly Differentiated CD8+CD28-CD27- T Cells Is Associated with Decreased Akt (Ser473) Phosphorylation J. Immunol., June 15, 2007; 178(12): 7710 - 7719. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. C. Miles, M. van der Sande, D. Jeffries, S. Kaye, J. Ismaili, O. Ojuola, M. Sanneh, E. S. Touray, P. Waight, S. Rowland-Jones, et al. Cytomegalovirus Infection in Gambian Infants Leads to Profound CD8 T-Cell Differentiation J. Virol., June 1, 2007; 81(11): 5766 - 5776. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. N. Akbar and M. Vukmanovic-Stejic Telomerase in T Lymphocytes: Use It and Lose It? J. Immunol., June 1, 2007; 178(11): 6689 - 6694. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Khan, D. Best, R. Bruton, L. Nayak, A. B. Rickinson, and P. A. H. Moss T Cell Recognition Patterns of Immunodominant Cytomegalovirus Antigens in Primary and Persistent Infection J. Immunol., April 1, 2007; 178(7): 4455 - 4465. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. Miles, N. A. Borg, R. M. Brennan, F. E. Tynan, L. Kjer-Nielsen, S. L. Silins, M. J. Bell, J. M. Burrows, J. McCluskey, J. Rossjohn, et al. TCR{alpha} Genes Direct MHC Restriction in the Potent Human T Cell Response to a Class I-Bound Viral Epitope J. Immunol., November 15, 2006; 177(10): 6804 - 6814. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Le Priol, D. Puthier, C. Lecureuil, C. Combadiere, P. Debre, C. Nguyen, and B. Combadiere High Cytotoxic and Specific Migratory Potencies of Senescent CD8+CD57+ Cells in HIV-Infected and Uninfected Individuals J. Immunol., October 15, 2006; 177(8): 5145 - 5154. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R Dawes, B Hennig, W Irving, S Petrova, S Boxall, V Ward, D Wallace, D C Macallan, M Thursz, A Hill, et al. Altered CD45 expression in C77G carriers influences immune function and outcome of hepatitis C infection J. Med. Genet., August 1, 2006; 43(8): 678 - 684. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Matsumoto, H. Matsuo, H. Sakuma, I.-K. Park, Y. Tsukada, K. Kohyama, T. Kondo, S. Kotorii, and N. Shibuya CDR3 Spectratyping Analysis of the TCR Repertoire in Myasthenia Gravis. J. Immunol., April 15, 2006; 176(8): 5100 - 5107. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. F. Stone, P. Price, and M. A. French Cytomegalovirus (CMV)-specific CD8+ T cells in individuals with HIV infection: correlation with protection from CMV disease J. Antimicrob. Chemother., April 1, 2006; 57(4): 585 - 588. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. W. Munks, M. C. Gold, A. L. Zajac, C. M. Doom, C. S. Morello, D. H. Spector, and A. B. Hill Genome-Wide Analysis Reveals a Highly Diverse CD8 T Cell Response to Murine Cytomegalovirus J. Immunol., March 15, 2006; 176(6): 3760 - 3766. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. R. Hadrup, J. Strindhall, T. Kollgaard, T. Seremet, B. Johansson, G. Pawelec, P. thor Straten, and A. Wikby Longitudinal Studies of Clonally Expanded CD8 T Cells Reveal a Repertoire Shrinkage Predicting Mortality and an Increased Number of Dysfunctional Cytomegalovirus-Specific T Cells in the Very Elderly J. Immunol., February 15, 2006; 176(4): 2645 - 2653. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Fletcher, M. Vukmanovic-Stejic, P. J. Dunne, K. E. Birch, J. E. Cook, S. E. Jackson, M. Salmon, M. H. Rustin, and A. N. Akbar Cytomegalovirus-Specific CD4+ T Cells in Healthy Carriers Are Continuously Driven to Replicative Exhaustion J. Immunol., December 15, 2005; 175(12): 8218 - 8225. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. Miles, S. L. Silins, A. G. Brooks, J. E. Davis, I. Misko, and S. R. Burrows T-cell grit: large clonal expansions of virus-specific CD8+ T cells can dominate in the peripheral circulation for at least 18 years Blood, December 15, 2005; 106(13): 4412 - 4413. [Full Text] [PDF]
|
|
|
|
|
|
O. Norbeck, A. Isa, C. Pohlmann, K. Broliden, V. Kasprowicz, P. Bowness, P. Klenerman, and T. Tolfvenstam Sustained CD8+ T-Cell Responses Induced after Acute Parvovirus B19 Infection in Humans J. Virol., September 15, 2005; 79(18): 12117 - 12121. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. W. Sylwester, B. L. Mitchell, J. B. Edgar, C. Taormina, C. Pelte, F. Ruchti, P. R. Sleath, K. H. Grabstein, N. A. Hosken, F. Kern, et al. Broadly targeted human cytomegalovirus-specific CD4+ and CD8+ T cells dominate the memory compartments of exposed subjects J. Exp. Med., September 6, 2005; 202(5): 673 - 685. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Marleau and N. Sarvetnick T cell homeostasis in tolerance and immunity J. Leukoc. Biol., September 1, 2005; 78(3): 575 - 584. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Guitart Beyond Clonal Detection: Defining the T-Cell Clone Arch Dermatol, September 1, 2005; 141(9): 1159 - 1160. [Full Text] [PDF]
|
|
|
|
|
|
D. Herndler-Brandstetter, S. Schwaiger, E. Veel, C. Fehrer, D. P. Cioca, G. Almanzar, M. Keller, G. Pfister, W. Parson, R. Wurzner, et al. CD25-Expressing CD8+ T Cells Are Potent Memory Cells in Old Age J. Immunol., August 1, 2005; 175(3): 1566 - 1574. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. Dunne, L. Belaramani, J. M. Fletcher, S. F. de Mattos, M. Lawrenz, M. V. D. Soares, M. H. A. Rustin, E. W.-F. Lam, M. Salmon, and A. N. Akbar Quiescence and functional reprogramming of Epstein-Barr virus (EBV)-specific CD8+ T cells during persistent infection Blood, July 15, 2005; 106(2): 558 - 565. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Wikby, F. Ferguson, R. Forsey, J. Thompson, J. Strindhall, S. Lofgren, B.-O. Nilsson, J. Ernerudh, G. Pawelec, and B. Johansson An Immune Risk Phenotype, Cognitive Impairment, and Survival in Very Late Life: Impact of Allostatic Load in Swedish Octogenarian and Nonagenarian Humans J. Gerontol. A Biol. Sci. Med. Sci., May 1, 2005; 60(5): 556 - 565. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Almanzar, S. Schwaiger, B. Jenewein, M. Keller, D. Herndler-Brandstetter, R. Wurzner, D. Schonitzer, and B. Grubeck-Loebenstein Long-Term Cytomegalovirus Infection Leads to Significant Changes in the Composition of the CD8+ T-Cell Repertoire, Which May Be the Basis for an Imbalance in the Cytokine Production Profile in Elderly Persons J. Virol., March 15, 2005; 79(6): 3675 - 3683. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Redwood, M. Messerle, N. L. Harvey, C. M. Hardy, U. H. Koszinowski, M. A. Lawson, and G. R. Shellam Use of a Murine Cytomegalovirus K181-Derived Bacterial Artificial Chromosome as a Vaccine Vector for Immunocontraception J. Virol., March 1, 2005; 79(5): 2998 - 3008. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Khan, A. Hislop, N. Gudgeon, M. Cobbold, R. Khanna, L. Nayak, A. B. Rickinson, and P. A. H. Moss Herpesvirus-Specific CD8 T Cell Immunity in Old Age: Cytomegalovirus Impairs the Response to a Coresident EBV Infection J. Immunol., December 15, 2004; 173(12): 7481 - 7489. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Ehrchen, A. Sindrilaru, S. Grabbe, F. Schonlau, C. Schlesiger, C. Sorg, K. Scharffetter-Kochanek, and C. Sunderkotter Senescent BALB/c Mice Are Able To Develop Resistance to Leishmania major Infection Infect. Immun., September 1, 2004; 72(9): 5106 - 5114. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. L. Wallace, Y. Zhang, H. Ghattas, A. Worth, A. Irvine, A. R. Bennett, G. E. Griffin, P. C. L. Beverley, D. F. Tough, and D. C. Macallan Direct Measurement of T Cell Subset Kinetics In Vivo in Elderly Men and Women J. Immunol., August 1, 2004; 173(3): 1787 - 1794. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. M. M. van Leeuwen, E. B. M. Remmerswaal, M. T. M. Vossen, A. T. Rowshani, P. M. E. Wertheim-van Dillen, R. A. W. van Lier, and I. J. M. ten Berge Emergence of a CD4+CD28- Granzyme B+, Cytomegalovirus-Specific T Cell Subset after Recovery of Primary Cytomegalovirus Infection J. Immunol., August 1, 2004; 173(3): 1834 - 1841. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. G. Blount, P. R. Heaton, and D. I. Pritchard Changes to Levels of DNA Damage and Apoptotic Resistance in Peripheral Blood Mononuclear Cells and Plasma Antioxidant Potential with Age in Labrador Retriever Dogs J. Nutr., August 1, 2004; 134(8): 2120S - 2123S. [Full Text] [PDF]
|
|
|
|
 |
|
 D. E. Lewis, M. Merched-Sauvage, J. J. Goronzy, C. M. Weyand, and A. N. Vallejo Tumor Necrosis Factor-{alpha} and CD80 Modulate CD28 Expression through a Similar Mechanism of T-cell Receptor-independent Inhibition of Transcription J. Biol. Chem., July 9, 2004; 279(28): 29130 - 29138. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Betea, A. R. Bradwell, T. C. Harvey, G. P. Mead, H. Schmidt-Gayk, B. Ghaye, A. F. Daly, and A. Beckers Hormonal and Biochemical Normalization and Tumor Shrinkage Induced by Anti-Parathyroid Hormone Immunotherapy in a Patient with Metastatic Parathyroid Carcinoma J. Clin. Endocrinol. Metab., July 1, 2004; 89(7): 3413 - 3420. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Gold, M. W. Munks, M. Wagner, C. W. McMahon, A. Kelly, D. G. Kavanagh, M. K. Slifka, U. H. Koszinowski, D. H. Raulet, and A. B. Hill Murine Cytomegalovirus Interference with Antigen Presentation Has Little Effect on the Size or the Effector Memory Phenotype of the CD8 T Cell Response J. Immunol., June 1, 2004; 172(11): 6944 - 6953. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. E. Gamadia, E. M. M. van Leeuwen, E. B. M. Remmerswaal, S.-L. Yong, S. Surachno, P. M. E. Wertheim-van Dillen, I. J. M. ten Berge, and R. A. W. van Lier The Size and Phenotype of Virus-Specific T Cell Populations Is Determined by Repetitive Antigenic Stimulation and Environmental Cytokines J. Immunol., May 15, 2004; 172(10): 6107 - 6114. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Deng, Y. Jing, A. E. Campbell, and S. Gravenstein Age-Related Impaired Type 1 T Cell Responses to Influenza: Reduced Activation Ex Vivo, Decreased Expansion in CTL Culture In Vitro, and Blunted Response to Influenza Vaccination In Vivo in the Elderly J. Immunol., March 15, 2004; 172(6): 3437 - 3446. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. D. Sloan, G. Zahariadis, C. M. Posavad, N. T. Pate, S. J. Kussick, and K. R. Jerome CTL Are Inactivated by Herpes Simplex Virus-Infected Cells Expressing a Viral Protein Kinase J. Immunol., December 15, 2003; 171(12): 6733 - 6741. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. E. Bower, P. A. Ganz, N. Aziz, J. L. Fahey, and S. W. Cole T-Cell Homeostasis in Breast Cancer Survivors With Persistent Fatigue J Natl Cancer Inst, August 6, 2003; 95(15): 1165 - 1168. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J. Davenport Immunity Challenge Sci. Aging Knowl. Environ., June 11, 2003; 2003(23): oa1 - 1. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Karrer, S. Sierro, M. Wagner, A. Oxenius, H. Hengel, U. H. Koszinowski, R. E. Phillips, and P. Klenerman Memory Inflation: Continuous Accumulation of Antiviral CD8+ T Cells Over Time J. Immunol., February 15, 2003; 170(4): 2022 - 2029. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Prod'homme, C. Retiere, B.-M. Imbert-Marcille, M. Bonneville, and M.-M. Hallet Modulation of HLA-A*0201-Restricted T Cell Responses by Natural Polymorphism in the IE1315-324 Epitope of Human Cytomegalovirus J. Immunol., February 15, 2003; 170(4): 2030 - 2036. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
), irrelevant EBV peptide RPQKRPSCI (
), or DMSO
(
). Donors 025, 041, and 040 are all CMV seropositive, whereas donor
056 is CMV seronegative. Assays using a TPR-specific clone were also
performed as a further control.
