HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Andoh, A. Articles by Fujiyama, Y. Search for Related Content PubMed PubMed Citation Articles by Andoh, A. Articles by Fujiyama, Y. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene Substance via MeSH

IL-17 Selectively Down-Regulates TNF--Induced RANTES Gene Expression in Human Colonic Subepithelial Myofibroblasts¹

Division of Gastroenterology, Shiga University of Medical Science, Otsu, Japan

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
IL-17 enhances the TNF--induced IL-6 and IL-8 secretion in human colonic subepithelial myofibroblasts. In this study, we investigated how IL-17 modulates RANTES secretion in these cells. TNF- potently induced RANTES secretion, but IL-17 dose-dependently inhibited the TNF--induced RANTES secretion. This was also observed at the mRNA level. Even after pretreatment with TNF- for 12 h, the inhibitory effect of IL-17 was detectable. IL-17 did not affect the TNF--induced stability of the RANTES gene. IL-17 significantly decreased the TNF--induced increase in RANTES promoter activity, and IL-17 actually blocked the TNF--induced RANTES gene transcription. EMSAs demonstrated that IL-17 did not modulate the TNF--induced NF-B DNA-binding activity, but markedly decreased TNF--induced IFN regulatory factor-1 (IRF-1) DNA-binding activity. Because cooperation between NF-B and IRF-1 is important in the TNF--induced RANTES gene expression, the major mechanism mediating the inhibitory effect of IL-17 may be achieved by the inhibition of IRF-1 DNA-binding activity.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Chemokines, a family of small chemotactic cytokines, regulate the migration and activation of leukocytes, and therefore play a key role in the inflammatory and infectious processes of the intestine. RANTES is a member of the CC chemokine family and is strongly chemotactic for T lymphocytes, monocytes, basophils, and eosinophils (1, 2, 3), all cell types which are present and activated in the lesions of chronic inflammation. There is an increasing number of reports demonstrating a role for RANTES in the pathophysiology of inflammatory bowel disease (IBD)³ (4, 5). However, the cellular source of RANTES and its regulation in the intestine has not fully been understood.

IL-17 is a newly identified T cell-specific cytokine (6, 7). Human IL-17 is an 20-kDa glycoprotein of 155 aa, and IL-17 secretion is strictly limited in activated CD4⁺ and CD8⁺ T lymphocytes, predominantly in the memory CD45RO⁺ cells (8, 9). In particular, both the Th1 and Th2 subsets of CD4⁺ cells release IL-17. IL-17, in turn, induces several genes associated with inflammation via NF-B activation. Recently, we reported that IL-17 potently enhanced IL-1- and TNF--induced IL-6, IL-8, and monocyte chemoattractant protein (MCP)-1 secretion in myofibroblasts derived from the human colon and pancreas (10, 11).

The contribution of colonic subepithelial myofibroblasts (SEMFs) in RANTES secretion has not yet been defined. Colonic SEMFs are present immediately subjacent to the basement membrane in the normal intestinal mucosa, juxtaposed against the bottom of the epithelial cells (12, 13). These cells play a role in the regulation of a number of epithelial cell functions, such as epithelial proliferation and differentiation. In this study, we investigated the role of IL-17 in the induction of RANTES secretion in colonic SEMFs, and found that IL-17 selectively down-regulated TNF--induced RANTES secretion. Although IL-17 has been characterized as a proinflammatory cytokine by its activity to induce NF-B activation, the finding in this study suggests that IL-17 might be a novel class of cytokines which possesses both pro- and anti-inflammatory natures.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Reagents

Recombinant human IL-1, IL-17, and TNF- were obtained from R&D Systems (Minneapolis, MN). All other reagents used in this study were purchased from Sigma-Aldrich (St. Louis, MO).

Culture of human colonic SEMFs

The primary cultures of SEMFs were generated and cultured according to the methods described previously (11, 12). Samples of the human adult colonic mucosa were obtained from surgical specimens (>5 cm from the tumor margin) from patients undergoing a partial colectomy for carcinoma, with their informed consent. The studies were performed on passages 2–6 of myofibroblasts isolated from six resection specimens.

Quantification of human RANTES and IL-8

The amounts of antigenic RANTES and IL-8 in the samples were determined by sandwich ELISA kits purchased from BioSource International (Camarillo, CA).

Northern blot analysis

Northern blotting and hybridization were performed according to the method previously described (10, 11, 14).

Nuclear extracts and EMSAs

Nuclear extracts were prepared from cells exposed to IL-1 (1.0 ng/ml), IL-17 (100 ng/ml), and TNF- (50 ng/ml) for 1.5 h according to the method of Dignam et al. (15). Oligonucleotides of the RANTES NF-B element located between nt -50 to -29 of the RANTES promoter (5'-ACTCCCCTTAGGGGATCCCCT) (16) and the IFN-stimulated regulatory element (ISRE) located between nt -124 to -97 (5'-CTATTTCAGTTTTCTTTTCCGTTTTGTG) were used. The oligonucleotides were 5' end-labeled with T4 polynucleotide kinase (Promega, Madison, WI) and [-³²P]ATP (Amersham Biosciences, Piscataway, NJ). The binding reactions were performed according to methods previously described (14). Antisera for the supershift assay was purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

RANTES promoter luciferase reporter constructs and cell transfection

Human RANTES promoter region was amplified by PCR using human genomic DNA as a template with the primers: RANTES (-398), GTAAGATCTGTAATGAATAAGCAGGAA; RANTES (+46) TGGGAGAGGCTGTGCGAGGTCCACGTG. The 5' sequence of RANTES (-398) was modified for the BglII site, and the 5' region of RANTES (+46) was modified for the HindIII site, respectively. These fragments were ligated into the BglII and HindIII sites of the luciferase reporter plasmid pGL3-Basic (Promega) yielding the reporter construct. Transient transfection was performed by using lipofectamine plus reagent (Life Technologies, Grand Island, NY) according to the manufacturer’s instructions. Twenty hours before transfection, 1 x 10⁶ cells were plated in triplicate in 35-mm wells of a six-well plate. For each well, 1 µg plasmid DNA and 0.2 µg -galactosidase reporter vector pCMV (Clontech Laboratories, Palo Alto, CA) were cotransfected and incubated for 24 h. Then, the medium was changed and cells were incubated in the presence of stimuli further for 12 h. The luciferase activity was measured by the Luciferase Assay System kit (Promega) and expressed as relative activity normalized to -galactosidase activity.

Mutated reporter constructs were generated by a PCR-based site-directed mutagenesis kit (Stratagene, La Jolla, CA). The NF-B element and the ISRE were modified to ACTCCCCTTAGGcctTaaCCT and CTATTTCAGTaaaCTaaaCCGTTTTGTG, respectively. Underlined letters designate mutated sequence.

Nuclear run-on assays

Nuclear run-on assays, using nuclei from confluent SEMFs, were performed according to the method described previously (14). In this experiment, cells were exposed to stimuli for 5 h, scraped off, and lysed in buffer (10 mM Tris, pH 7.4, 10 mM NaCl₂, 3 mM MgCl₂, 0.5% Nonidet P-40). Empty plasmids of the TA cloning vector were also used to detect nonspecific backgrounds.

Statistical analysis

The data are expressed as means ± SD. The statistical significance of the changes was determined by the Mann-Whitney U test. Differences resulting in p values <0.05 were considered to be statistically significant.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Inhibitory effects of IL-17 on TNF--induced RANTES secretion

Human SEMFs were incubated for 24 h with increasing concentrations of TNF-, IL-1, and IL-17, and the amount of RANTES secreted into the supernatant was determined by ELISA. As shown in Fig. 1A, the addition of TNF- induced a dose-dependent increase in RANTES secretion, and the addition of IL-17 dose-dependently inhibited this TNF--induced RANTES secretion.

View larger version (33K): [in this window] [in a new window]   FIGURE 1. Effects of IL-17 on TNF-- and/or IL-1-induced RANTES secretion in human SEMFs. A, The cells were incubated for 24 h in the presence of TNF- with increasing concentrations of IL-17. B, The cells were incubated for 24 h in the presence of IL-1 with increasing concentrations of IL-17. Values are expressed as mean ± SD (n = 4).

Effects of IL-17 on TNF--induced RANTES mRNA expression

As shown in Fig. 2A, TNF- (50 ng/ml) rapidly induced RANTES mRNA expression in colonic SEMFs, and this gradually increased over 24 h. The inhibitory effects of IL-17 on RANTES mRNA expression were also evaluated (Fig. 2B). The cells were stimulated for 6 h with IL-17 (100 ng/ml), IL-1 (1.0 ng/ml), TNF- (50 ng/ml) or a combination of these cytokines. IL-17 did not affect the IL-1-induced RANTES mRNA expression, but markedly decreased the TNF--induced RANTES mRNA expression. In contrast, IL-17 enhanced the IL-1- and TNF--induced IL-8 mRNA expression.

View larger version (29K): [in this window] [in a new window]   FIGURE 2. A, Kinetics of RANTES mRNA expression. The cells were cultured in the presence of TNF- (50 ng/ml), and RANTES mRNA expression was sequentially determined by Northern blotting. B, Effects of IL-17 on IL-1- and TNF--induced RANTES mRNA expression. The cells were stimulated for 6 h, and RANTES and IL-8 mRNA expression was determined by Northern blotting. Lane 1, medium only; lane 2, IL-17 (100 ng/ml); lane 3, IL-1 (10 ng/ml); lane 4, IL-1 + IL-17; lane 5, TNF- (50 ng/ml); lane 6, TNF- + IL-17. C, Effects of IL-17 on RANTES mRNA expression in TNF- pretreated cells. The cells were pretreated with TNF- (50 ng/ml) for 12 h, and further incubated with TNF- alone or TNF- + IL-17 (100 ng/ml). To detect rapid effects of IL-17, the exposure time used in C was shorter than that used in A and B.

Effects of IL-17 on TNF--induced RANTES promoter and transcriptional activity

Previously, it has been reported that the transcription factors NF-B and IFN regulatory factor (IRF) play a role in TNF--induced RANTES gene expression (3, 16). We performed a promoter assay using a RANTES promoter-luciferase construct containing NF-B-binding motifs and ISRE. As shown in Fig. 3A, TNF- induced a significant increase in RANTES promoter activity, but this was potently blocked by the mutation of either the NF-B-binding or ISRE motifs. This indicates that both the NF-B and ISRE motifs are critical for TNF--induced RANTES expression. Similarly, IL-17 markedly decreased TNF--induced RANTES promoter activity.

View larger version (32K): [in this window] [in a new window]   FIGURE 3. A, Effects of IL-17 and TNF- on RANTES promoter activity. Human RANTES promoter DNA and -galactosidase reporter vector were cotransfected and incubated for 24 h. Then, the cells were incubated in the presence of stimuli further for 12 h. Values are expressed as mean ± SD (n = 4); **, p < 0.01. B, Nuclear run-on assays for evaluation of transcriptional activation of chemokine genes. Nuclei were isolated 6 h after stimulation with IL-17 (100 ng/ml) and TNF- (50 ng/ml), and nuclear run-on assays were performed in the presence of [-32P]UTP, as described in Materials and Methods. C, Evaluation of RANTES mRNA stability. The cells were stimulated with TNF- (50 ng/ml) or IL-17 (100 ng/ml) for 6 h, and then treated with actinomycin D (5 µg/ml) for various time periods. RANTES mRNA expression was detected by Northern blot.

Stability study of RANTES mRNA

To evaluate the effects of IL-17 on RANTES mRNA stability, the cells were pretreated for 6 h with TNF- (50 ng/ml) or TNF- (50 ng/ml) + IL-17 (100 ng/ml), washed and then incubated with actinomycin D (5 µg/ml) to block further mRNA transcription. As shown in Fig. 3C, there were no differences in RANTES mRNA stability, indicating that the inhibitory effect of IL-17 was not associated with a posttranscriptional mechanism.

Modulation of transcription factor activation

To elucidate the mechanisms underlying the response to IL-17, we evaluated the activation of the transcription factors NF-B and IRF in human SEMFs. As demonstrated in Fig. 4A, stimulation with IL-17 (500 ng/ml) induced an increase in RANTES NF-B-DNA-binding activity. TNF- (50 ng/ml) induced a strong NF-B DNA binding, but IL-17 did not affect the TNF--induced NF-B DNA-binding activity. This was compatible with our previous observation, in which a conventional NF-B probe was used (11). The specificity of this reaction was confirmed by the addition of cold oligo-DNA, which abolished the reactive band.

View larger version (56K): [in this window] [in a new window]   FIGURE 4. A, EMSAs for NF-B and IRF DNA-binding activities. The cells were incubated with medium alone, IL-17 (100 ng/ml), IL-1 (10 ng/ml), TNF- (50 ng/ml), or these combinations for 1.5 h, and then nuclear extracts were prepared. N.S. refers to a nonspecific band.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
We have shown that human colonic SEMFs in culture can be induced to release RANTES when incubated with TNF- and IL-1. The stimulatory effect of TNF- was much stronger than that induced by IL-1. Furthermore, this study was the first to demonstrate that IL-17, which has been regarded as a proinflammatory cytokine (10, 11, 14), inhibits the TNF--induced RANTES secretion in these cells. Although very little is known about the factors that inhibit RANTES secretion (17, 18), IL-17 is a unique cytokine which can cause a potent inhibition of TNF--inducedRANTES secretion. Furthermore, it is of particular interest to note that the inhibitory action of IL-17 is specific for TNF- stimulation, because IL-17 did not affect the IL-1-induced RANTES secretion. This inhibitory effect of IL-17 on RANTES secretion stands in opposition to its stimulatory effects on TNF--induced IL-6, IL-8, and MCP-1 secretion in these cells (11). In many cells, the regulation of RANTES secretion has been reported to be coupled to that of IL-8 and MCP-1 secretion through the NF-B signaling pathway (3, 14, 19, 20). Based on this viewpoint, IL-17 may be a cytokine of a novel class which exerts a counterregulatory action on chemokine (IL-8, MCP-1, and RANTES) secretion.

IBD is clinically characterized by a recurrent flare with chronic inflammation in the intestine. Recent studies demonstrated an increase in the number of RANTES-expressing cells in the inflamed mucosa of IBD patients (4, 5). Although IL-17 expression in IBD has not been reported, we recently observed that IL-17-expressing cells also increased in the IBD mucosa (S. Fujino, A. Andoh, S. Bamba, A. Ogawa, K. Hata, Y. Araki, T. Bamba, Y. Fujiyama, unpublished data). RANTES has marked chemotactic activity for various leukocytes including monocytes, CD4⁺ T cells, eosinophils, and basophils (1, 2, 3), all of which are responsible for perpetuating chronic inflammation rather than initiating acute inflammation. In fact, these inflammatory cells are prominent in the mucosa of the chronic phase of IBD patients. In particular, the RANTES-mediated chemotactic activity of CD4⁺/CD45RO⁺ memory T cells might be of special interest, because these cells are regarded as the major source of IL-17 (9). IL-17 secretion will be subsequently induced in activated CD4⁺ T cells recruited by RANTES, and IL-17 exerts its inhibitory action on RANTES secretion. The IL-17-mediated inhibition of RANTES secretion in the TNF--stimulated SEMFs may be an autoregulatory mechanism for the prevention of excess infiltration and activation of T cells and other leukocytes. Following the inhibition of RANTES secretion, IL-17 may trigger a flare of mucosal inflammation via induction of IL-6, IL-8, and MCP-1 secretion in SEMFs (11). Thus, it is likely that IL-17 may play a role in a flare-up of IBD through its counterregulation of chemokine (IL-8, MCP-1, and RANTES) secretion.

Human RANTES mRNA expression is differentially regulated based on the cell type and the stimulus applied. With T cell differentiation, RANTES mRNA expression is up-regulated late (after 3–5 days) (21), but many other cell types, including SEMFs, transiently up-regulate RANTES mRNA rapidly, within hours after stimuli such as proinflammatory cytokines (3, 14, 19). In this rapid induction of the RANTES gene, the role of NF-B activation has been discussed (3, 22). In addition, the participation of IRF-1 in TNF--induced RANTES gene expression has also been reported (16, 23). IRF-1 binds to the ISRE located between nt -126 to -92 of the RANTES promoter (16). Thus, TNF- requires the cooperation of NF-B and IRF-1 transcription factors to induce RANTES gene expression. Lee et al. (23) recently reported that a mutation of either the ISRE or the NF-B-binding motifs of the RANTES promoter markedly decreased TNF--induced RANTES promoter activity. In this study, we also demonstrated that a mutation of the ISRE motif strongly reduced TNF--induced RANTES promoter activity in SEMFs. These findings suggest that the inhibitory effects of IL-17 on TNF--induced RANTES gene expression may be achieved by the inhibition of TNF--induced IRF-1 DNA-binding activity. A blockade of the cooperation between NF-B and IRF-1 by reducing IRF-1 DNA-binding activity may be the major mechanism responsible for the inhibitory effects of IL-17 on TNF--induced RANTES expression. The inhibitory effect of IL-17 was specific for the RANTES gene, because the promoter regions of IL-8 and other inflammatory genes such as MCP-1 and IL-6 do not include the ISRE, and hence their expression depends mainly on NF-B activation. The importance of IRF-1 in RANTES gene expression is suggested by its responses to IL-1. In SEMFs, IL-1 induced NF-B DNA-binding activity, but did not induce IRF-1 DNA-binding activity. The lack of IRF-1 signaling may be a possible explanation for the inability of IL-17 to modulate IL-1-induced RANTES expression. To our knowledge, IL-17 is characterized by its novel activity that is both NF-B activated and IRF inhibited.

In conclusion, this study demonstrated that SEMFs are a local source of RANTES in the colonic mucosa. It is likely that the primary role of IL-17 in mucosal inflammation is to regulate many other proinflammatory genes, and to tune the acute and chronic inflammatory processes. Further investigation using SEMFs will clarify the regulatory mechanisms involved in the pathogenesis of IBD.

	Footnotes

 
¹ This study was supported in part by Grants-in-Aid for Scientific Research (B) from the Ministry of Education, Culture, Sports, Science and Technology, Japan (12470121 and 13470119).

² Address correspondence and reprint requests to Dr. Akira Andoh, Division of Gastroenterology, Shiga University of Medical Science, Seta-Tsukinowa, Otsu 520-2192, Japan. E-mail address: andoh{at}belle.shiga-med.ac.jp

³ Abbreviations used in this paper: IBD, inflammatory bowel disease; MCP, monocyte chemoattractant protein; SEMF, subepithelial myofibroblast; ISRE, IFN-stimulated regulatory element; IRF, IFN regulatory element.

Received for publication April 15, 2002. Accepted for publication June 3, 2002.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Schall, T. J., K. Bacon, K. J. Toy, D. V. Goeddel. 1990. Selective attraction of monocytes and T lymphocytes of the memory phenotype by cytokine RANTES. Nature 347:669.[Medline]
2. Rot, A., M. Krieger, T. Brunner, S. C. Bischoff, T. J. Schall, C. A. Dahinden. 1992. RANTES and macrophage inflammatory protein 1 induce the migration and activation of normal human eosinophil granulocytes. J. Exp. Med. 176:1489.[Abstract/Free Full Text]
3. Lebovic, D. I., V. A. Chao, J. F. Martini, R. N. Taylor. 2001. IL-1 induction of RANTES (regulated upon activation, normal T cell expressed and secreted) chemokine gene expression in endometriotic stromal cells depends on a nuclear factor-B site in the proximal promoter. J. Clin. Endocrinol. Metab. 86:4759.[Abstract/Free Full Text]
4. Mazzucchelli, L., C. Hauser, K. Zgraggen, H. E. Wagner, M. W. Hess, J. A. Laissue, C. Mueller. 1996. Differential in situ expression of the genes encoding the chemokines MCP-1 and RANTES in human inflammatory bowel disease. J. Pathol. 178:201.[Medline]
5. Yang, S. K., M. S. Choi, O. H. Kim, S. J. Myung, H. Y. Jung, W. S. Hong, J. H. Kim, Y. I. Min. 2002. The increased expression of an array of C-X-C and C-C chemokines in the colonic mucosa of patients with ulcerative colitis: regulation by corticosteroids. Am. J. Gastroenterol. 97:126.[Medline]
6. Fossiez, F., J. Banchereau, R. Murray, C. Van Kooten, P. Garrone, S. Lebecque. 1998. Interleukin-17. Int. Rev. Immunol. 16:541.[Medline]
7. Yao, Z., S. L. Painter, W. C. Fanslow, D. Ulrich, B. M. Macduff, M. K. Spriggs, R. J. Armitage. 1995. Human IL-17: a novel cytokine derived from T cells. J. Immunol. 155:5483.[Abstract]
8. Albanesi, C., C. Scarponi, A. Cavani, M. Federici, F. Nasorri, G. Girolomoni. 2000. Interleukin-17 is produced by both Th1 and Th2 lymphocytes, and modulates interferon-- and interleukin-4-induced activation of human keratinocytes. J. Invest. Dermatol. 115:81.[Medline]
9. Shin, H. C., N. Benbernou, S. Esnault, M. Guenounou. 1999. Expression of IL-17 in human memory CD45RO⁺ T lymphocytes and its regulation by protein kinase A pathway. Cytokine 11:25.
10. Shimada, M., A. Andoh, K. Hata, K. Tasaki, Y. Araki, Y. Fujiyama, T. Bamba. 2002. IL-6 secretion by human pancreatic periacinar myofibroblasts in response to inflammatory mediators. J. Immunol. 168:861.[Abstract/Free Full Text]
11. Hata, K., A. Andoh, M. Shimada, S. Fujino, S. Bamba, Y. Araki, T. Okuno, Y. Fujiyama, T. Bamba. 2002. IL-17 stimulates inflammatory responses via NF-B and MAP kinase pathways in human colonic myofibroblasts. Am. J. Physiol. 282:G1035.[Abstract/Free Full Text]
12. Mahida, Y. R., J. Beltinger, S. Marh, M. Goke, T. Gray, D. K. Podolsky, C. J. Hawkey. 1997. Adult human colonic subepithelial myofibroblasts express extracellular matrix proteins and cyclooxygenase-1 and -2. Am. J. Physiol. 273:G1341.[Abstract/Free Full Text]
13. Powell, D. W., R. C. Mifflin, J. D. Valentich, S. E. Crowe, J. I. Saada, A. B. West. 1999. Myofibroblasts II. Intestinal subepithelial myofibroblasts. Am. J. Physiol. 277:C183.
14. Andoh, A., H. Takaya, T. Saotome, M. Shimada, K. Hata, Y. Araki, F. Nakamura, Y. Shintani, Y. Fujiyama, T. Bamba. 2000. Cytokine regulation of chemokine (IL-8, MCP-1, and RANTES) gene expression in human pancreatic periacinar myofibroblasts. Gastroenterology 119:211.[Medline]
15. Dignam, J. D., R. M. Lebovitz, R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475.[Abstract/Free Full Text]
16. Genin, P., M. Algarte, P. Roof, R. Lin, J. Hiscott. 2000. Regulation of RANTES chemokine gene expression requires cooperativity between NF-B and IFN-regulatory factor transcription factors. J. Immunol. 164:5352.[Abstract/Free Full Text]
17. John, M., S. J. Hirst, P. J. Jose, A. Robichaud, N. Berkman, C. Witt, C. H. Twort, P. J. Barnes, K. F. Chung. 1997. Human airway smooth muscle cells express and release RANTES in response to T helper 1 cytokines: regulation by T helper 2 cytokines and corticosteroids. J. Immunol. 158:1841.[Abstract]
18. Ayad, O., J. M. Stark, M. M. Fiedler, I. Y. Menendez, M. A. Ryan, H. R. Wong. 1998. The heat shock response inhibits RANTES gene expression in cultured human lung epithelium. J. Immunol. 161:2594.[Abstract/Free Full Text]
19. Roebuck, K. A., L. R. Carpenter, V. Lakshminarayanan, S. M. Page, J. N. Moy, L. L. Thomas. 1999. Stimulus-specific regulation of chemokine expression involves differential activation of the redox-responsive transcription factors AP-1 and NF-B. J. Leukocyte Biol. 65:291.[Abstract]
20. Fujisawa, T., Y. Kato, J. Atsuta, A. Terada, K. Iguchi, H. Kamiya, H. Yamada, T. Nakajima, M. Miyamasu, K. Hirai. 2000. Chemokine production by the BEAS-2B human bronchial epithelial cells: differential regulation of eotaxin, IL-8, and RANTES by TH2- and TH1-derived cytokines. J. Allergy Clin. Immunol. 105:126.[Medline]
21. Song, A., T. Nikolcheva, A. M. Krensky. 2000. Transcriptional regulation of RANTES expression in T lymphocytes. Immunol. Rev. 177:236.[Medline]
22. Moriuchi, H., M. Moriuchi, A. S. Fauci. 1997. Nuclear factor-B potently up-regulates the promoter activity of RANTES, a chemokine that blocks HIV infection. J. Immunol. 158:3483.[Abstract]
23. Lee, A. H., J. H. Hong, Y. S. Seo. 2000. Tumor necrosis factor- and interferon- synergistically activate the RANTES promoter through nuclear factor B and interferon regulatory factor 1 (IRF-1) transcription factors. Biochem J. 350:131.

This article has been cited by other articles:

				J. H. Niess, F. Leithauser, G. Adler, and J. Reimann Commensal Gut Flora Drives the Expansion of Proinflammatory CD4 T Cells in the Colonic Lamina Propria under Normal and Inflammatory Conditions J. Immunol., January 1, 2008; 180(1): 559 - 568. [Abstract] [Full Text] [PDF]

				S. Wiehler and D. Proud Interleukin-17A modulates human airway epithelial responses to human rhinovirus infection Am J Physiol Lung Cell Mol Physiol, August 1, 2007; 293(2): L505 - L515. [Abstract] [Full Text] [PDF]

				S. Schnyder-Candrian, D. Togbe, I. Couillin, I. Mercier, F. Brombacher, V. Quesniaux, F. Fossiez, B. Ryffel, and B. Schnyder Interleukin-17 is a negative regulator of established allergic asthma J. Exp. Med., November 27, 2006; 203(12): 2715 - 2725. [Abstract] [Full Text] [PDF]

				J. Adams, E. Kiss, A. B.V. Arroyo, M. Bonrouhi, Q. Sun, Z. Li, N. Gretz, A. Schnitger, C. C. Zouboulis, M. Wiesel, et al. 13-cis Retinoic Acid Inhibits Development and Progression of Chronic Allograft Nephropathy Am. J. Pathol., July 1, 2005; 167(1): 285 - 298. [Abstract] [Full Text] [PDF]

				J. Liu, X. Guan, and X. Ma Interferon Regulatory Factor 1 Is an Essential and Direct Transcriptional Activator for Interferon {gamma}-induced RANTES/CCl5 Expression in Macrophages J. Biol. Chem., July 1, 2005; 280(26): 24347 - 24355. [Abstract] [Full Text] [PDF]

				F. Shen, M. J. Ruddy, P. Plamondon, and S. L. Gaffen Cytokines link osteoblasts and inflammation: microarray analysis of interleukin-17- and TNF-{alpha}-induced genes in bone cells J. Leukoc. Biol., March 1, 2005; 77(3): 388 - 399. [Abstract] [Full Text] [PDF]

				M. J. Ruddy, G. C. Wong, X. K. Liu, H. Yamamoto, S. Kasayama, K. L. Kirkwood, and S. L. Gaffen Functional Cooperation between Interleukin-17 and Tumor Necrosis Factor-{alpha} Is Mediated by CCAAT/Enhancer-binding Protein Family Members J. Biol. Chem., January 23, 2004; 279(4): 2559 - 2567. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Andoh, A. Articles by Fujiyama, Y. Search for Related Content PubMed PubMed Citation Articles by Andoh, A. Articles by Fujiyama, Y. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene Substance via MeSH