The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sato, Y.
Right arrow Articles by Sato, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sato, Y.
Right arrow Articles by Sato, N.
The Journal of Immunology, 2002, 169: 1611-1618.
Copyright © 2002 by The American Association of Immunologists

Detection and Induction of CTLs Specific for SYT-SSX-Derived Peptides in HLA-A24+ Patients with Synovial Sarcoma1

Yuriko Sato*,{dagger}, Yuki Nabeta*, Tomohide Tsukahara*,{dagger}, Yoshihiko Hirohashi{dagger}, Rong Syunsui{dagger}, Akiko Maeda{dagger}, Hiroeki Sahara{dagger}, Hideyuki Ikeda{dagger}, Toshihiko Torigoe{dagger}, Shingo Ichimiya{dagger}, Takuro Wada*, Toshihiko Yamashita*, Hiroaki Hiraga{ddagger}, Akira Kawai§, Takeshi Ishii, Nobuhito Araki||, Akira Myoui#, Seiichi Matsumoto**, Tohru Umeda{dagger}{dagger}, Seiichi Ishii*, Satoshi Kawaguchi2,* and Noriyuki Sato{dagger}

Departments of * Orthopedic Surgery and {dagger} Pathology, Sapporo Medical University School of Medicine, and {ddagger} Department of Clinical Research, Division of Orthopedics, National Sapporo Hospital, Sapporo, Japan; § Department of Orthopedic Surgery, Okayama University Medical School, Okayama, Japan; Department of Orthopedic Surgery, Chiba Cancer Center Hospital, Chiba, Japan; || Department of Orthopedic Surgery, Osaka Medical Center for Cancer and Cardiovascular Diseases, and # Department of Orthopedics, Osaka University Graduate School of Medicine, Osaka, Japan; and ** Department of Orthopedic Surgery, Cancer Institute Hospital, and {dagger}{dagger} Department of Orthopedic Surgery, National Cancer Center Hospital, Tokyo, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To investigate the immunogenic property of peptides derived from the synovial sarcoma-specific SYT-SSX fusion gene, we synthesized four peptides according to the binding motif for HLA-A24. The peptides, SS391 (PYGYDQIMPK) and SS393 (GYDQIMPKK), were derived from the breakpoint of SYT-SSX, and SS449a (AWTHRLRER) and SS449b (AWTHRLRERK) were from the SSX region. These peptides were tested for their reactivity with CTL precursors (CTLps) in 16 synovial sarcoma patients using HLA-A24/SYT-SSX peptide tetramers and also for induction of specific CTLs from four HLA-A24+ synovial sarcoma patients. Tetramer analysis indicated that the increased CTLp frequency to the SYT-SSX was associated with pulmonary metastasis in synovial sarcoma patients (p < 0.03). CTLs were induced from PBLs of two synovial sarcoma patients using the peptide mixture of SS391 and SS393, which lysed HLA-A24+ synovial sarcoma cells expressing SYT-SSX as well as the peptide-pulsed target cells in an HLA class I-restricted manner. These findings suggest that aberrantly expressed SYT-SSX gene products have primed SYT-SSX-specific CTLps in vivo and increased their frequency in synovial sarcoma patients. The identification of SYT-SSX peptides may offer an opportunity to design peptide-based immunotherapeutic approaches for HLA-A24+ patients with synovial sarcoma.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Current immunotherapeutic strategies depend largely on identification of tumor antigenic peptides (1). Although a number of antigenic peptides have been identified by using autologous tumor cell-CTL pairs, the difficulty in establishing such autologous pairs has hampered identification of antigenic peptides from bone and soft tissue sarcomas (2). Recently, chimeric fusion genes resulting from tumor-specific chromosomal translocations have been identified in several types of soft tissue sarcomas, including SYT-SSX in synovial sarcoma (3, 4, 5), EWS-Fli1 in Ewing’s sarcoma (6), and TLS-CHOP in myxoid/round cell liposarcoma (7, 8). These chimeric genes have been considered to play a key role in the genesis of soft tissue sarcomas (9) in association with their diagnostic (10, 11, 12) and prognostic (13, 14) significance. At the same time, identification of the chimeric genes has provided a unique opportunity to examine the immunological response against the tumor-specific chimeric sequences, which serve as putative antigenic peptides.

Synovial sarcoma accounts for 5–10% of all soft tissue sarcomas and occurs mainly in adolescents and young adults. More than 90% of synovial sarcomas have been shown to exhibit a characteristic chromosomal translocation, t(X;18)(p11;q11), which results in the fusion of SYT to the SSX1, SSX2, or SSX4 gene (3, 4, 5, 11, 12). An Ab generation strategy has confirmed constitutive production of SYT-SSX fusion proteins and their intracellular localization in synovial sarcoma cells (15, 16), implying that the junctional portion of the fusion protein can be processed in the cytosol and assembled into an HLA-peptide complex, even though the fusion proteins eventually localize in the nucleus. These features support the validity of using synovial sarcoma as a prototype of soft tissue sarcomas with chromosomal translocation in the analysis of the immunological significance of chimeric gene sequences.

In the present study, we investigated the antigenic properties of SYT-SSX-derived peptides by assessing their ability 1) to react with circulating CD8+ T cells in HLA-A24+ patients with synovial sarcoma or other malignant tumors and healthy individuals using fluorescent HLA-A24/SYT-SSX peptide tetramers and 2) to elicit SYT-SSX sequence-specific antitumor CTLs. Substantial in vivo and in vitro T cell responses against SYT-SSX junctional peptides shown upon these analyses provided the basis for development of Ag-specific immunotherapy for soft tissue sarcomas with proved chromosomal translocation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines and transfectants

Cell lines used were synovial sarcoma cell lines (Fuji, HS-SY-II, and SW982), a erythroleukemia cell line (K562), a lymphoblastoid cell line transfected with HLA-A*2402 (C1R-A*2402) and HLA-A*31012 (C1R-A*31012), and a mouse lymphoma cell line transfected with a chimera gene, A*2402/Kb (RMA-S-A*2402/Kb). Fuji cells (17) were obtained from Dr. T. Nojima (Kanazawa Medical University, Kanazawa, Japan), HS-SY-II cells (18) were from Dr. H. Sonobe (Kochi Medical College, Kochi, Japan), C1R-A*2402 cells (19) and C1R-A*31012 cells (19) were from Dr. M. Takiguchi (Kumamoto University School of Medicine, Kumamoto, Japan), and RMA-S-A*2402/Kb cells (20) were from H. Takasu (Research Institution of Sumitomo Pharmaceuticals, Osaka, Japan). SW982 cells and K562 cells were purchased from American Type Culture Collection (Manassas, VA). Cells were cultured in either RPMI 1640 (Fuji, SW982, C1R-A*2402, and C1R-A*31012) or DMEM (HS-SY-II) medium supplemented with 2 mM L-glutamine, 10% FCS, 100 U/ml penicillin G, and 100 µg/ml streptomycin and were maintained at 37°C in a humidified 5% CO2 atmosphere. Hygromycin (0.5 mg/ml) was continuously added in the culture medium for C1R-A*2402 cells and C1R-A*31012 cells.

SW982 cells were transfected with the expression vector pIRES-puro (Clontech Laboratories, Palo Alto, CA) encoding the cDNA for HLA-A24 using lipofectin reagent (Life Technologies, Rockville, MD). The cDNA for HLA-A24 was cloned from the RNA extracts of the LHK-2 lung adenocarcinoma cell line with ISOGEN reagent according to the manufacturer’s protocol (Nippon Gene, Tokyo, Japan) and was reverse transcribed by using SuperscriptII reverse transcriptase with oligo(dT) primer (Life Technologies). The incubation was conducted at 42°C for 60 min and then at 70°C for 15 min. PCR procedure with Pfu DNA polymerase was performed using the forward primer 5'-GACTCAGATGATATCCAGACGCCGAGGATGGCCGTCATG-3' and the reverse primer 5'-CGCGGATCCGCGGCCGCAGGGAGCACAGGTCAGCGTGGGAA-3', which are specific for the HLA-A24 gene and contain the EcoRV and BamHI restriction sites, respectively. The mixture was denatured at 98°C for 5 min, followed by 30 cycles at 98°C for 15 s, 58°C for 45 s, and 72°C for 4 min. Purified PCR products were cloned into the pIRES-puro vector and the insert was sequenced by the ABI genetic analyzer PRIM 310 using the AmpliCycle sequencing kit (PerkinElmer, Foster City, CA). Stable transfectants were selected in RPMI 1640 medium in the presence of puromycin (1 µM) and designated as SW982-A24.

Peptide synthesis

The entire sequence of SYT-SSX1 (3) and SYT-SSX2 (4) fusion genes was searched to identify regions that contain anchor motif residues required for binding to HLA-A24 class I molecules. Criteria for selection were the presence of tyrosine, phenylalanine, tryptophan, or methionine at the 2nd portion and the presence of isoleucine, phenylalanine, leucine, tryptophan, arginine, or lysine at the 9th or 10th portion (21, 22). Consequently, two regions fulfilled the criteria from which four synthetic peptides were designated (Fig. 1Go). Two peptides designated as SS391 (PYGYDQIMPK) and SS393 (GYDQIMPKK) were derived from the breakpoint, and the remaining two peptides, SS449a (AWTHRLRER) and SS449b (AWTHRLRERK), were from an SSX region. The amino acid sequences at the SYT-SSX junctional region as well as the SSX region used to designate peptides were conserved in SYT-SSX1, SYT-SSX2, and SYT-SSX4 genes (3, 4, 5).



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 1. Design of SYT-SSX-derived peptides. Underlined amino acids indicate HLA-A24 binding motif residues. SS391 and SS393 were derived from the breakpoint of the SYT-SSX gene and SS449a and SS449b from the SSX region. These regions were shared by SYT-SSX1, SYT-SSX2, and SYT-SSX4 genes.

 
In addition to SYT-SSX-derived peptides, three peptides with an HLA-A24-binding motif were synthesized for reference: TYGPVFMSL (termed EBV), derived from EB virus latent membrane protein 2 (23); AYIDNYNKF (termed NA24), a naturally processed HLA-A24-bound peptide (22); and QFQSIYAKFF (termed R49.2), derived from Recoverin, a causative Ag of cancer-associated retinopathy (24). Also, an HLA-B31-restricted CTL epitope of gastric cancer, YSWMDISCWI (termed F4.2), was used (25). None of SYT-SSX1, SYT-SSX2, or SYT-SSX4 genes has amino acid sequences corresponding to these four peptides.

Peptide-binding assay

The peptide-binding assay was performed as described by Nakao et al. (20). RMA-S-A*2402/Kb cells were incubated at 26°C for 18 h. After washing with PBS, the cells (2 x 105) were suspended with OPTI-MEM (Life Technologies), 3 µg/ml human {beta}2-microgloblin, and 100 µg/ml of peptides. Then the cells were incubated at 26°C for 3 h and at 37°C for 3 h. After washing with PBS, the cells were incubated with an anti-HLA-A24 mAb, C7709A2.6 (a kind gift from Dr. P. G. Coulie, Université Catholique de Louvain, Brussels, Belgium) (26), at 4°C for 30 min and then with PE-conjugated goat anti-mouse IgG Ab (Cappel, Aurora, OH) at 4°C for 30 min. After washing, the cells were suspended with 1 ml of PBS containing 1% formaldehyde and were analyzed with FACScan (BD Biosciences, Mountain View, CA) using the EXPO32 program (EPICS; Beckman Coulter, Fullerton, CA). Binding activity was evaluated by the mean fluorescence intensity (MFI)3 of the HLA-A*2402 molecule of the RMA-S-A*2402/Kb cells that were pulsed with a peptide (100 µM).

Participants

This study was approved by the ethical committees of the individual participating institutions. Peripheral blood samples were collected from patients with synovial sarcoma, patients with other soft tissue malignant tumors, and normal donors after they had given informed consent. Mononuclear cells isolated from blood samples using Ficoll-Conray density gradient centrifugation were screened for the expression of HLA-A24 by RT-PCR as described above, and those defined as HLA-24-positive were subjected to the analysis. There were 16 patients with synovial sarcoma, 5 with osteosarcoma, 3 with malignant fibrous histiocytoma (MFH), 1 with Ewing’s sarcoma, 1 with liposarcoma, and 10 normal donors. Diagnosis of the tumors was made histologically. Of 16 synovial sarcomas, 10 tumors were confirmed for the presence of SYT-SSX mRNA by RT-PCR.

Tetramer construction and FACS analysis

HLA-A24/peptide tetramers were constructed according the procedure described by Altman et al. (27). To improve translation efficiency, we developed a soluble form of mutated HLA-A24 heavy chain by PCR. HLA-A24 cDNA from LHK-2 cells was used as a template of soluble HLA class I heavy chain. Forward primer was designated as 5'-CATACCATGGGCAGCCATTCTATGCGCTATTTTTCTACCTCCGT-3'. This contains an NcoI site (CATACC) followed by the start codon (ATG) at the 5' terminus. Oligonucleotide from the 10th base represents the nucleotide sequence of HLA-A24 (73–107 from the N terminus), in which mammalian codon usage was exchanged for that of Escherichia coli: TCC, CAC, TCC, AGG, TTC, and ACA to AGC, CAT, TCT, CGC, TTT, TCT, and ACC, respectively. Reverse primer was designated as 5'-TAAAGCGGCCGC1GGAACCACGCGGAAC CAGACGATGATTCCACACCATTTTCTGTGCATCCAGAATATGATGCAGGGATCC2TGGCTCCCATCTCAGGGTGAGGGGCTTGGGCAGACCCTC-3'. Underlines 1 and 2 encode NotI and BamHI restricted sites, respectively. Oligonucleotide from the 13th to 30th bases represents the thrombin recognition site. The bold character region encodes BirA substrate peptide that is specifically recognized by biotin-protein ligase. The last oligonucleotide sequence represents the 900-862 nucleotide sequence of HLA-A24, thus deleting the transmembrane domain.

PCR amplifications were performed according to a LA-Taq polymerase system (Takara, Tokyo, Japan) in the following conditions: starting at 95°C for 1 min for denaturation, followed by 30 cycles at 95°C for 45 s, at 40°C for 1.5 min, at 68°C for 1 min, and then at 72°C for 10 min. The amplified DNAs were gel purified, digested with NcoI/NotI, and ligated into pET21d (Novagen, Madison, WI) that had been digested with the corresponding enzymes. HLA-A24 constructs in pET21d were transformed into the BL21 (DE3) strain of E. coli. Recombinant human {beta}2-microgloblin was expressed in E. coli (a gift from Sumitomo Pharmaceuticals). After purification, HLA-A24 and human {beta}2-microgloblin were refolded with the synthesized SYT-SSX peptides. The refolded HLA-A24-peptide complexes were biotinylated by incubation for 17 h at room temperature with BirA enzyme (Avidity, Denver, CO). The biotinylated product was purified using fast protein liquid chromatography. Tetrameric HLA-peptide complexes were produced by adding streptavidin-PE (Vector Laboratories, Burlingame, CA) to achieve a 1:4 molar ratio. Four types of tetramers were constructed: HLA-A24/SS391, HLA-A24/SS393, HLA-A24/SS449a+b (the mixture of SS449a and SS449b peptides), and HLA-A24/R49.2.

For flow cytometric analysis, PBMCs were isolated from the blood samples using Ficoll-Conray density gradient centrifugation and then were stained with the appropriate PE-labeled tetramers at 37°C for 20 min and with FITC-conjugated anti-CD8 mAb (BD Biosciences) at 4°C for 30 min. Cells were washed twice with PBS before fixation in 1% formaldehyde. Analysis of stained PBMCs was performed using FACScan (BD Biosciences) and CellQuest software (BD Biosciences). The frequency of CTL precursors was calculated as the number of tetramer-positive cells divided by the number of CD8+ cells.

Statistical analysis

Association between increased frequency of CD8+ T cells to the SYT-SSX peptides and clinical parameters of 16 synovial sarcoma patients was analyzed with respect to age, gender, and the state of primary tumor, pulmonary metastasis, and chemotherapy. Patients were divided into two groups according to the frequency of CD8+ T cells reacting with the MHC/SYT-SSX peptide tetramers, in which those with the T cell frequency of 0.25% or more were referred to the increased group. Association with patients’ ages was statistically analyzed using the Student t test and association with gender and the state of primary tumor, pulmonary metastasis, and chemotherapy was done using Fisher’s probability test. Statistical significance was defined as p < 0.05.

In vitro CTL induction using synthetic peptides

In vitro CTL induction was performed as previously described (24, 25). PBMCs were isolated from HLA-A24+ synovial sarcoma patients using Ficoll-Conray density gradient centrifugation and were cultured in AIM-V medium (Life Technologies). After 24-h incubation, nonadherent cells were transferred to another culture dish and maintained in AIM-V medium (Life Technologies) with 100 U/ml rIL-2 (a gift from Takeda Pharmaceuticals, Osaka, Japan) until the next procedure. To induce APCs, the remaining adherent cells were cultured in AIM-V medium (Life Technologies) with 1000 U/ml IL-4 (Life Technologies) and 1000 U/ml GM-CSF (a gift from Novartis Pharmaceuticals, Basel, Switzerland) for 5 days, and then 10-µM peptides (the mixture of SS391 and SS393 or that of SS449a and SS449b) were pulsed for 1 day. On the next day, 10 ng/ml TNF-{alpha} (DAKO, Kyoto, Japan) and 1000 U/ml IFN-{alpha} (a gift from Sumitomo Pharmaceuticals) were added to induce maturation of the APCs. Meanwhile, CD8+ T cells were isolated from nonadherent cells using an anti-CD8 mAb coupled to magnetic microbeads (MACS; Miltenyi, Bergisch Gladbach, Germany). On day 7, CD8 + T cells were cocultured with the peptide-pulsed APCs. The remaining CD8- PBMCs, including CD4+ T cells, were cultured in AIM-V with PHA (1 µg/ml) and IL-2 (100 U/ml) for 3 days and without PHA for the next 4 days. On days 14 and 21, the responding CD8 + T cells were restimulated with PHA-activated CD8- PBMCs that had been pulsed with the peptides for 2 h and irradiated with 5000 rad. The cytotoxic activity of the responder cells was evaluated on day 28.

Cytotoxicity assay

The cytotoxic activity of stimulated CD8 + T cells was measured using a conventional 51Cr release assay (24, 25). Cell lines used as targets were Fuji, HS-SY-II, SW982-A24, K562, C1R-A*2402, and C1R-A*31012. The target cells were labeled with 100 µCi of 51Cr for 1 h at 37°C. The peptide-pulsed targets, C1R-A*2402 cells and C1R-A*31012 cells, were prepared by incubating the cells with 10-µM peptides (the mixture of SS391 and SS393, that of SS449a and SS449b, or a control peptide) overnight at 37°C and then labeling with 51Cr. The stimulated CD8 + T cells were mixed with the labeled target cells in the well at a concentration of 5 x 103 cells/well. After a 4-h incubation period at 37°C, the release of the 51Cr label was measured by collecting the supernatant, followed by quantification in an automated gamma counter. The percentage of specific cytotoxicity was calculated as the percentage of specific 51Cr release: [day(experimental 51Cr release - spontaneous 51Cr release)/(maximum 51Cr release - spontaneous 51Cr release) ] x 100.

Detection of SYT-SSX and HLA-A24 mRNAs

Expression of SYT-SSX, SSX, and HLA-A*2402 mRNAs in cell lines was determined using RT-PCR. Briefly, total RNA was isolated from 1 x 107 cells with ISOGEN. The first-strand cDNAs were synthesized with 1 µg of total RNA by using the Superscript Preamplification System (Life Technologies). Target cDNAs were amplified by PCR with KOD Dash polymerase (Toyobo, Osaka, Japan) and gene-specific primer pairs for SYT-SSX (forward primer, 5'-CAACAGCAAGATGCATACCA-3'; reverse primer, 5'-CACTTGCTATGCACCTGATG-3'), SSX1 (forward primer, 5'-CTAAAGCATCAGAGAAGAGAAGC-3'; reverse primer, 5'-AGATCTCTTATTAATCTTCTCAGAAA-3'), SSX2 (forward primer, 5'-GTGCTCAAATACCAGAGAAGATC-3'; reverse primer, 5'-TTTTGGGTCCAGATCTCTCGTG-3'), and HLA-A24 (forward primer, 5'-GGCCGGAGTATTGGGACGA-3'; reverse primer, 5'-CCAAGAGCGCAGGTCCTCT-3'). The conditions for PCR amplification were as follows: 3 min at 94°C, 30 cycles of 30 s at 94°C, 5 s at 55°C, and 1 min at 72°C, followed by an extension for 5 min at 72°C. Reaction products were analyzed by electrophoresis in 1.0% agarose gels with ethidium bromide.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of synthetic peptides from SYT-SSX fusion genes

To investigate the immunogenic property of peptides derived from the synovial sarcoma-specific SYT-SSX fusion gene, we searched the entire sequence of SYT-SSX1 and SYT-SSX2 genes for identifying regions that contain anchor motif residues required for binding to HLA-A24 class I molecules. Consequently, we defined two regions, from which four peptides were synthesized (Fig. 1Go). Two peptides designated as SS391 and SS393 were derived from the breakpoint, and the remaining two peptides, SS449a and SS449b, were from the SSX region. The amino acid sequences at the SYT-SSX junctional region as well as the SSX region used to designate peptides were conserved in SYT-SSX1, SYT-SSX2, and SYT-SSX4 genes (3, 4, 5).

Binding activity of SYT-SSX peptides to the HLA-A*2402 molecule

We first evaluated the binding activity of these SYT-SSX-derived peptides to HLA-A*2402 molecules. In this assay, MFI of HLA-A*2402 molecules on RMA-S-A*2402/Kb cells after peptide pulsation, which reflected the property of peptides to stabilize HLA-A*2402 molecules on the cell surface, was regarded as the binding activity. As shown in Fig. 2Go, RMA-S-A*2402/Kb cells that had been pulsed with EBV peptide or NA24 peptide (both having an HLA-A24-binding motif) showed substantially high MFI of HLA-A*2402 molecules (1.15 and 1.55, respectively). In contrast, pulsation of F4.2 peptide that has binding activity to HLA-B*31012 but not HLA-A*2402 molecules resulted in MFI of 0.1. Among the SYT-SSX-derived peptides, pulsation of SS393 led to the highest MFI (0.8), whereas the other three peptides showed relatively low MFI (SS391, 0.15; SS449a, 0.2; and SS449b, 0.1).



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 2. Binding activity of SYT-SSX-derived peptides to the HLA-A*2402 molecule. Binding activity of SYT-SSX peptides to HLA-A*2402 molecules was evaluated by the MFI of the HLA-A*2402 molecule of the RMA-S-A*2402/Kb cells that were pulsed with a peptide. Peptides EBV and NA24 were used for positive controls, and F4.2 peptide was used for a negative control.

 
Frequency of SYT-SSX peptide-specific CTL precursors in HLA-A24+ PBMCs

We analyzed the frequency of the CTL precursor (CTLp) specific for these SYT-SSX-derived peptides in PBMCs using MHC/peptide tetramers (HLA-A24/SS391 tetramer, HLA-A24/SS393 tetramer, and HLA-A24/SS449a+b tetramer). To determine the baseline level of CTLp frequency, we analyzed PBMCs of 10 patients with osteosarcoma, MFH, Ewing’s sarcoma, and liposarcoma (Table IGo). The average number and SD of the frequency of CTLps for SS391, SS393, and SS449a+b in these patients were 0.11 ± 0.09. Accordingly, the frequency of 0.25% or higher was determined as significantly high (Fig. 3Go). Such high CTLp frequency of CTLp was observed for SS391 and SS393 peptides in a patient with Ewing’s sarcoma, whereas none of these 10 sarcoma patients showed CTLp frequency of 0.25% or higher for SS449a+b peptides.


View this table:
[in this window]
[in a new window]
 
Table I. CTLp frequency for SYT-SSX peptide in HLA-A24+ PBMCs of sarcoma patients

 


View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 3. Average frequency of CTLps reacting with SYT-SSX-derived peptides. The frequency of CTLps was determined as the number of tetramer-positive cells divided by the number of CD8+ cells, and the average frequency and SD were calculated for each group.

 
Subsequently, we analyzed HLA-A24+ PBMCs of 10 healthy donors (Table IIGo) and 16 synovial sarcoma patients (Table IIIGo). As shown in Table IIGo, none of the 10 healthy donors showed high CTLp frequency of 0.25% or higher for SYT-SSX peptides. In contrast, high CTLps for SS393 peptide were detected in 6 of the 16 synovial sarcoma patients (Table IIIGo). Of these six patients, four also showed high CTLp frequency for SS391 peptide and two patients showed high CTLp frequency for SS499a+b peptides. The specificity of CTLp for the SYT-SSX sequence was examined using HLA-A24/Recoverin peptide (R49.2) tetramer. None of the three patients examined (cases 3, 6, and 10) showed high CTLp frequency to the R49.2 peptide (Table IIIGo and Fig. 4Go). Moreover, in vitro peptide stimulation procedures that had been repeated three times further increased the frequency of CTLp. As shown in Fig. 5Go (case 3), CTLp frequency to the SS391 and SS393 peptide tetramers increased from 0.40 to 1.17% and from 0.34 to 1.14%, respectively, after a three-time stimulation with the mixture of SS391 and SS393 peptides. These increases were specific to the peptides used because this procedure did not increase the CTLp frequency to SS449a+b peptide tetramer. Likewise, stimulation with the mixture of SS499a+b peptide increased the CTLp frequency to SS449a+b tetramer from 0.18 to 2.28%, but it did not increase the frequency to the SS391 or SS393 peptide tetramers. Also, there was association between CTLp frequency and successful induction of CTLs. Two patients (cases 1 and 3) from whom CTLs had been inducible had a CTLp frequency of 0.25 or more for SYT-SSX peptides, whereas the remaining two patients (cases 12 and 14) did not show such high CTLp frequency.


View this table:
[in this window]
[in a new window]
 
Table II. CTLp frequency for SYT-SSX peptide in HLA-A24+ PBMCs of healthy donors

 

View this table:
[in this window]
[in a new window]
 
Table III. CTLp frequency for SYT-SSX peptide in HLA-A24+ PBMCs of synovial sarcoma patients

 


View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 4. A case presentation of CTL precursors that react with SYT-SSX-derived peptides. PBMCs from a synovial sarcoma patient (case 3) were stained with HLA-A24/peptide tetramer and FITC-conjugated anti-CD8 mAb. Tetramer staining intensity is shown on the y-axis and anti-CD8 staining is shown on the x-axis. The number in the top right quadrant indicates the percentage of HLA-A24/peptide tetramer-positive cells in CD8+ cells.

 


View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 5. Increased frequency of CTLps after in vitro three-time stimulation with SYT-SSX-derived peptides. PBMCs from a synovial sarcoma patient (case 3) were stimulated three times weekly with the peptide mixture of SS391 + SS393 or with the peptide mixture of SS449a+b. Stimulated T cells were stained with HLA-A24/SYT-SSX peptide tetramers and FITC-conjugated anti-CD8 mAb. Tetramer staining intensity is shown on the y-axis and anti-CD8 staining is shown on the x-axis. The number in the top right quadrant indicates the percentage of HLA-A24/peptide tetramer-positive cells in CD8+ cells.

 
We assessed association between reactivity of CTLp to the SYT-SSX peptides and the clinical features of synovial sarcoma patients. Notably, all of the six patients showing high CTLp frequency to the SYT-SSX peptides had either a present or past history of pulmonary metastasis. There were three patients (cases 4, 5, and 9) who had a history of pulmonary metastasis but did not show high CTLp frequency. Of these three patients, two had undergone chemotherapy and one was receiving chemotherapy at the time the blood sample was taken. High CTLp frequency for SYT-SSX peptides was detected in all of the three patients with untreated pulmonary metastasis (cases 1, 2, and 3). Statistical analysis revealed the significant association of the increased CTLp frequency to the SYT-SSX peptides with development of pulmonary metastasis (p < 0.03), but not with age, gender, the state of primary tumor, or chemotherapy.

Induction of CTLs from HLA-A24+ synovial sarcoma patients

To determine whether HLA-A24-restricted SYT-SSX-specific CTLs can be induced by these synthetic peptides, we conducted CTL assays using peripheral blood from four HLA-A24+ synovial sarcoma patients (cases 1, 3, 12, and 14 in Table IIIGo). We pulsed APCs derived from PBMCs of these patients with the peptide mixture of SS391 + SS393 or SS449a+b and subsequently mixed them with T cells. Such T cell stimulation was done three times every week. Cytotoxicity assays were then conducted against target C1R-A*2402 cells pulsed with those peptides and an irrelevant control peptide, NA24. CTLs were successfully induced from PBMCs of two synovial sarcoma patients (cases 1 and 3). As shown in Fig. 6GoA (case 3), CTLs induced with the SS391 + SS393 peptide mixture lysed C1R-A*2402 cells that had been pulsed with SS391 or SS393 but not with those with a control NA24 peptide or K562 cells. In contrast, cytotoxicity was no longer elicited against C1R-A*31012 cells, despite stimulation and pulsation with SS391 and SS393 peptides. Similarly, CTLs induced with SS449a+b mixture showed cytotoxicity to C1R-A*2402 cells that had been pulsed with SS449a or SS449b (Fig. 6GoB). In the other patient (case 1), CTLs induced with the SS391 + SS393 peptide mixture lysed C1R-A*2402 cells with peptide specificity (Fig. 7Go), whereas stimulation with the SS499a+b peptide mixture failed to elicit such peptide-specific cytotoxicity.



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 6. Peptide-specific and MHC-restricted CTLs induced from a synovial sarcoma patient (case 3) upon stimulation with SYT-SSX-derived peptides. CTLs were induced from PBMCs of a synovial sarcoma patient (case 3) using the peptide mixture of SS391 + SS393 (A) and the mixture of SS449a+SS449b (B). Cytotoxicity assays were conducted against targets C1R-A*2402 or CIR-A*31012, which had been pulsed with corresponding peptides or NA24 control peptide. K562 cells that lack class I molecules were also used as a control.

 


View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 7. Peptide-specific CTLs induced from another synovial sarcoma patient (case 1). CTLs were induced from PBMCs of a synovial sarcoma patient (case 1) using the peptide mixture of SS391 + SS393. Cytotoxicity assays were conducted against target C1R-A*2402, which had been pulsed with corresponding peptides or NA24 control peptide.

 
We next conducted CTL assays against synovial sarcoma cell lines. Before CTL assays, we determined the expression profiles of HLA-A24, SYT-SSX, and SSX genes (Table IVGo). RT-PCR yielded the amplified products of HLA-A24 mRNA from Fuji, HS-SY-II, SW982-A24, and C1R-A*2402 cells and SYT-SSX mRNA from Fuji and HS-SY-II cells, as previously shown in the original papers (17, 18). SSX mRNA was detected in SW982-A24 cells. As shown in Fig. 8GoA, CTLs induced from a synovial sarcoma patient (case 3) with the peptide mixture of SS391 + SS393 lysed synovial sarcoma cell lines, Fuji, and HS-SY-II. On the contrary, no such cytotoxic activity was observed against K562 cells or SW982-A24 synovial sarcoma cells that lacked SYT-SSX. CTLs induced with SS499a+b mixture lysed SW982-A24 cells (Fig. 8GoB). Although Fuji cells and HS-SY-II cells were confirmed to express SSX mRNA at levels similar to those of SW982-A24 cells (data not shown), no apparent cytotoxicity was observed against these cells. Likewise, CTLs induced from the case 1 synovial sarcoma patient with the peptide mixture of SS391 + SS393 lysed Fuji cells (Fig. 9GoA), whereas those induced with the SS449a+b mixture showed no apparent cytotoxic activity against Fuji cells (Fig. 9GoB).


View this table:
[in this window]
[in a new window]
 
Table IV. Expression of HLA-A24 and SYT-SSX mRNAs in cell lines

 


View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 8. Cytotoxicity of CTLs against synovial sarcoma cell lines (case 3). CTLs were induced from PBMCs of a synovial sarcoma patient (case 3) using the peptide mixture of SS391 + SS393 (A) and the mixture of SS449a+SS449b (B). Cytotoxicity assays were conducted against synovial sarcoma cell lines, Fuji (•) and HS-SY-II ({circ}), which express SYT-SSX gene and SW982-A24 cells ({blacksquare}) that express the SSX gene but not SYT-SSX. K562 cells ({square}) were used as control.

 


View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 9. Cytotoxicity of CTLs against synovial sarcoma cell lines (case 1). CTLs were induced from PBMCs of a synovial sarcoma patient (case 1) using the peptide mixture of SS391 + SS393 (A) and the mixture of SS449a+SS449b (B). Cytotoxicity assays were conducted against Fuji cells (•) and K562 cells ({blacksquare}).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Using synovial sarcoma as a prototype tumor with specific chromosomal translocation and the resultant gene fusion, we generated four synthetic peptides from the SYT-SSX fusion gene according to the HLA-A24 binding motif. We found that one or more of these four peptides reacted in the context of HLA-A24/peptide tetramer with 0.25% or more of circulating CTLps in six (66.7%) of nine synovial sarcoma patients who had either a present or past history of pulmonary metastasis, whereas such high CTLp frequency was detected in none of seven synovial sarcoma patients without metastasis, in 1 of 10 patients with other sarcomas, and in none of the 10 healthy individuals. The specificity of the CTLp to the SYT-SSX sequence was confirmed in three synovial sarcoma patients by using an HLA-A24/Recoverin peptide tetramer. These findings suggest that aberrantly expressed SYT-SSX gene products have primed SYT-SSX-specific CTLps in vivo and increased their frequency in synovial sarcoma patients, especially during the process of systemic blood-borne metastasis. Previously, the SYT-SSX gene had been detected in peripheral blood in a patient with synovial sarcoma (28) (case 7 in Table IIIGo), who was found to have high CTLp frequency to both SS391 and SS393 peptides, further supporting this assumption.

Four SYT-SSX-derived peptides used in the present study showed distinct property in binding to HLA-A24 molecules, reaction with circulating CTLps, and induction of CTLs. Theoretically, T cells recognize these peptides as Ags, because the junctional region of the SYT-SSX gene is tumor specific and the SSX gene product serves as a cancer-testis Ag (29, 30). Consistent with the relatively high binding activity of the SS393 peptide to HLA-A24 molecules, this peptide most often reacted with CTLp among the peptides and induced CTLs that had specificity for peptide and MHC usage, as defined by experiments using CIR-A*2402 and CIR-A*31012 cells, and showed substantial cytotoxic activity against SYT-SSX+ synovial sarcoma cell lines. In contrast, SS449a and SS449b peptides reacted with CTLp at high frequency (0.25% or more) in only two patients with synovial sarcoma. CTLs induced with the peptide mixture of SS449a+b did not consistently show peptide-specific lysis of CIR-A*2402 cells and failed to lyse SYT-SSX+ synovial sarcoma cell lines. This likely reflects the low binding activity of SS449a and SS449b peptides to HLA-A2402 molecules and the extent of peptide presentation in the context of MHC molecules in cell lines used. Because of the limited availability of PBMCs, we were only able to examine four patients and to induce CTLs from two patients in whom high CTLp frequency to SS391 and SS393 peptides was defined. To exclude the possibility of nonspecific binding of SYT-SSX-derived peptides to T cells, CTL analysis with a larger patient number, CTL clones, or tetramer-sorted cells, as well as tetramer analysis with epitope-specific CTLs or irrelevant CTLs, would be required. The lack of such control cells is a significant limitation in this study. Thus far, cloning and sorting of CTLs have not been successful despite repeated attempts.

Peptide-binding, tetramer, and cytotoxicity analyses consistently supported the superiority of SS393 peptide to other SYT-SSX-derived peptides. In consideration of clinical application, it would be helpful to further improve the efficacy of SS393 peptide in CTL induction. To this end, we are currently examining several SS393 peptide analogs that potentially have higher affinity to HLA-A24 molecules. In our preliminary study, immunization of SS393 peptide in combination with an adjuvant, bacterial-unmethylated CpG DNA (CpG) into HLA-A*2402/Kb transgenic mice led to CTLp frequency of 0.74% to HLA-A24/SS393 tetramer in comparison with mice immunized with CpG alone, showing a frequency of 0.15%. Spleen cells obtained from mice that had been immunized with SS393 and CpG showed peptide-specific cytotoxicity against Jurkat cells expressing HLA-A*2402/Kb (data not shown). No apparent adverse effects such as weight loss or pathological changes in organs were found in the mice immunized with SS393 peptide and CpG. Thus, more efficacious immunization protocols with SS393 peptide analog and adjuvants may be defined using HLA-A*2402/Kb transgenic mice before the clinical study.

In soft tissue sarcomas, several investigators have emphasized the usefulness of translocation gene products as immunotherapeutic targets (31, 32, 33). Recently, Worley et al. (34) have demonstrated the ability of the fusion breakpoint sequences associated with synovial sarcoma, clear cell sarcoma, and desmoplastic small round cell tumor to bind to several class I HLA molecules and induce peptide-specific CTLs from normal donor lymphocytes. In this study, however, in vivo reactivity of T lymphocytes to those sequences has not been defined in patients with the corresponding tumor, which appears to be a prerequisite for subsequent clinical trials.

In conclusion, this is the first report demonstrating the frequency of CD8+ T cells that specifically react with fusion proteins resulting from tumor-specific chromosomal translocation in soft tissue sarcomas. The identification of the SYT-SSX peptides offered the opportunity to design peptide-based immunotherapeutic approaches that might prove to be effective in treating HLA-A24-positive patients with SYT-SSX-positive synovial sarcoma and also provided the basis for the development of target peptides in other soft tissue sarcomas with chromosomal translocation.


    Acknowledgments
 
We thank Drs. T. Nojima, H. Sonobe, M. Takiguchi, H. Takasu, and P. G. Coulie for kind donation of cell lines and hybridoma and M. Kondo for her technical support in generation of tetramers.


    Footnotes
 
1 This work was conducted as a collaboration study organized by the Ministry of Health, Labor and Welfare and was supported by grants-in-aid from the Ministry of Education, Culture, Sports, Science and Technology and the Akiyama Memorial Foundation. Back

2 Address correspondence and reprint requests to Dr. Satoshi Kawaguchi, Department of Orthopedic Surgery, Sapporo Medical University School of Medicine, South 1, West 16, Chuo-ku, Sapporo 060-8543, Japan. E-mail address: kawaguch{at}sapmed.ac.jp Back

3 Abbreviations used in this paper: MFI, mean fluorescence intensity; MFH, malignant fibrous histiocytoma; CTLp, CTL precursor. Back

Received for publication February 25, 2002. Accepted for publication May 17, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Rosenberg, S. A.. 1999. A new era for cancer immunotherapy based on the genes that encode cancer antigens. Immunity 10:281.[Medline]
  2. Nabeta, Y., S. Kawaguchi, Y. Sato, T. Wada, T. Yamashita, N. Sato. 2000. Identification strategy and cataloguing of antigenic cancer epitopes. Mod. Asp. Immunobiol. 1:17.
  3. Clark, J., P. J. Rocques, A. J. Crew, S. Gill, J. Shipley, A. M. Chan, B. A. Gusterson, C. S. Cooper. 1994. Identification of novel genes, SYT and SSX, involved in the t(X;18)(p11.2;q11.2) translocation found in human synovial sarcoma. Nat. Genet. 7:502.[Medline]
  4. Crew, A. J., J. Clark, C. Fisher, S. Gill, R. Grimer, A. Chand, J. Shipley, A. Gusterson, C. S. Cooper. 1995. Fusion of SYT to two genes, SSX1 and SSX2, encoding proteins with homology to the Kruppel-associated box in human synovial sarcoma. EMBO J. 14:2333.[Medline]
  5. Skytting, B., B. Nilsson, B. Brodin, Y. Xie, J. Lunderberg, M. Uhlen, O. Larsson. 1999. A novel fusion gene, SYT-SSX4, in synovial sarcoma. J. Natl. Cancer Inst. 91:974.[Free Full Text]
  6. Delattre, O., J. Zucman, B. Plougastel, C. Desmaze, T. Melot, M. Peter, H. Kovar, I. Joubert, P. de Jong, G. Rouleau. 1992. Gene fusion with an ETS DNA-binding domain caused by chromosome translocation in human tumours. Nature 359:162.[Medline]
  7. Crozat, A., P. Aman, N. Mandahl, D. Ron. 1993. Fusion of CHOP to a novel RNA-binding protein in human myxoid liposarcoma. Nature 363:640.[Medline]
  8. Rabbitts, T. H., A. Forster, R. Larson, P. Nathan. 1993. Fusion of the dominant negative transcription regulator CHOP with a novel gene FUS by translocation t(12;16) in malignant liposarcoma. Nat. Genet. 4:175.[Medline]
  9. Barr, F. G.. 1998. Translocations, cancer and the puzzle of specificity. Nat. Genet. 19:121.[Medline]
  10. Barr, F. G., J. Chatten, C. M. D’Cruz, A. E. Wilson, L. E. Nauta, L. M. Nycum, J. A. Biegel, R. B. Womer. 1995. Molecular assays for chromosomal translocations in the diagnosis of pediatric soft tissue sarcomas. J. Am. Med. Assoc. 273:553.[Abstract]
  11. Hiraga, H., T. Nojima, S. Abe, H. Sawa, K. Yamashiro, S. Yamawaki, K. Kaneda, K. Nagashima. 1998. Diagnosis of synovial sarcoma with the reverse transcriptase-polymerase chain reaction: analyses of 84 soft tissue and bone tumors. Diagn. Mol. Pathol. 7:102.[Medline]
  12. Naito, N., A. Kawai, M. Ouchida, T. Dan’ura, Y. Morimoto, T. Ozaki, K. Shimizu, H. Inoue. 2000. A reverse transcriptase-polymerase chain reaction assay in the diagnosis of soft tissue sarcomas. Cancer 89:1992.[Medline]
  13. de Alava, E., A. Kawai, J. H. Healey, I. Fligman, P. A. Meyers, A. G. Huvos, W. L. Gerald, S. C. Jhanwar, P. Argani, C. R. Antonescu, et al 1998. EWS-FLI1 fusion transcript structure is an independent determinant of prognosis in Ewing’s sarcoma. J. Clin. Oncol. 16:1248.[Abstract/Free Full Text]
  14. Kawai, A., J. Woodruff, J. H. Healey, M. F. Brennan, C. R. Antonescu, M. Ladanyi. 1998. SYT-SSX gene fusion as a determinant of morphology and prognosis in synovial sarcoma. N. Engl. J. Med. 338:153.[Abstract/Free Full Text]
  15. dos Santos, N. R., D. R. de Bruijn, M. Balemans, B. Janssen, F. Gartner, J. M. Lopes, B. de Leeuw, A. Geurts van Kessel. 1997. Nuclear localization of SYT, SSX and the synovial sarcoma-associated SYT-SSX fusion proteins. Hum. Mol. Genet. 6:1549.[Abstract/Free Full Text]
  16. Hashimoto, N., N. Araki, H. Yoshikawa, A. Myoui, A. Matsumine, M. Kaneko, H. Sonobe, T. Ochi. 2000. SYT-SSX fusion proteins in synovial sarcomas: detection and characterization with new antibodies. Cancer Lett. 149:31.[Medline]
  17. Nojima, T., Y.-S. Wang, S. Abe, T. Matsuno, S. Yamawaki, K. Nagashima. 1990. Morphological and cytogenetic studies of a human synovial sarcoma xenotransplanted into nude mice. Acta Pathol. Jpn. 40:486.[Medline]
  18. Sonobe, H., Y. Manabe, M. Furihata, J. Iwata, T. Oka, Y. Ohtsuki, H. Mizobuchi, H. Yamamoto, O. Kumano, S. Abe. 1992. Establishment and characterization of a new human synovial sarcoma cell line, HS-SY II. Lab. Invest. 67:498.[Medline]
  19. Suzuki, K., H. Sahara, Y. Okada, T. Yasoshima, Y. Hirohashi, Y. Nabeta, I. Hirai, T. Torigoe, S. Takahashi, A. Matsuura, et al 1999. Identification of natural antigenic peptides of a human gastric signet ring cell carcinoma recognized by HLA-A31-restricted cytotoxic T lymphocytes. J. Immunol. 163:2783.[Abstract/Free Full Text]
  20. Nakao, M., S. Shichijo, T. Imaizumi, Y. Inoue, K. Matsunaga, A. Yamada, M. Kikuchi, N. Tsuda, K. Ohta, S. Takamori, et al 2000. Identification of a gene coding for a new squamous cell carcinoma antigen recognized by the CTL. J. Immunol. 164:2565.[Abstract/Free Full Text]
  21. Kondo, A., J. Sidney, S. Southwood, M.-F. del Guercio, E. Appella, H. Sakamoto, E. Celis, H. M. Grey, R. W. Chesnut, R. T. Kubo, A. Sette. 1995. Prominent roles of secondary anchor residues in peptide binding to HLA-A24 human class I molecules. J. Immunol. 155:4307.[Abstract]
  22. Kubo, R. T., A. Sette, H. M. Grey, E. Appella, K. Sakaguchi, N. Z. Zhu, D. Arnott, N. Sherman, J. Shabanowitz, H. Michel, et al 1994. Definition of specific peptide motifs for four major HLA-A alleles. J. Immunol. 152:3913.[Abstract]
  23. Lee, S. P., R. J. Tierney, W. A. Thomas, J. M. Brooks, A. B. Rickinson. 1997. Conserved CTL epitope within EBV latent membrane protein 2: a potential target for CTL-based tumor therapy. J. Immunol. 158:3325.[Abstract]
  24. Maeda, A., H. Ohguro, Y. Nabeta, Y. Hirohashi, H. Sahara, T. Maeda, Y. Wada, T. Sato, C. Yun, Y. Nishimura, et al 2001. Identification of human antitumor cytotoxic T lymphocyte epitopes of recoverin, a cancer-associated retinopathy antigen, possibly related with a better prognosis in a paraneoplastic syndrome. Eur. J. Immunol. 31:563.[Medline]
  25. Nabeta, Y., H. Sahara, K. Suzuki, H. Kondo, M. Nagata, Y. Hirohashi, Y. Sato, Y. Wada, T. Sato, T. Wada, et al 2000. Induction of cytotoxic T lymphocytes from peripheral blood of human histocompatibility antigen (HLA)-A31+ gastric cancer patients by in vitro stimulation with antigenic peptide of signet ring cell carcinoma. Jpn. J. Cancer Res. 91:616.[Medline]
  26. Ikeda, H., B. Lethe, F. Lehmann, N. van Baren, J. F. Baurain, C. de Smet, H. Chambost, M. Vitale, A. Moretta, T. Boon, P. G. Coulie. 1997. Characterization of an antigen that is recognized on a melanoma showing partial HLA loss by CTL expressing an NK inhibitory receptor. Immunity 6:199.[Medline]
  27. Altman, J. D., P. A. Moss, P. J. Goulder, D. H. Barouch, M. G. McHeyzer-Williams, J. I. Bell, A. J. McMichael, M. M. Davis. 1996. Phenotypic analysis of antigen-specific T lymphocytes. Science 274:94.[Abstract/Free Full Text]
  28. Hashimoto, N., A. Myoui, N. Araki, T. Asai, H. Sonobe, S. Hirota, H. Yoshikawa. 2001. Detection of SYT-SSX fusion gene in peripheral blood from a patient with synovial sarcoma. Am. J. Surg. Pathol. 25:406.[Medline]
  29. Türeci, O., U. Sahin, I. Schobert, M. Koslowski, H. Schmitt, H. J. Schild, F. Stenner, G. Seitz, H. G. Rammensee, M. Pfreundschuh. 1996. The SSX-2 gene, which is involved in the t(X;18) translocation of synovial sarcomas, codes for the human tumor antigen HOM-MEL-40. Cancer Res. 56:4766.[Abstract/Free Full Text]
  30. Gure, A. O., O. Türeci, U. Sahin, S. Tsang, M. J. Scanlan, E. Jager, A. Knuth, M. Pfreundschuh, L. J. Old, Y. T. Chen. 1997. SSX: a multigene family with several members transcribed in normal testis and human cancer. Int. J. Cancer 72:965.[Medline]
  31. Linehan, D. C., W. B. Bowne, J. J. Lewis. 1999. Immunotherapeutic approaches to sarcoma. Semin. Surg. Oncol. 17:72.[Medline]
  32. Mackall, C., J. Berzofsky, L. J. Helman. 2000. Targeting tumor specific translocations in sarcomas in pediatric patients for immunotherapy. Clin. Orthop. 373:25.
  33. Maki, R. G.. 2001. Soft tissue sarcoma as a model disease to examine cancer immunotherapy. Curr. Opin. Oncol. 13:270.[Medline]
  34. Worley, B. S., L. T. van den Broeke, T. J. Goletz, D. Pendelton, E. M. Daschbach, E. K. Thomas, F. M. Marinola, L. J. Helman, J. A. Berzofsky. 2001. Antigenecity of fusion proteins from sarcoma-associated chromosomal translocations. Cancer Res. 61:6868.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Clin. Pathol.Home page
O. Slater and J. Shipley
Clinical relevance of molecular genetics to paediatric sarcomas
J. Clin. Pathol., November 1, 2007; 60(11): 1187 - 1194.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Ishibe, T. Nakayama, T. Okamoto, T. Aoyama, K. Nishijo, K. R. Shibata, Y. Shima, S. Nagayama, T. Katagiri, Y. Nakamura, et al.
Disruption of Fibroblast Growth Factor Signal Pathway Inhibits the Growth of Synovial Sarcomas: Potential Application of Signal Inhibitors to Molecular Target Therapy
Clin. Cancer Res., April 1, 2005; 11(7): 2702 - 2712.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Idenoue, Y. Hirohashi, T. Torigoe, Y. Sato, Y. Tamura, H. Hariu, M. Yamamoto, T. Kurotaki, T. Tsuruma, H. Asanuma, et al.
A Potent Immunogenic General Cancer Vaccine That Targets Survivin, an Inhibitor of Apoptosis Proteins
Clin. Cancer Res., February 15, 2005; 11(4): 1474 - 1482.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Hariu, Y. Hirohashi, T. Torigoe, H. Asanuma, M. Hariu, Y. Tamura, K. Aketa, C. Nabeta, K. Nakanishi, K. Kamiguchi, et al.
Aberrant Expression and Potency as a Cancer Immunotherapy Target of Inhibitor of Apoptosis Protein Family, Livin/ML-IAP in Lung Cancer
Clin. Cancer Res., February 1, 2005; 11(3): 1000 - 1009.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Tsukahara, Y. Nabeta, S. Kawaguchi, H. Ikeda, Y. Sato, K. Shimozawa, K. Ida, H. Asanuma, Y. Hirohashi, T. Torigoe, et al.
Identification of Human Autologous Cytotoxic T-Lymphocyte-Defined Osteosarcoma Gene That Encodes a Transcriptional Regulator, Papillomavirus Binding Factor
Cancer Res., August 1, 2004; 64(15): 5442 - 5448.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Ida, S. Kawaguchi, Y. Sato, T. Tsukahara, Y. Nabeta, H. Sahara, H. Ikeda, T. Torigoe, S. Ichimiya, K. Kamiguchi, et al.
Crisscross CTL Induction by SYT-SSX Junction Peptide and Its HLA-A*2402 Anchor Substitute
J. Immunol., July 15, 2004; 173(2): 1436 - 1443.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sato, Y.
Right arrow Articles by Sato, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sato, Y.
Right arrow Articles by Sato, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS