|
|
||||||||







* Immunobiology Group, Medical Research Council Center for Inflammation Research,
Respiratory Medicine Unit, and
Department of Pathology, University of Edinburgh Medical School, Edinburgh, United Kingdom; and
Department of Biological Sciences, Imperial College of Science, Technology and Medicine, London, United Kingdom
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Shh is synthesized as a 45-kDa precursor protein, which undergoes autoproteolysis to yield the biologically active amino-terminal domain protein (Shh-N), and a 27-kDa carboxyl-terminal Shh-C protein responsible for the autoprocessing (4, 5). The biologically active Shh-N remains associated with the membrane through cholesterol modification in the autoprocessing step and can exert short-range signaling in this way. There is also evidence for a freely diffusible form of Shh, which would mediate long-range signaling (6, 7, 8). Shh signals to neighboring cells via two multitransmembrane proteins patched (ptc) and smoothened (smo). They exist as a receptor complex in which ptc is the ligand-binding subunit and smo is the signaling component. Upon binding of Shh to ptc, an inhibitory effect of ptc on smo is released, allowing smo to transduce the Shh signal across the plasma membrane (9). The signal is then mediated by the Gli family of zinc finger transcription factors, of which three members have now been identified in vertebrates. Gli1 is up-regulated by Shh-secreting cells, while Gli2 and Gli3 appear to be more broadly expressed, suggesting they may also play a role in other pathways (1, 2, 10).
Shh signaling in vertebrates is critical in development, patterning, and cell fate induction in a number of tissues including CNS, limb buds, gut, and lung (1, 11), pituitary gland (12), and pancreas (13). More specifically, it has been reported that Shh induces proliferation in several cell types in vitro such as skin keratinocytes (14), hemopoietic stem cells (15), lung squamous carcinoma cells (16), and neuronal precursor cells (17). Furthermore, mutations in ptc and smo, resulting in constitutive activation of the Shh signaling pathway, are associated with several forms of malignant disease including basal cell carcinoma, medulloblastoma, and rhabidomyosarcoma (18).
Collectively, these results confirm that the Shh pathway is linked to proliferation in many adult cell types, including hemopoietic stem cells (15). Members of the Shh signaling pathway are expressed in the thymus where they appear to function in thymocyte development. They regulate differentiation from the double-negative (CD4-CD8-) to the double-positive (CD4+CD8+) stage of T cell development (19). Shh is also associated with the proliferation of human hemopoietic stem cells and Shh, ptc, and smo transcripts are present in primitive and mature CD19+, CD33+, and CD3+ cell populations (15). Shh has also previously been shown to induce bcl-2 (20), an important regulator of T cell survival (21, 22, 23, 24).
Therefore, since the Shh signaling pathway is associated with several aspects of lymphoid cell development, differentiation, and survival, this prompted us to investigate whether or not Shh contributes to the expansion of peripheral CD4+ T cells. In this study, we report the presence of members of the Hh signaling pathway in peripheral CD4+ T cells and secondary lymphoid tissues at both mRNA and protein levels. In addition, we demonstrate that biologically active amino-terminal Shh peptide amplifies the proliferation of activated CD4+ T cells by enhanced cell entry into the S-G2 phase of the cell cycle. Neutralizing anti-Shh Ab caused G1 arrest of the cell cycle. We also report that ligation of the TCR increases transcription of Shh and Gli1 after 72 h of culture. In contrast, in the presence of exogenous Shh, these genes and bcl-2 are up-regulated by 48 h.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6J mice were purchased from Harlan Orlac (Bicester, U.K.) and maintained in the Medical Faculty Animal Area Animal Unit at the University of Edinburgh. All experiments were performed in accordance with the animal ethics regulations of the Home Office in the United Kingdom.
Antibodies
Functional grade anti-CD3e and anti-CD28 Abs were purchased from Insight Biotechnology (Wembley, U.K.). The neutralizing anti-Shh Ab 5E1 (Developmental Studies Hybridoma Bank, Iowa City, IA) and the IgG1 isotype control Ab (cell name P3X63Ag8; European Cell Culture Collection, Wiltshire, U.K.) were purified from hybridoma supernatants using protein G columns (Amersham Pharmacia Biotech, Buckinghamshire, U.K.). Western blotting confirmed that 5E1 but not the isotype control Ab bound to Shh peptide (data not shown). Anti-CD4FITC Ab (BD Biosciences, Heidelberg, Germany) was used at a dilution of 1/100 for FACS staining. Both anti-Shh N-19 (1/40 dilution) and anti-ptc C-20 (1/60 dilution) Abs for use in immunocytochemistry were goat polyclonal Abs (Autogen Bioclear, Wiltshire, U.K.). Both anti-Shh and anti-ptc are completely blocked by use of the relevant peptide (data not shown). The secondary Ab for immunocytochemistrywas a biotinylated rabbit anti-goat Ab (DAKO, Cambridgeshire, U.K.) used at a dilution of 1/400.
Isolation of CD4+ T cells
Single-cell suspensions from pooled C57BL/6 mouse spleens were applied to negative selection CD4+ T cell columns (R&D Systems Europe, Abingdon, U.K.) as per the manufacturers instructions. Purity was checked using FACS staining with an anti-CD4FITC Ab and this ranged between 88 and 93%.
Culture of CD4+ T cells
CD4+T cells were cultured in RPMI 1640 medium (Life Technologies, Paisley, U.K.) supplemented with 10% FCS (Life Technologies), 2 mM L-glutamine, (Sigma-Aldrich, Dorset, U.K.), 20 µg/ml penicillin/streptomycin (Life Technologies), and 50 mM 2-ME (Sigma-Aldrich). Anti-CD3/28 Ab activation was conducted at two concentrations, namely, suboptimal (anti-CD3 at 0.25 µg/ml and anti-CD28 at 0.1 µg/ml) and optimal (anti-CD3 at 1 µg/ml and anti-CD28 at 5 µg/ml). Tissue culture plates (Corning Glass, Corning, NY) were coated with the anti-CD3 Ab for 90 min at 37°C before addition of the CD4+ T cells. Recombinant mouse Shh, a 180-aa residue amino-terminal peptide (R&D Systems Europe) was added into cultures at a concentration of 500 ng/ml. 5E1 Ab was used at either 20 or 50 µg/ml and the isotype control was used at 20 µg/ml. The concentrations used were based on the results of dose-response curves (data not shown).
T cell proliferation assays
The CD4+ T cells were cultured as above in 96-well plates with and without the addition of exogenous Shh or 5E1. They were pulsed after 48 h of anti-CD3/28 activation with 20 µl of [3H]TdR (50 µCi/ml; Amersham Pharmacia Biotech), harvested at 72 h, and read on a betaplate scintillation counter (Wallac, Milton Keynes, U.K.).
Immunocytochemistry
Paraffin sections of mouse lymph node and spleen were dewaxed in xylene and rehydrated through descending alcohols. Ag retrieval was carried in a microwave using Vector Ag Retrieval solution (Vector Laboratories, Burlingame, CA). After blocking endogenous peroxidase in 3% hydrogen peroxide, the sections were loaded onto a Sequenza (Shandon Scientific, Cheshire, U.K.). Nonspecific binding was blocked using normal rabbit serum, and endogenous biotin was blocked using the Vector blocking kit according to the manufacturers instructions. The primary and secondary Abs were applied to the sections for 30 min at room temperature. After washing, Vectastain Elite avidin-biotin complex (Vector Laboratories) was then applied according to kit instructions before addition of the substrate diaminobenzidine (Sigma-Aldrich).
Cell cycle analysis
The CD4+ T cells were cultured as above in 48-well plates with and without the addition of exogenous Shh or 5E1. At 72 h postactivation, the cells were spun at 13,000 rpm for 7 min, then resuspended in citrate buffer. Cell cycle analysis was conducted using the Vindelov method (25). Briefly, the cells were trypsinized (Sigma-Aldrich) to expose the nucleus before being stained with propidium iodide (Sigma-Aldrich). Cell cycle analysis was then performed on an Epics XL flow cytometer (Beckman Coulter U.K., Buckinghamshire, U.K.). The machine counted 30,000 nuclei in each sample and the software analyzed the percentage of cells in each stage of the cell cycle sub-G1, G1, S, and G2-M phases. From these values, the percentage of live cells (G1, S, and G2-M) was calculated and, from this, the percentage of live cells in the G1 and S-G2 phases.
Statistical analyses
A paired t test using a one-tailed p value was used to test the significance of differences in [3H]TdR incorporation or percentage of CD4+ T cells in the proliferative S-G2 phase with and without the addition of Shh or anti-Shh Ab. Values of p < 0.05 were considered to be significant.
RNA isolation
CD4+ T cells were cultured as above in
48-well plates with and without the addition of exogenous Shh or 5E1.
At various time points (24, 48, 72 h) postactivation, the
CD4+ T cells were spun at 300 x
g for 7 min and then resuspended in lysis buffer provided as
part of the RNeasy kit used for the RNA isolation (Qiagen, Crawley,
U.K.). Any contaminating DNA was then digested by treating the RNA with
DNase I (Life Technologies) according to the manufacturers
instructions. To check that no contaminating DNA remained, a PCR was
conducted using genomic
-actin primers (forward primer (fp),
5'-CCACCAACTGGGACACATG-3' and reverse primer (rp),
5'-GTCTCAAACATGATCTGGGTCATC-3') (MWG Biotec, Ebersburg, Germany). The
PCR program was as follows: 35 cycles of 30 s at 94°C, 1 min at
58°C, 2 min at 72°C, followed by a 5-min 72°C extension then
4°C hold. This was conducted on a PTC-200 Peltier thermal cycler (MJ
Research, Cambridge, MA).
RT-PCR
Reverse transcription of RNA was conducted using Moloney murine leukemia virus-reverse transcriptase (all components Promega, Southampton, U.K.). Tubes were incubated at 37°C for 45 min, then at 95°C for 5 min to allow the reverse transcription to take place. The following primer pairs were used for the PCR: Shh fp, AGGGGGTTTGGAAAGAGG; Shh rp, GGATTCATAGTAGACCCAGTCG; ptc fp, ATCGGAGTGGAGTTCACC; ptc rp, CTGCTGTGCTTCGTATTGCC; smo fp, CATCAAGTTCAACAGTTCAGGA; smo rp, ATAGGTGAGGACCACGAACCACACTACTCC; Gli1 fp, GAGAAGCCACACAAGTGC; and Gli1 rp, AACAGTCAGTCTGCTCTCTTCC. The PCR conditions used were: 35 cycles of 1 min at 94°C, 1 min at 65°C (60°C for Shh and Gli1), 2 min at 72°C followed by an extension of 5 min at 72°C and a 4°C hold.
Real-time PCR
Unless otherwise stated, all materials for real-time PCR were supplied by Applied Biosystems U.K. (Cheshire, U.K.). Four hundred nanograms of RNA was reverse transcribed using the Multiscribe RT kit. Samples were incubated for 10 min at 25°C, 40 min at 48°C, then 5 min at 95°C to allow the reverse transcription to take place. cDNA samples were then diluted 1/5 in nuclease-free water (Promega). The PCR step was conducted using Taqman Universal PCR Mastermix, a primer/probe mix specific to the gene of interest and a primer/probe mix specific to 18S rRNA control reagent. The following primer/probe sequences were used: Shh fp, TGACCCCTTTAGCCTACAAGCA; Shh rp, TTCTTGTGATCTTCCCTTCATATCTG; Shh probe, TTTATTCCCAACGTAGCCGAGAAGACCC; ptc fp, CTCCAAGTGTCGTCCGGTTT; ptc rp, TGTACTCCGAGTCGGAGGAATC; ptc probe, CGTGCCTCCTGGTCACACGAACAA; Gli1 fp, GGCTGTCGGAAGTCCTATTCAC; Gli1 rp, CAACCTTCTTGCTCACACATGTAAG; Gli1 probe, CGCACCTTCGGTCGCACACG; bcl-2 fp, GCCCTGTGCCACCATGTG; bcl-2 rp, CGGTAGCGACGAGAGAAGTCA; and bcl-2 probe, CCATCTGACCCTCCGCCGGG.
These probes were all labeled with the fluorescent dye FAM. The primer/probe mix for 18S was supplied by Applied Biosystems which was labeled with the fluorescent dye vic. Each cDNA sample was run in duplicate 25-µl volumes on a capped 96-well optical reaction plate. The plate was run in the Applied Biosystems Prism 7700 sequence detector using SDS software. The PCR conditions were as follows: 50°C for 2 min, 95°C for 10 min, then 40 cycles of 15 s at 95°C and 1 min at 60°C. The software then analyzed the data and output a pair of cycle threshold (ct) values for each sample. ct is the number of cycles needed to result in a signal crossing a set threshold. Each sample yielded two ct values, one for the gene of interest and one for the 18S housekeeping control. The ct values were then transported to a Microsoft Excel spreadsheet and analyzed to give a value representing the relative mRNA levels present for the gene of interest linearly as per the manufacturers instructions.
| Results |
|---|
|
|
|---|
Expression of mRNAs encoding Shh, ptc,
Smo, and Gli1 was investigated using RT-PCR. RNA
from adult thymus was used as a positive control and was compared with
the expression of these genes in both resting (t
= 0) and anti-CD3/CD28 Ab-activated (t =
72 h) CD4+ T cells. Specific transcripts for
Shh, ptc, Smo, and Gli1
were detected in both resting and activated CD4+
T cells (Fig. 1
).
|
Shh peptide promotes peripheral CD4+ T cell proliferation
Given that the Shh signaling pathway is both present in peripheral CD4+ T cells and has proliferative effects on many cell types, we investigated whether or not Shh modulates peripheral CD4+ T cell proliferation. Purified peripheral CD4+ T cells were cultured with and without the addition of the biologically active amino-terminal Shh peptide. An initial titration curve established that 500 ng/ml was the optimal dose of the Shh peptide to enhance proliferation of peripheral CD4+ T cells (data not shown), and this concentration was used in all subsequent experiments. Shh was added to CD4+ T cells that were resting, maximally stimulated with anti-CD3 (1 µg/ml) and anti-CD28 (5 µg/ml) Abs or suboptimally activated with anti-CD3 (0.25 µg/ml) and anti-CD28 (0.1 µg/ml).
No significant difference in the degree of proliferation was observed
following the addition of the Shh peptide in resting
CD4+ T cells (Fig. 2
A). In maximally stimulated T
cells, the Shh peptide was added at two time points, namely, 24 h
before (t = -24 h) or at the time of
anti-CD3/28 activation (t = 0). However, no
significant difference in the level of proliferation as determined by
[3H]TdR incorporation was detected at either
time point (Fig. 2
A).
|
Shh peptide promotes cell entry into S-G2 phase
The effect of Shh on CD4+ T cell
proliferation was investigated further using cell cycle analysis to
allow us to examine whether Shh affected cell survival or promoted
entry in the S-G2 proliferative phase of the cell
cycle. As with the [3H]TdR incorporation
studies, this analysis was conducted on resting
CD4+ T cells and those optimally and suboptimally
activated. Exogenous Shh was added at the time of
(t = 0) or 24 h before
(t = -24 h) anti-CD3/28 Ab activation and
the T cells were analyzed 72 h later. In the case of resting
CD4+ T cells, Shh peptide was added at
t = 0, and the cells were analyzed at 24, 48, and
72 h. The percent cells distributed in
sub-G1, G1, S, and
G2 phases of the cell cycle was analyzed, and
from this the percentage live cells in G1 and
S-G2 phases was calculated. Fig. 3
, A and B, shows a
representative plot of the cell cycle distribution in the presence or
absence of Shh (500 ng/ml) to demonstrate how the cell cycle was
analyzed.
|
In optimally activated CD4+ T cells
(anti-CD3, 1 µg/ml; anti-CD28, 5 µg/ml), the addition of
Shh at t = 0 promoted CD4+ T cell
entry into the S-G2 proliferative phase of the
cell cycle. The percentage of live cells is very similar with and
without Shh added, but of those live cells, the addition of exogenous
Shh promotes increased proliferation by entry into
S-G2 phase (Fig. 3
D). However, this
percent increase in live cells in the S-G2 phase
showed a variable range from 9 to 144% (mean, 63.7%;
n = 3) and did not reach statistical significance.
Adding Shh 24 h before optimal activation also promoted
CD4+T cell entry into the
S-G2 proliferative phase of the cell cycle.
Again, the percentage of live cells is very similar with and without
Shh added, but addition of Shh showed an increase in cells in the
S-G2 phase that ranged from 53.1 to 97.1% (mean,
71.5%; n = 3; p < 0.01).
To investigate whether or not this increase in
CD4+ T cell proliferation in response to
exogenous Shh could be further augmented in the absence of maximal
anti-CD3/28 Ab treatment, cell cycle analysis was also performed in
suboptimally activated CD4+ T cells. In these
CD4+ T cells, addition of Shh peptide at
time = 0 also resulted in an increase in proliferation (Fig. 3
D). As before with the optimally activated
CD4+T cells, the percent live cells is similar
with and without addition of Shh, but of those live cells, adding Shh
peptide at t = 0 promotes cell entry into the
proliferative S-G2 phase, with the percent
increase in live cells in the S-G2 phase ranging
from 27.8 to 77.8% (mean, 55.8%; n = 3;
p < 0.02). Addition of the Shh peptide 24 h
before suboptimal activation revealed an increase in the percentage of
live CD4+ T cells (p <
0.02). However, as Fig. 3
D shows, the pattern of the
previous experiments was repeated, as a significantly higher percentage
of those live cells entered the proliferative
S-G2 phase with addition of exogenous Shh ranging
from 34.6 to 110% (mean, 61.5%; n = 3;
p < 0.03).
Anti-Shh Ab inhibits TCR-mediated CD4+ T cell proliferation in vitro
Given that exogenous Shh promotes the proliferation of activated
CD4+ T cells, we were prompted to investigate
whether CD4+ T cells produce Shh following
TCR-mediated signaling. CD4+ T cells were
activated with anti-CD3/CD28 Abs in the presence of a neutralizing
anti-Shh Ab (5E1). The suboptimally activated
CD4+ T cells were used in this set of experiments
because under these conditions the cells showed increased proliferation
as determined by both [3H]TdR incorporation and
enhanced entry into the S-G2 phase of the cell
cycle. The addition of anti-Shh Ab at the time of activation
resulted in dose-dependent inhibition of proliferation. In the presence
of 50 µg/ml anti-Shh Ab, the decrease ranged from 71.3 to 85.1%
(mean, 77%; n = 3; p < 0.03; Fig. 4
). Inhibition of proliferation was not
detected in the presence of the isotype control Ab. These results
demonstrate that endogenous Shh is produced by activated
CD4+ T cells since the neutralizing Ab binds to
Shh but not to the receptor, ptc.
|
The effect of the anti-Shh Ab on the cell cycle was also
investigated (Table I
). As with the Shh
peptide studies, the anti-Shh Ab does not alter the percent live
cells in the culture but exerts its effect by blocking the entry of the
CD4+ T cells into the proliferative
S-G2 phase of the cell cycle. The percent
decrease in the proportion of CD4+ T cells in
S-G2 with addition of the anti-Shh Ab (50
µg/ml) ranged from 66.2 to 81.6% (mean, 73.4%; n =
3; p < 0.02). This effect was not seen with the
isotype control Ab, in which the percentage of
CD4+ T cells in the S-G2
phase was very similar (either a slight increase or decrease) compared
with medium-only activated CD4+ T cells. The
percent alteration in the proportion of CD4+ T
cells in S-G2 with addition of the isotype
control Ab ranged from 19 to 25% (mean, 23%; n =
3).
|
To analyze the mechanisms of Shh amplification of TCR-mediated activation in CD4+ T cells, the kinetics of expression of components of the Shh signaling pathway and bcl-2 were analyzed in activated CD4+ T cells in the presence and absence of exogenous Shh. CD4+ T cell cultures were set up as before, suboptimally activated with anti-CD3/CD28, and Shh was added at t = 0. RNA was extracted at 24, 48, and 72 h postactivation. It has been reported that a two times or greater increase in the transcription of any gene on at least two occasions is considered to be significant (26, 27). Proliferation assays and cell cycle analyses were also performed concurrently to ensure that the Shh peptide showed enhanced proliferation in these CD4+ T cell cultures.
To perform a time course analysis, the 48- and 72-h samples were
normalized to the 24-h RNA sample, assigned a value of 1. In
suboptimally anti-CD3/CD28-activated CD4+ T
cells in the absence of Shh, we detected a significantly increased
transcription of Shh and Gli1, no significant
changes were measured for the expression of either ptc or
bcl-2 (Fig. 5
A). In
the presence of exogenous Shh, Shh transcription was
increased at both 48 and 72 h. Gli1 transcription
increased at 48 h and was maintained at 72 h.
Bcl-2 transcripts increased at 48 and at 72 h. However,
although ptc transcription was marginally higher at 72
h it did not reach significance (Fig. 5
B).
|
|
| Discussion |
|---|
|
|
|---|
Shh has a proliferative effects on a variety of cell types including hemopoietic stem cells (14, 15, 16, 17, 19). We have reported that Shh and ptc protein are expressed in peripheral lymphoid tissue by immunocytochemistry and that the Shh signaling pathway components Shh, ptc, smo, and Gli1 are present in both resting and activated peripheral CD4+ T cells by RT-PCR. It has been demonstrated that members of the Shh signaling pathway are expressed in the thymus (19). Shh was present on the thymic epithelial cells but not thymocytes, whereas, the receptors, smo and ptc were detected on thymocytes at various stages of development (19). Furthermore, transcripts for Shh, ptc, and smo have been detected in mature CD3+ T cell populations (15), which is in agreement with the findings reported here.
We observed that the addition of exogenous Shh increased CD4+ T cell proliferation significantly in response to suboptimal stimulation with anti-CD3/28 Abs. This enhancement of proliferation was also noted following the addition of Shh 24 h before activation. In contrast, exogenous Shh failed to amplify T cell proliferation induced by optimal doses of anti-CD3/CD28 Abs. It is unlikely that in vivo Ag would be encountered in an environment that would result in the level of activation mediated by saturating doses of anti-CD3 and anti-CD28 Abs in vitro. Thus, Shh may function as a cofactor and contribute to clonal expansion of T cells under physiological conditions of stimulation.
These studies were extended to cell cycle analysis, and, with this more sensitive technique, we observed that exogenous Shh increased proliferation in activated CD4+ T cells if the Shh peptide was added either 24 h before or at the time of activation. Shh appears to promote CD4+ T cell entry into the proliferative S-G2 phase of the cell cycle. The exception to this was the increase in the percentage of live CD4+ T cells observed with addition of exogenous Shh 24 h before suboptimal anti-CD3/28 Ab activation. However, a significantly higher percentage of those live cells entered the proliferative S-G2 phase of the cell cycle with the addition of Shh. This effect of Shh has been reported for several other cell types (14, 17). For example, it has been demonstrated that Shh induced a disproportionate number of keratinocytes in the S-G2 phase of the cell cycle (14). Kenney and Rowitch (17) found that Shh increased the number of neuronal precursor cells in S phase. They also noted that Shh was unable to recruit quiescent cells into the cell cycle and could only sustain cell cycle progression. This may also be true for CD4+ T cells since we found that Shh has no effect on resting, nonactivated CD4+ T cells. Shh increased cell cycle progression only in cells that had been activated and which would have already entered the G1 phase of the cell cycle. The increased proliferation induced by Shh is not reflected in decreased levels of apoptosis as shown by cell cycle analysis. However, addition of Shh peptide did significantly increase the transcription of bcl-2. Shh has previously been shown to induce expression of bcl-2 (20). Bcl-2 is known to play an important role in the regulation of postthymic T cell survival (21, 22, 23, 24) and Shh may act, at least in part, by promoting survival of activated cells through the induction of bcl-2.
TCR-mediated signaling in CD4+ T cells can be blocked with anti-Shh-neutralizing Ab; therefore, this would suggest that Shh may be a normal component of the proliferative response. The proposed mechanism by which Shh exerts its proliferative effect was supported by the antiproliferative effect of the anti-Shh Ab. Again, no change was seen in the level of CD4+ T cell death, but the anti-Shh Ab executed its antiproliferative effect by blocking CD4+ T cell entry into the S-G2 phase of the cell cycle with the majority of cells arresting at G1 phase. Since this Ab binds to Shh, but not to its receptor ptc, this indicates that the Ab is blocking effects of endogenous Shh present in the CD4+ T cell culture. Therefore, it would appear that endogenous Shh maintains proliferation perhaps in an autocrine fashion, since blocking of this endogenous Shh results in decreased proliferation. Exogenous Shh serves to enhance this proliferation. This is supported by the quantitation of the Shh signaling pathway components by real-time PCR. Transcription of Shh mRNA was maximal at 72 h, corresponding to maximal proliferation in activated CD4+ T cells both with and without Shh peptide added to the culture. Therefore, it appears that even in normal activation conditions, Shh may function to maintain proliferation. When comparing the relative level of expression of transcripts of Shh in CD4+ T cell cultures in the presence and absence of Shh peptide, expression was reduced at 24 h in CD4+ T cell cultures to which exogenous Shh had been added. Thus, the presence of exogenous Shh may negatively regulate endogenous production by CD4+ T cells. Further evidence to support the theory that the Shh signaling pathway is involved in normal CD4+ T cell proliferation is the maximal transcription of Gli1 at 72 h.
Cell cycle progression is largely dependent on a regulatory network whose key components include the cyclins and cyclin-dependent kinases (cdks) (28, 29, 30, 31, 32). It has previously been shown that Shh expression is associated with increased activity of cdk2 and cdk4, important in G1-S transition, in keratinocytes under normal growth conditions (14). It has also been shown that Shh promotes cell cycle progression in proliferating neuronal precursors by maintaining expression of G1 phase cyclins such as cyclin D1, D2, and E, thought to be via synthesis of unknown protein intermediates (17). Recently, Hh signaling in Drosophila has been shown to promote DNA replication by up-regulation of cyclins D and E (33). These mechanisms may account for the ability of Shh to promote CD4+ T cell entry into the S-G2 phase of the cell cycle.
An alternative mode by which Shh can promote cell cycle progression, namely, entry into mitosis requires the activation and nuclear translocation of the M phase promoting factor (MPF) (34, 35). The MPF consists of two proteins, cdc2 and cyclin B1. ptc1 can interact with cyclin B1 and prevent nuclear translocation of the MPF and thereby prevent cell cycle progression. With addition of Shh to bind ptc, the release of cyclin B1 is facilitated, and nuclear import of the MPF and subsequently cell cycle progression can take place (36). However, we observed that the effects of Shh on the cell cycle in CD4+ T cells occurred in S phase, which implies that repression of MPF (which controls the latter G2-M phase) cannot fully account for our findings. The repressive effect of ptc on cell cycle progression could perhaps explain why the transcription of ptc mRNA does not increase throughout the course of proliferation as in the case of Shh mRNA and Gli1 mRNA. In summary, we have presented evidence for a link between Shh signaling and sustained and enhanced peripheral CD4+ T cell proliferation. This appears to via promotion of CD4+T cells into S-G2 phase of the cell cycle. Furthermore, Shh can be produced in an autocrine fashion by the CD4+ T cells themselves, functioning to amplify and maintain clonal expansion.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jacqueline A. Lowrey, Immunobiology Group, Medical Research Council Center for Inflammation Research, Respiratory Medicine Unit, University of Edinburgh Medical School, Teviot Place, Edinburgh EH8 9AG, U.K. E-mail address: J.A.Lowrey{at}ed.ac.uk ![]()
3 Abbreviations used in this paper: Hh, hedgehog; ptc, patched; smo, smoothened; Shh, sonic Hh; fp, forward primer; rp, reverse primer; ct, cycle threshold; cdk, cyclin-dependent kinase; MPF, M phase promoting factor. ![]()
Received for publication March 25, 2002. Accepted for publication June 17, 2002.
| References |
|---|
|
|
|---|
-cells. Diabetes 49:2039.This article has been cited by other articles:
![]() |
G. V. Hegde, K. J. Peterson, K. Emanuel, A. K. Mittal, A. D. Joshi, J. D. Dickinson, G. J. Kollessery, R. G. Bociek, P. Bierman, J. M. Vose, et al. Hedgehog-Induced Survival of B-Cell Chronic Lymphocytic Leukemia Cells in a Stromal Cell Microenvironment: A Potential New Therapeutic Target Mol. Cancer Res., December 1, 2008; 6(12): 1928 - 1936. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Varas, C. Hernandez-Lopez, J. Valencia, S. Mattavelli, V. G. Martinez, L. Hidalgo, C. Gutierrez-Frias, A. G. Zapata, R. Sacedon, and A. Vicente Survival and function of human thymic dendritic cells are dependent on autocrine Hedgehog signaling J. Leukoc. Biol., June 1, 2008; 83(6): 1476 - 1483. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. V. Hegde, C. M. Munger, K. Emanuel, A. D. Joshi, T. C. Greiner, D. D. Weisenburger, J. M. Vose, and S. S. Joshi Targeting of sonic hedgehog-GLI signaling: a potential strategy to improve therapy for mantle cell lymphoma Mol. Cancer Ther., June 1, 2008; 7(6): 1450 - 1460. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kobune, J. Kato, Y. Kawano, K. Sasaki, H. Uchida, K. Takada, S. Takahashi, R. Takimoto, and Y. Niitsu Adenoviral Vector-Mediated Transfer of the Indian Hedgehog Gene Modulates Lymphomyelopoiesis In Vivo Stem Cells, February 1, 2008; 26(2): 534 - 542. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Ji, F. C. Mei, B. H. Johnson, E. B. Thompson, and X. Cheng Protein Kinase A, not Epac, Suppresses Hedgehog Activity and Regulates Glucocorticoid Sensitivity in Acute Lymphoblastic Leukemia Cells J. Biol. Chem., December 28, 2007; 282(52): 37370 - 37377. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Rowbotham, A. L. Hager-Theodorides, M. Cebecauer, D. K. Shah, E. Drakopoulou, J. Dyson, S. V. Outram, and T. Crompton Activation of the Hedgehog signaling pathway in T-lineage cells inhibits TCR repertoire selection in the thymus and peripheral T-cell activation Blood, May 1, 2007; 109(9): 3757 - 3766. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. F. Chan, S.-y. Chau, L. Tian, Y. Chen, S. K. Y. Kwong, J. Quackenbush, M. Dallman, J. Lamb, and P. K. H. Tam Sonic hedgehog promotes CD4+ T lymphocyte proliferation and modulates the expression of a subset of CD28-targeted genes Int. Immunol., December 1, 2006; 18(12): 1627 - 1636. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Martinez, F. Larbret, F. Zobairi, J. Coulombe, N. Debili, W. Vainchenker, M. Ruat, and J.-M. Freyssinet Transfer of differentiation signal by membrane microvesicles harboring hedgehog morphogens Blood, November 1, 2006; 108(9): 3012 - 3020. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Bijlsma, M. P. Peppelenbosch, and C. A. Spek Hedgehog Morphogen in Cardiovascular Disease Circulation, October 31, 2006; 114(18): 1985 - 1991. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Willinger, T. Freeman, M. Herbert, H. Hasegawa, A. J. McMichael, and M. F. C. Callan Human Naive CD8 T Cells Down-Regulate Expression of the WNT Pathway Transcription Factors Lymphoid Enhancer Binding Factor 1 and Transcription Factor 7 (T Cell Factor-1) following Antigen Encounter In Vitro and In Vivo J. Immunol., February 1, 2006; 176(3): 1439 - 1446. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sacedon, B. Diez, V. Nunez, C. Hernandez-Lopez, C. Gutierrez-Frias, T. Cejalvo, S. V. Outram, T. Crompton, A. G. Zapata, A. Vicente, et al. Sonic Hedgehog Is Produced by Follicular Dendritic Cells and Protects Germinal Center B Cells from Apoptosis J. Immunol., February 1, 2005; 174(3): 1456 - 1461. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gutierrez-Frias, R. Sacedon, C. Hernandez-Lopez, T. Cejalvo, T. Crompton, A. G. Zapata, A. Varas, and A. Vicente Sonic Hedgehog Regulates Early Human Thymocyte Differentiation by Counteracting the IL-7-Induced Development of CD34+ Precursor Cells J. Immunol., October 15, 2004; 173(8): 5046 - 5053. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kobune, Y. Ito, Y. Kawano, K. Sasaki, H. Uchida, K. Nakamura, H. Dehari, H. Chiba, R. Takimoto, T. Matsunaga, et al. Indian hedgehog gene transfer augments hematopoietic support of human stromal cells including NOD/SCID-{beta}2m-/- repopulating cells. Blood, August 15, 2004; 104(4): 1002 - 1009. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sacedon, A. Varas, C. Hernandez-Lopez, C. Gutierrez-deFrias, T. Crompton, A. G. Zapata, and A. Vicente Expression of Hedgehog Proteins in the Human Thymus J. Histochem. Cytochem., November 1, 2003; 51(11): 1557 - 1566. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Stewart, J. A. Lowrey, S. J. Wakelin, P. M. Fitch, S. Lindey, M. J. Dallman, J. R. Lamb, and S. E. M. Howie Sonic Hedgehog Signaling Modulates Activation of and Cytokine Production by Human Peripheral CD4+ T Cells J. Immunol., November 15, 2002; 169(10): 5451 - 5457. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |