The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hayden, T. A.
Right arrow Articles by Kline, G. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hayden, T. A.
Right arrow Articles by Kline, G. H.
The Journal of Immunology, 2002, 169: 1970-1977.
Copyright © 2002 by The American Association of Immunologists

Detection of Functional VH81X Heavy Chains in Adult Mice with an Assessment of Complementarity-Determining Region 3 Diversity and Capacity to Form Pre-B Cell Receptor1

Tracy A. Hayden, Patricia Riegert and Gregory H. Kline2

Basel Institute for Immunology, Basel, Switzerland


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recent reports have indicated that up to 50% of all H chain proteins formed cannot associate with the surrogate L chain complex and therefore fail to form a pre-B cell receptor (pBCR), which is required for allelic exclusion and, in most cases, verifies that the H chain can assemble with the L chain to form an Ab molecule. Certain VH genes, such as VH81X, appear to be particularly prone to encoding for nonpairing (dysfunctional) H chains. It has been suggested that sequence variability at complementarity-determining region 3, especially when increased by the enzyme TdT, often precludes the ability of VH81X-using H chains to form pBCR. To determine whether a motif exists that accounts for the ability of H chains to pair with surrogate L chain complex/L chain, we have bred a mouse line in which H chain recombination can only occur on one allele, allowing us to compile a pool of H chains capable of forming Ab molecules in the absence of dysfunctional H chains. Somewhat unexpectedly, we have found VH81X H chains capable of Ab formation and cell surface expression in the presence of TdT. Scrutiny of these H chains has revealed that, although highly prone to encode for dysfunctional H chains, sequence variability is not severely limited among functional VH81X H chains. We also demonstrate that surface Ig expression is highly indicative of the capacity of a H chain to form pBCR.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
A productive Ig H chain rearrangement, one in which a full-length H chain protein is expressed, alters a newly emerging B cell in a number of fundamental ways: further DNA recombination events at the H chain locus are precluded (allelic exclusion), and a H chain-dependent differentiation program is initiated, allowing for continued clonal development and expansion (1, 2, 3). These events depend upon the formation of the pre-B cell receptor (pBCR),3 a complex composed of the nascent H chain and the surrogate L chain (SLC) (4, 5, 6, 7). The SLC is itself a heterodimer formed between the {lambda}5 and VpreB proteins (8, 9, 10). Until recently, it was generally assumed that all H chain proteins were capable of bringing about these changes; however, a newly defined class of H chains, termed dysfunctional, neither mediates allelic exclusion nor drives clonal maturation (11, 12, 13, 14, 15). The underlying mechanism for this failure is the inability of a dysfunctional H chain protein to pair with the SLC and form a pBCR (11, 12, 14). Significantly, failure to pair with SLC is also indicative of the inability of the H chain protein to pair with conventional L chain (13).

Analysis of the Ig rearrangements from early B cells has revealed that as many as 50% of all H chain proteins are dysfunctional (11, 12). Since single VH genes have been found that can encode for either a functional or a dysfunctional H chain the inability to pair with the SLC must arise as a result of differences within the complementarity-determining region 3 (CDR3) sequence. The CDR3, formed by DNA recombination between VH, D, and JH genes, is the only sequence that varies between H chains using the same VH gene.

H chains using the VH81X gene, a member of the VH7183 gene family, appear to be particularly prone to producing dysfunctional H chain proteins (15). In one series of experiments in which H chain rearrangements isolated from 6- to 8-wk-old mice were screened for their ability to pair with the SLC, all VH81X H chain proteins tested were dysfunctional, whereas all H chains using other members of VH7183 gene family were functional (12). One explanation for these observations is that only an extremely limited spectrum of CDR3 sequences in combination with the VH81X-encoded protein can form a functional H chain. Supporting this concept, the only known functional VH81X H chain isolated to date was derived from fetal liver and, hence, was generated before the onset of TdT expression that generally occurs 2–3 days after birth (16) (S. Gilfillan, unpublished observation). This is relevant, because TdT adds nontemplated nucleotides (N nucleotides) at the junctions generated during D to JH and VH to DJH rearrangements; therefore, mice expressing TdT have greater CDR3 sequence diversity than mice lacking TdT (17, 18, 19, 20). This extra diversity does not seem particularly beneficial for VH81X expression, as productive VH81X rearrangements are disfavored in adult mice that express TdT and in the livers of fetal mice that express a TdT transgene prematurely during ontogeny (21, 22, 23, 24, 25, 26, 27, 28, 29).

In this study we tried to identify an overall sequence motif that defines a functional H chain. We began our studies by examining VH81X rearrangements, since the a priori expectation would be that the CDR3 sequence diversity of these H chains would be the most severely limited. In fact, given the findings reported to date, it is unclear whether any functional VH81X H chains are generated in mice expressing TdT (11, 12). Previous studies of functional H chains relied on an in vitro assay to identify functional H chains; individual productively rearranged H chain genes were transfected into cell lines expressing the SLC, and those able to promote cell surface expression of the pBCR were scored as positive (11, 12, 14). This was necessary because dysfunctional H chains fail to allelically exclude, so individual B cells can harbor two productive H chain rearrangements, one functional the other dysfunctional (11, 12). Therefore, amplification of H chain rearrangements from surface Ig-positive (sIg+) cells does not guarantee that all productive rearrangements isolated are functional. We have adopted an alternative approach for isolating a pool of functional H chain genes. By crossing mice incapable of producing a H chain molecule (JH knockout) with C57BL/6 mice, we generated offspring hemizygous for H chain rearrangements (30). In these mice all VHDJH rearrangements isolated from sIg+ B cells must be functional. We found that functional VH81X H chains do exist in mice that express TdT and consequently have extensive N region addition. Surprisingly, we found no obvious restrictions on the diversity of CDR3 in these functional VH81X H chains.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals

Mice used in these studies were derived by crossing C57BL/6 (BRL, Fullinsdorf, Switzerland) with homozygous JHT knockout mice that had been backcrossed six times onto the C57BL/6 background (The Jackson Laboratory, Bar Harbor, ME) and maintained at the animal facility at Basel Institute for Immunology (Basel, Switzerland). The derived F1 mice were sacrificed either at 6–8 wk of age or for neonatal studies 2–3 days after birth.

Isolation and staining of whole bone marrow

Whole bone marrow cells were isolated by flushing the femurs and tibias with HBSS (Life Technologies, Grand Island, NY) supplemented with 0.1% BSA (fraction V; Sigma-Aldrich, St. Louis, MO) and 0.1% sodium azide (HBA). The cells were then passed through Nytex gauze and pelleted by centrifugation at 300 x g for 8 min, followed by resuspension in HBA, counted, and brought to a cell density of 1 x 107/ml. Cells were then stained with anti-IgD-FITC (clone 11-26c.2a; BD PharMingen, San Diego, CA). After a 15-min incubation on ice, excess Ab was removed by washing the cells with HBA. The cells were resuspended in HBA and stained with anti-IgMb PE (clone Af6-78; BD PharMingen). After a final wash, the cell suspension was passed through Nytex gauze and sorted using a MoFlo (Cytomation, Fort Collins, CO) high speed sorter.

Isolation and staining of splenocytes for FACS

A single-cell suspension was derived by carefully homogenizing removed pooled spleens from two 6- to 8-wk-old mice (adult) or at least nine spleens from 2- to 3-day-old neonates. Spleens from adult mice were treated with 0.16 M ammonium chloride, 0.17 M Tris-Cl, pH 7.2, to remove RBC. The splenocytes were resuspended in HBA and stained with either anti-IgD-FITC (clone 11-26c.2a; BD PharMingen) or anti-IgM-Cy5 (Chemicon, Temecula, CA) and anti-B220-FITC (clone RA3-6B2; BD PharMingen, San Diego, CA), incubated, and washed as described above. Adult splenocytes were then stained with anti-IgMb-PE (clone Af6-78; BD PharMingen), incubated for 15 min on ice, and washed to remove excess Ab. Propidium iodine was added to the neonatal splenocytes for live/dead cell discrimination immediately before cell sorting. The cells were then sorted using a MoFlo (Cytomation) high speed sorter.

Genomic DNA preparation and PCR amplification

Genomic DNA was prepared from the sorted cell populations using a Qiagen Blood and Cell Culture DNA Mini kit (Qiagen, Basel, Switzerland) following the manufacturer’s instructions for the isolation of genomic DNA from cultured cells. The isolated genomic DNA was quantified by optical absorbance. Two hundred nanograms of this genomic DNA was then used as the starting template for the first round of nested PCR with the initial reaction consisting of 5 µl 10x Taq buffer, 2.5 mM MgCl2, 2.5 ng VH-specific primer 1 (see below), 2.5 ng. JH universal primer, 2.5 U Taq polymerase (Roche, Basel, Switzerland), and H2O to a total volume of 50 µl. The reactions were placed into a Biometra thermal cycler (Tampa, FL) and subjected to 10 min at 95oC, followed by 30 cycles of 94oC for 1 min, 50°C for 1 min, and 72°C for 1.5 min. The resultant products were then extended by a 10-min incubation at 72°C, followed by a 4°C soak. Two microliters of this first reaction was used as the template for the second round of PCR. This reaction was conducted as described above with the following exceptions: VH-specific primer 1 was replaced by VH-specific primer 2, one of four JH-specific primers was used instead of the JH universal primer, and the thermal cycling consisted of 10 min at 95°C, 30 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min, and an extension of products with a 10 -min incubation at 72°C, followed by a 4°C soak. Therefore, four independent second-round PCR amplifications were conducted to isolate VHDJH rearrangements using each JH individually. Upon completion of this second round of PCR, the resultant products were cloned using the TOPO-TA Cloning kit (Invitrogen, San Diego, CA) following the manufacturer’s instructions. For PCR amplification of products used for expression/pairing analyses, the following modifications to the above protocol were applied: in the first round of amplification each JH-specific primer was used in combination with VH-specific primer 1 in four independent reactions and subjected to thermal cycling consisted of 10 min at 95°C, 30 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1.5 min, and an extension of the products with a 10-min incubation at 72°C, followed by a 4°C soak. In a second round of amplification 2 µl of each of the first-round reactions were used as templates using VH-specific primer 2 along with each appropriate JH-specific expression cloning oligonucleotide primer with thermal cycling consisting of 95°C for 10 min, 50°C for 1 min, and 72°C for 30 s, and an extension of the products with a 10-min incubation at 72°C, followed by a 4°C soak.

Preparation of plasmid DNA and sequencing

Plasmid DNA was isolated from 2 ml of the O/N culture using a QIAprep Spin Mini Prep kit (Qiagen). Plasmid DNA positive for PCR inserts, as determined by EcoRI digestion resolved by agarose gel electrophoresis, were used as templates for DNA sequencing using ABI Big Dye Terminator Cycle Sequencing kit (PE Applied Biosystems, Warrington, U.K.) and run on a ABI model 377 automated sequencer following manufacturer’s instructions. All sequences were read up to the EcoRI site in the VH81X gene. Only sequences with complete identity with the published VH81X gene were included in these analyses.

Sequences of oligonucleotide primers used for PCR

The primer sequences were: VH-specific primer 1, 81X ggaggcttagtgcagcctagagag; VH-specific primer 2, 81X tccctgaggcgcgcctgtgaatcc (nucleotides exchanged from germline sequence are shown in bold forming a unique AscI site (underlined); appropriate for the cloning of PCR products but not used in this current study); JH universal, gaaaactccataacaaagg; JH-specific: JH1, agcttctgcagcatgcagagtgtg; JH2, ggccaggatccctataaatctctg; JH3, acaaaggggttgaatcttgattcc; JH4, aaaataaagacctggagaggc; JH-specific expression: JH1, aagctttgactctctgaggagacggtgacc; JH2, aagctttgactctctgaggagactgtgaga; JH3, aagctttgactctctgcagagacagtgacc; and JH4, aagctttgactctctgaggagacggtgact.

Cloning, transfection, and detection of cell surface expression of H chains

The pELVC retroviral H chain expression vector contains unique SalI/HindIII restriction sites introduced as silent mutations in the coding region of the VH (amino acids 1, 2, and Cµ 3, 4, respectively) and lacks the intron between JH and Cµ for the cloning of VH DJH rearrangements (12). To make use of this system we digested our cloned and sequenced VH81XDJH rearrangements (originally from PCR products generated using our VH81X- and JH-specific expression primers) with EcoRI/HindIII and agarose gel purified the appropriate sized VH81XDJH band from vector sequence using QiaexII (Qiagen) following manufacturer’s instructions. This fragment was then ligated using the Rapid DNA Ligation kit (Roche, Mannheim, Germany) to pBS-Hinchi; a pBS vector (Stratagene, San Diego, CA) containing a complete VH81XDJH rearrangement with SalI and HindIII sites (gift from X. C. Kong and T. Rolink) that had been used previously in expression studies was also digested with EcoRI/HindIII and purified. The resultant transformants were picked, isolated by mini-prep DNA, and screened for the presence of the insert. This DNA was then digested with SalI/HindIII, and the entire VDJ fragment was cloned into pELVC. One to 2 µg pELVC DNA (by OD measurement) with each rearrangement to be tested was then used to individually transfect the retroviral packaging cell line GPE (gift from U. Grawunder). Cells (2.5 x 105) were plated into six-well plates the night before transfection using Lipofectamine Plus reagent (Invitrogen) following the manufacturer’s protocol. The cells were incubated for 5 h in the presence of the DNA-Lipofectamine complexes before addition of medium with serum. These cells were then grown overnight, medium was replaced, and 3.5 x 105 38B9 cells (gift from J. Andersson and T. Rolink) were added. After 24 h of coculture the 38B9 cells were harvested and were cultured overnight before the addition of 15 µg puromycin to the culture medium. Sufficient cell numbers for FACS analysis were obtained after 7 days of selection. For FACS analysis, transfected 38B9 cells were removed from culture, pelleted by centrifugation, and resuspended in HBA. The cells were then stained with anti-IgM-Cy5 (Chemicon, Temecula, CA) for 15 min on ice. Following this the cells were washed in HBA to remove excess Ab and then analyzed on a FACSCaliber (BD Biosciences, Mountain View, CA). Propidium iodine (0.6 µg/sample) was added for live/dead cell discrimination to each sample individually ~1 min before FACS analysis.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Isolation and analysis of VH81X rearrangements from immature B cells from F1 mice

We began our studies by isolating DNA from FACS-sorted sIgM+D- immature bone marrow B cells (Fig. 1Go) from 8-wk-old (C57BL/6XJHT-/-)F1 mice that, as noted above, can only complete H chain rearrangements on one allele. This population was chosen because all rearrangements isolated from sIg+ cells must, by definition, be functional in these mice. Immature bone marrow B cells from mice of this age would be expected to undergo DNA recombination at the H chain locus in the presence of TdT. PCR amplification and sequencing of DNA isolated from these sIgM+ cells revealed that functional VH81X rearrangements are produced in the presence of TdT (Fig. 2Go) and, indeed, have N nucleotides. Although not shown in Fig. 2Go, all sequences included in these analyses were read from the JH gene through the EcoRI site within the VH81X gene. Only sequences with complete identity with the published VH81X gene are depicted. As would be expected from a highly purified preparation of cells from this population, no nonproductive rearrangements were detected. Overall, there appeared to be few, if any, constraints on CDR3 sequence length or diversity in functional VH81X rearrangements; every amino acid was accommodated, and no shared motifs or patterns were obvious (Fig. 2Gob). Recently, Marshall et al. (29) identified a degenerative amino acid consensus sequence that was found to be prevalent among VH81X rearrangements from fetal and neonatal mice. The neonatal consensus sequence was based on their observation that only a limited range of amino acids occurred at the junction between the VH81X gene and the selected D gene. In particular, only histidine was found to occur at position 95, using the numbering system defined by Kabat (29, 30), with either one of four residues (glycine, serine, tyrosine, and asparagine) occurring at positions 96–98. Since VH81X rearrangements isolated from fetal or neonatal mice are generally productive, it seems plausible that possessing this consensus sequence may confer a selective advantage, such as the ability to pair with SLC or L chain (24). It was not determined whether the consensus sequence correlates with the ability of the VH81X rearrangements to pair with SLC or L chain. Alternatively, this sequence may occur more often among VH81X rearrangements in fetal and neonatal mice due to a lack of TdT expression and therefore a lack of N region addition and limited sequence variability of CDR3 (21). For clarity, we have appended this neonatal consensus sequence to the amino acid sequences isolated from sIgM+ immature bone marrow cells shown in Fig. 2Gob.



View larger version (66K):
[in this window]
[in a new window]
  		FIGURE 1. Isolation of immature B cells from the bone marrow of (C57BL/6xJHT-/-)F1 mice. The sort regions used for isolating immature B cells (sIgM+D-) from whole bone marrow is shown in a and b, while the post-sort reanalysis of the isolated cell population is depicted in c and d. R1 and R2 represent the sorting gates used in the isolation of immature B cells. The FACS profile shown in b is the result of applying the R1 gate.

 


View larger version (93K):
[in this window]
[in a new window]
  		FIGURE 2. VH81X H chain CDR3 sequences isolated from immature B cells. A, The nucleotide sequence of CDR3 is depicted with nucleotides assigned to the VH81X gene or the D or JH gene segment by conservation with known sequence identity. D gene nucleotides are shown in parentheses, while untemplated N or P nucleotides are shown outside, at the junctions between VH and D or D and JH. Rearrangements are ordered according to JH gene usage from top to bottom (JH1 top) with spaces between the sequences delineating the different JH genes. Underlined DNA sequences represent rearrangements assayed for SLC pairing capacity (see text and Fig. 7Go for details) with the presence (+) or the absence (-) of sIg expression shown to the right of each amino acid sequence tested. B, The amino acid sequences were determined from the DNA sequences shown in A. The degenerative neonatal consensus sequence defined by Marshall et al. (29 ) is shown at the bottom of the figure using the numbering system defined by Kabat (29 31 ).

 
Among functional VH81X rearrangements we isolated from immature B cells, 5% of the sequences matched the identified neonatal consensus sequence, significantly less than the 59% Marshall et al. (29) reported for neonatal spleen. In addition, only 48% of all isolated functional VH81X rearrangements from the immature B cell population of F1 mice have a histidine at residue 95. Therefore, histidine at residue 95 is not required for a VH81X H chain to be functional, nor is there an absolute bias for the neonatal consensus sequence in general among functional H chains. Because the neonatal consensus sequence was derived from a pool of isolated VH81X rearrangements using JH4, it is possible that the neonatal consensus sequence is selectively favored among VH81XDJH4 rearrangements. However, analysis of our functional VH81XDJH4 rearrangements revealed no such primary structural bias. Although selection for the neonatal consensus motif among functional VH81X rearrangements cannot be ruled out completely, it should be noted that at least one VH81X H chain containing the neonatal consensus sequence has been identified and is dysfunctional (13, 14).

The neonatal consensus is not enriched for among mature splenic B cells

Previous reports have demonstrated a selective decline of productive VH81X rearrangements with increasing developmental state (23, 25, 26, 27, 28). Whereas among immature bone marrow B cells 15% of VH81X rearrangements are productive, only 5% of the rearrangements isolated from splenic B cells using this VH gene were found to be productive (23, 28). This decline apparently mirrors an increase in the percentage of VH81X rearrangements that fit the neonatal consensus sequence (29). Among VH81X rearrangements isolated from the splenic B cells of BALB/c mice, 40% were observed to match the consensus sequence, whereas none of the sequences amplified from sIgM+ immature bone marrow B cells encoded this motif. Two possible explanations for these findings are: 1) VH81X rearrangements with the neonatal consensus sequence rarely occur in older mice that express TdT, but when they do arise they are selected for and greatly enriched among productive VH81X rearrangements in the spleen; or 2) long-lived neonatal B cells that would be expected to frequently use the neonatal consensus may skew the observed repertoire of splenic B cells overall. In an attempt to address these issues, we isolated mature sIgM+D+ cells from the spleens of F1 mice by FACS as shown in Fig. 3Go; sequences of VH81X rearrangements from this population are shown in Fig. 4Go. Contrary to expectation, we found that the neonatal consensus sequence is not enriched among the mature splenic B cells from F1 mice. In fact, there appears to be little difference in the percentage of VH81X rearrangements with the neonatal consensus sequence between the immature B cells in the bone marrow and the mature splenic B cell pool. One explanation for this difference between a previous report and our own may lie with the relatively small number of sequences assessed in the earlier work (five productive VH81X sequences in total) (29).



View larger version (60K):
[in this window]
[in a new window]
  		FIGURE 3. Isolation of mature B cells from the spleens of (C57BL/6xJHT-/-)F1 mice. The sort regions used for isolating mature splenic B cells (sIgMlowDhigh) is shown in a and b, while the post sort re-analysis of the isolated cell population is depicted in c and d. R1 and R2 represent the sorting gates used in the isolation of immature B cells. The FACS profile shown in b is the result of applying the R1 gate.

 


View larger version (43K):
[in this window]
[in a new window]
  		FIGURE 4. VH81X H chain CDR3 sequences isolated from mature splenic B cells. A, The nucleotide sequence of CDR3 is depicted with nucleotides assigned to the VH81X gene or the D or JH gene segment by conservation with known sequence identity. D gene nucleotides are shown within parentheses, while untemplated N or P nucleotides are shown outside, at the junctions between VH and D or D and JH. Underlined DNA sequences represent rearrangements assayed for SLC pairing capacity (see text and Fig. 7Go for details) with the presence (+) or the absence (-) of sIg expression shown to the right of each amino acid sequence tested. B, The amino acid sequences were determined from the DNA sequences shown in A. Note that no JH2 rearrangements were detected within this pool.

 
Neonatal consensus sequence is enriched among the splenic B cells of F1 neonates

We have interpreted our finding that the neonatal consensus sequence is not enriched among functional VH81X rearrangements isolated from mice that express TdT to mean that this sequence is not predictive for the functionality of VH81X H chains. This conclusion was reached based on our finding that there appears to be a lack of selection for the neonatal consensus sequence among VH81X rearrangements derived from immature and mature B cells of F1 mice. Given the apparent lack of selection for the neonatal consensus sequence among functional H chains isolated from older mice, we were curious to examine whether, in fact, the neonatal consensus sequence would be enriched for among the splenic B cell compartment of neonatal F1 mice. For this we isolated sIgM+B220+ cells from the spleens of 2- to 3-day-old F1 mice (Fig. 5Go). The VH81X sequences isolated from this cell population are shown in Fig. 6Go; among these, 33% matched the neonatal consensus sequence. This proportion of neonatal consensus rearrangements is lower than the 59% reported by Marshall et al. (29) for neonatal spleen and is identical with the 33% (three of nine) they noted in sequences amplified from µ membrane, exon-targeted (µT) fetal liver (a TdT-negative environment in which H chain expression and selection are not possible, which would, therefore, provide an accurate estimate as to how frequently this consensus sequence is formed in the absence of TdT and selection).



View larger version (60K):
[in this window]
[in a new window]
  		FIGURE 5. Isolation of sIgM+ cells from the spleens of neonatal (C57BL/6xJHT-/-)F1 mice. The sort regions used in isolating splenic B cells (sIgM+) from neonatal mice is shown in a and b, while the post sort re-analysis of the isolated cell population is depicted in c and d. R1 and R2 represent the sorting gates used in the isolation of sIgM+ B cells. The FACS profile shown in b is the result of applying the R1 gate.

 


View larger version (39K):
[in this window]
[in a new window]
  		FIGURE 6. VH81X H chain CDR3 sequences isolated from sIgM+ splenic B cells from neonatal mice. A, The nucleotide sequence of CDR3 is depicted with nucleotides assigned to the VH81X gene or the D or JH gene segment by conservation with known sequence identity. D gene nucleotides are shown in parentheses, while untemplated N or P nucleotides are shown outside, at the junctions between VH and D or D and JH. Underlined DNA sequences represent rearrangements assayed for SLC pairing capacity (see text and Fig. 7Go for details) with the presence (+) or the absence (-) of sIg expression shown to the right of each amino acid sequence tested. B, The amino acid sequences were determined from the DNA sequences shown in A. Note that no JH2 rearrangements were detected within this pool.

 
Assessment of the SLC pairing capacity of isolated VH81X Rearrangements

Our analyses to date have relied on the supposition that sIg expression was indicative of the propensity of H chain to interact with the SLC in forming pBCR. It has been shown that H chains that fail to interact with SLC also fail to associate with L chain though whether L chain pairing is indicative of SLC pairing capacity has not been formally demonstrated (13). To test whether sIg expression does indeed reflect the propensity of a H chain to pair with SLC, we made use of a pairing assay first described by ten Boekel et al. (12). In this system H chains, under transcriptional control of the Ig promoter and enhancer, are transfected into the 38B9 cell line, which expresses SLC but lacks endogenous H chain expression. The pairing capacity of the H chain of interest is then scored by detection of surface H chain expression brought about by pBCR formation. A representative result obtained from analysis of the surface pBCR expression of 19 randomly selected VH81X rearrangements (four isolated from sIgM+D- adult bone marrow, eight from adult spleen, and seven from neonatal spleen; for sequences and whether sIg expression is detected see Figs. 2Gob, 4b, and 6b) are shown in Fig. 7Go. As a negative control we used a VH81X rearrangement first described by Jack’s group (13, 14) and shown both in vitro and in vivo to fail to associate with SLC or form pBCR. We found that the vast majority (16 of 19) of tested rearrangements did, in fact, exhibit some level of pBCR surface expression. We conclude from these results that the capacity of a given H chain to associate with SLC can in most instances be predicted by a given H chain’s ability to form sIg.



View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 7. Detection of pBCR formation by sIg expression. The capacity of isolated VH81X H chains to associate with SLC and foster pBCR formation was assessed by detection of sIg expression by FACS analysis of 38B9 cells transfect with the Ig expression vector pELVC. A representative FACS histogram of sIg+ expression from transfected 38B9 cells is shown (bold, solid line). The sIg expression of 38B9 cells transfected with a VH81X rearrangement previously shown to be incapable of association with SLC and pBCR formation in vitro and in vivo is overlaid (light, stippled line). The underlined sequences in Figs. 2Go, 4Go, and 6Go denote the rearrangements assayed. Whether the tested sequence was determined to be positive (+) or negative (-) for sIg expression is denoted to the right of the amino acid sequences in Figs. 2GoB, 4B, and 6B. Fluorescence from propidium iodide-positive cells was excluded from these analyses (not shown).

 
Interestingly, we observed three VH81X clones that failed to mediate cell surface expression of pBCR. Among these clones no overall theme is readily evident that explains these differences in surface expression levels. Although rearrangements that yielded negative surface expression lacked histidine at position 95, this did not seem to be an overriding factor, since rearrangements that lacked histidine a position 95 were also found within the surface pBCR+ category. Negative surface expression also did not correlate with any particular cell population. Several possibilities exist for why these H chains failed to permit surface pBCR expression: 1) these H chains could have been generated during fetal life; a developmental window in which H chains incapable of pBCR formation can direct B cell maturation (32) (see Discussion), 2) a small percentage of newly generated B cells can undergo early L chain recombination before the pre-B cell developmental stage, thereby bypassing the need for SLC and SLC-mediated selection (33), and 3) alterations to the expression construct may have occurred that precluded SLC pairing and surface pBCR expression. We would argue that the H chain incapable of surface pBCR expression isolated from the adult spleen, due to the its extensive N region addition, appears unlikely to have arisen during fetal/neonatal development.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The assembly of Ag receptors by DNA recombination affords an organism the means by which to generate a diverse repertoire while using a minimum of genetic information (1). Such structural diversity may, in fact, be so great as to preclude the formed Ag receptor from executing its function. In this current study we have sought to understand the underlying primary structural limitations that impinge upon Ig H chain variability; specifically, defining a functionality motif. Prior studies of functional and dysfunctional H chains using transfection assays have suffered from two inherent drawbacks: 1) pBCR formation or the failure to do so in this in vitro system does not necessarily reflect pairing capacity and selection in vivo; and 2) it is difficult to screen large numbers of H chains, which are necessary for repertoire studies (11, 12, 14). For example, among wild-type TdT expressing adult mice, only 5% or less of all VH81X rearrangements isolated from the spleen are productive (23, 28). To isolate the 39 productive rearrangements from the spleen used in this study would have required the isolation and sequencing of a minimum of 750 individual sequences, followed by screening of the recovered productive rearrangements in vitro. To overcome these obstacles and the fact that dysfunctional H chains fail to mediate allelic exclusion, we have bred mice in which B cell development relies upon a single H chain allele. Using such mice we have assembled a pool of functional H chains, allowing for the characterization of H chain variability within the limits of remaining functional.

We were unable to elucidate an overall primary structural motif that accounts for H chain (VH81X) functionality. Because this VH gene has an extremely high propensity for encoding dysfunctional H chains, we expected to see obvious structural constraints in functional VH81X H chains within CDR3 (11, 12, 29). Instead, and somewhat surprisingly in light of previous work on this VH gene, we clearly established that structurally diverse functional VH81X H chains can be generated. Applying the opposite experimental approach, looking for a dysfunctional motif, would be even more difficult, since there are no expected limitations on junctional diversity. Although not obvious at this point, the development of computer programs designed to model higher level structural motifs based on sequence data may make it possible to identify a functionality motif among our functional VH81X sequences.

Although we were unable to ascertain an overall functionality motif, we were capable of making a number of novel observations about H chain repertoire selection. Within this study we have demonstrated that the capacity of a H chain to interact with a L chain strongly correlates with a given H chain’s ability to form pBCR through an interaction with SLC. One role ascribed to the SLC has been to act as a "screener" for the capacity of a newly generated H chain to associate with L chain. If SLC does fill such a role, then it would be expected that the majority of sIg+ cells would, if previously selected by SLC, have the ability to associate with this complex, which is what we have observed.

As stated earlier, VH81X rearrangements are apparently favored in the neonatal environment, while such rearrangements generated in the adult are generally disfavored. One explanation put forward to explain this dichotomy has been that in the fetal/neonatal environment H chains incapable of associating with SLC have a growth advantage, while B cells bearing SLC-associating µ are actively inhibited from continued differentiation; in the adult environment the converse occurs (32). That is in the adult environment the capability of a µ-chain to pair with SLC gives that B cell a growth advantage. In light of this hypothesis, we predicted that one possible outcome of our surface pBCR assay (Fig. 7Go) would be that very few, if any, of our collection of neonatally derived VH81X H chains would foster surface pBCR expression, while nearly all of the adult bone marrow and spleen-derived H chains would. Contrary to this expectation we found that regardless of the population the H chain was isolated from that the majority of H chains tested directed surface pBCR formation. Given this observation we feel that further studies are needed to address the differences in selective forces operating within the fetal/neonatal and adult environments.

In summary we report an efficient system for specifically isolating and analyzing functional H chains. Our VH81X data can easily be augmented to include functional H chains using other VH genes; such analyses may lead to characterization of a prototypic functional H chain structure.


   Acknowledgments
 
We express great appreciation to Drs. A. Rolink, S. Gilfillan and N. R. Klinman for helpful discussions and critical reading of this manuscript. We also thank Drs. Rolink, J. Andersson, and U. Grawunder for providing the cell lines and technical assistance necessary for setting up the transfection assay system.


   Footnotes
 
1 The Basel Institute for Immunology was founded and supported by Hoffmann-LaRoche Ltd. Back

2 Address correspondence and reprint requests to Dr. Gregory H. Kline, Basel Institute for Immunology, Bau 90/519, Basel, CH-4070, Switzerland. E-mail address: kline{at}bii.ch Back

3 Abbreviations used in this paper: pBCR, pre-B cell receptor; CDR3, complementarity-determining region 3; sIg, surface Ig; SLC, surrogate L chain. Back

Received for publication August 29, 2001. Accepted for publication June 20, 2002.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Alt, F. W., G. D. Yancopoulus, T. K. Blackwell, C. Wood, E. Thomas, M. Boss, R. Coffman, N. Rosenberg, S. Tonegawa, D. Baltimore. 1984. Ordered rearrangement of immunoglobulin H chain variable region segments. EMBO J. 3:1209.[Medline]
  2. Nussenzwieg, M. C., A. C. Shaw, E. Sinn, D. B. Danner, K. L. Holmes, H. C. Morse, P. Leder. 1987. Allelic exclusion in transgenic mice that express the membrane form of immunoglobulin µ. Science 236:816.[Abstract/Free Full Text]
  3. Spanopoulu, E., C. A. Roman, L. M. Corcoran, M. S. Schlissel, D. P. Silver, D. Nemazee, M. C. Nussenzweig, S. A. Shinton, R. R. Hardy, D. Baltimore. 1994. Functional immunoglobulin transgenes guide ordered B-cell differentiation in Rag-1-deficient mice. Genes Dev. 8:1030.[Abstract/Free Full Text]
  4. Karasuyama, H., A. Kudo, F. Melchers. 1990. The proteins encoded by the VpreB and {lambda}5 pre B cell-specific genes can associate with each other and with µ H chain. J. Exp. Med. 172:969.[Abstract/Free Full Text]
  5. Nishimoto, N., H. Kubagawa, T. Ohno, G. L. Gartland, A. K. Stankovic, M. D. Cooper. 1991. Normal pre-B cells express a receptor complex of µ H chains and surrogate L chain proteins. Proc. Natl. Acad. Sci. USA 88:6284.[Abstract/Free Full Text]
  6. Kitamura, D., A. Kudo, S. Schaal, W. Muller, F. Melchers, K. Rajewsky. 1992. A critical role of {lambda}5 protein in B cell development. Cell 69:823.[Medline]
  7. Rolink, A., H. Karasuyama, D. Haasner, U. Grawunder, I. Martensson, A. Kudo, F. Melchers. 1994. Two pathways of B-lymphocyte development in mouse bone marrow and the roles of surrogate L chain in this development. Immunol. Rev. 137:185.[Medline]
  8. Kudo, A., F. Melchers. 1987. A second gene, VpreB in the {lambda}5 locus of the mouse, which appears to be selectively expressed in pre-B lymphocytes. EMBO J. 6:2267.[Medline]
  9. Pillai, S., D. Baltimore. 1987. Formation of disulfide-linked µ2{omega}2 tetramers in pre-B cells by 18K {omega}-immunoglobulin L chain. Nature 329:172.[Medline]
  10. Sakaguchi, N., F. Melchers. 1988. {lambda}5, a new L chain-related locus selectively expressed in pre-B lymphocytes. Nature 324:579.
  11. ten Boekel, E., F. Melchers, A. G. Rolink. 1997. Changes in the VH gene repertoire of developing precursor B lymphocytes in mouse bone marrow mediated by the pre-B cell receptor. Immunity 7:357.[Medline]
  12. ten Boekel, E., F. Melchers, A. G. Rolink. 1998. Precursor B cells showing H chain allelic inclusion display allelic exclusion at the level of pre-B cell receptor surface expression. Immunity 8:199.[Medline]
  13. Kline, G. H., L. Hartwell, G. B. Beck-Engeser, U. Keyna, S. Zaharavitz, N. R. Klinman, H.-M. Jack. 1998. Pre-B cell receptor-mediated selection of pre-B cells synthesizing functional µ H chains. J. Immunol. 161:1608.[Abstract/Free Full Text]
  14. Kenya, U., G. Beck-Engeser, J. Jongstra, S. E. Applequist, H.-M. Jack. 1995. Surrogate L chain-dependent selection of Ig H chain V regions. J. Immunol. 155:5536.[Abstract]
  15. Keyna, U., S. E. Applequist, J. Jonstra, G. B. Beck-Engeser, H.-M. Jack. 1995. Igµ H chains with VH81X variable regions do not associate with {lambda}5. Ann. NY Acad. Sci. 764:39.[Medline]
  16. Martin, F., X. Chen, J. F. Kearney. 1997. Development of VH81X transgene-bearing B cells in fetus and adult: sites for expansion and deletion in conventional and CD5/B1 cells. Int. Immunol. 9:493.[Abstract/Free Full Text]
  17. Desiderio, S., G. Yancopoulos, M. Paskind, E. Thomas, M. Boss, N. Landau, F. W. Alt, D. Baltimore. 1984. Insertion of N regions into heavy-chain genes is correlated with expression of terminal deoxytransferase in B cells. Nature 311:752.[Medline]
  18. Gilfillian, S., M. Dierich, M. Lemeur, C. Benoist, D. Mathis. 1993. Mice lacking TdT: mature animals with an immature lymphocyte repertoire. Science 261:1175.[Abstract/Free Full Text]
  19. Komori, T., A. Okada, V. Stewart, F. W. Alt. 1993. Lack of N regions in antigen receptor region genes of TdT-deficient lymphocytes. Science 261:1171.[Abstract/Free Full Text]
  20. Gu, H., I. Forster, K. Rajewsky. 1990. Sequence homologies, N sequence insertion and JH gene utilization in VHDJH joining: implications for the joining mechanisms and the oncogenic timing of Ly1 B cell and B-CLL progenitor generation. EMBO J. 9:2133.[Medline]
  21. Feeney, A.. 1992. Lack of N regions in fetal and neonatal mouse immunoglobulin V-D-J junctional sequences. J. Exp. Med. 172:1377.[Abstract/Free Full Text]
  22. Carlsson, L., C. Overmo, D. Holmberg. 1992. Selection against N-region diversity in immunoglobulin H chain variable regions during the development of pre-immune B cell repertoires. Int. Immunol. 4:549.[Abstract/Free Full Text]
  23. Decker, D., N. E. Boyle, N. R. Klinman. 1991. Predominance of nonproductive rearrangements of VH81X gene segments evidences a dependence of B cell clonal maturation on the structure of nascent H chains. J. Immunol. 147:1406.[Abstract]
  24. Chukwuocha, R., A. Feeney. 1993. Role of homology-directed recombination: predominantly productive rearrangements of VH81X in newborns but not in adults. Mol. Immunol. 30:1473.[Medline]
  25. Carlsson, L., C. Overmo, D. Holmberg. 1992. Developmentally controlled selection of antibody genes: characterization of individual VH 7183 genes and evidence for stage-specific somatic diversification. Eur. J. Immunol. 22:71.[Medline]
  26. Huetz, F., L. Carlsson, U. C. Tornberg, D. Holmberg. 1993. V-region directed selection in differentiating B lymphocytes. EMBO J. 12:1819.[Medline]
  27. Marshall, A., G. E. Wu, C. J. Paige. 1996. Frequency of VH81x usage during B cell development: initial decline in usage is independent of Ig H chain cell surface expression. J. Immunol. 156:2077.[Abstract]
  28. Decker, D., G. H. Kline, T. A. Hayden, S. N. Zaharevitz, N. R. Klinman. 1995. H chain V gene specific elimination of B cells during the pre-B cell to B cell transition. J. Immunol. 154:4924.[Abstract]
  29. Marshall, A., N. Doyen, L. Bentolila, C. J. Paige, G. E. Wu. 1998. Terminal deoxynucleotidyl transferase expression during neonatal life alters DH reading frame usage and Ig-receptor-dependent selection of V regions. J. Immunol. 161:6657.[Abstract/Free Full Text]
  30. Gu, H., Y. Zou, K. Rajewsky. 1993. Independent control of immunoglobulin switch recombination at individual switch regions through Cre-loxP-mediated gene targeting. Cell 18:1155.
  31. Kabat, E., T. Wu, H. Perry, K. Gottesman, C. Foeller. 1991. Sequences of Proteins of Immunological Interest U.S. Department of Health and Human Services, National Institutes of Health, Bethesda, MD.
  32. Wasserman, R., Y.-S. Li, S. A. Shinton, C. E. Carmack, T. Manser, D. L. Wiest, K. Hayakawa, R. R. Hardy. 1998. Maturation based on response by B cell precursors to pre B receptor assembly. J. Exp. Med. 187:259.[Abstract/Free Full Text]
  33. Novobrantseva, T. I., V. M. Martin, R. Pelanda, W. Muller, K. Rajewsky, A. Ehlich. 1999. Rearrangement and expression of immunoglobulin L chains can precede H chain expression during normal B cell development in mice. J. Exp. Med. 189:75.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
Y. Kawano, S. Yoshikawa, Y. Minegishi, and H. Karasuyama
Pre-B Cell Receptor Assesses the Quality of IgH Chains and Tunes the Pre-B Cell Repertoire by Delivering Differential Signals
J. Immunol., August 15, 2006; 177(4): 2242 - 2249.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
Y. Kawano, S. Yoshikawa, Y. Minegishi, and H. Karasuyama
Selection of stereotyped VH81X-{micro}H chains via pre-B cell receptor early in ontogeny and their conservation in adults by marginal zone B cells
Int. Immunol., July 1, 2005; 17(7): 857 - 867.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
D. A. Martin, H. Bradl, T. J. Collins, E. Roth, H.-M. Jack, and G. E. Wu
Selection of Ig {micro} Heavy Chains by Complementarity-Determining Region 3 Length and Amino Acid Composition
J. Immunol., November 1, 2003; 171(9): 4663 - 4671.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hayden, T. A.
Right arrow Articles by Kline, G. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hayden, T. A.
Right arrow Articles by Kline, G. H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS