| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Departments of
* Orthopedic Surgery and
Pathology, Sapporo Medical University School of Medicine, and
Department of Clinical Research, Division of Orthopedics, National Sapporo Hospital, Sapporo, Japan;
Department of Orthopedic Surgery, Okayama University Medical School, Okayama, Japan;
¶ Department of Orthopedic Surgery, Chiba Cancer Center Hospital, Chiba, Japan;
|| Department of Orthopedic Surgery, Osaka Medical Center for Cancer and Cardiovascular Diseases, and
# Department of Orthopedics, Osaka University Graduate School of Medicine, Osaka, Japan; and
** Department of Orthopedic Surgery, Cancer Institute Hospital, and
Department of Orthopedic Surgery, National Cancer Center Hospital, Tokyo, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Synovial sarcoma accounts for 5–10% of all soft tissue sarcomas and occurs mainly in adolescents and young adults. More than 90% of synovial sarcomas have been shown to exhibit a characteristic chromosomal translocation, t(X;18)(p11;q11), which results in the fusion of SYT to the SSX1, SSX2, or SSX4 gene (3, 4, 5, 11, 12). An Ab generation strategy has confirmed constitutive production of SYT-SSX fusion proteins and their intracellular localization in synovial sarcoma cells (15, 16), implying that the junctional portion of the fusion protein can be processed in the cytosol and assembled into an HLA-peptide complex, even though the fusion proteins eventually localize in the nucleus. These features support the validity of using synovial sarcoma as a prototype of soft tissue sarcomas with chromosomal translocation in the analysis of the immunological significance of chimeric gene sequences.
In the present study, we investigated the antigenic properties of SYT-SSX-derived peptides by assessing their ability 1) to react with circulating CD8+ T cells in HLA-A24+ patients with synovial sarcoma or other malignant tumors and healthy individuals using fluorescent HLA-A24/SYT-SSX peptide tetramers and 2) to elicit SYT-SSX sequence-specific antitumor CTLs. Substantial in vivo and in vitro T cell responses against SYT-SSX junctional peptides shown upon these analyses provided the basis for development of Ag-specific immunotherapy for soft tissue sarcomas with proved chromosomal translocation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cell lines used were synovial sarcoma cell lines (Fuji, HS-SY-II, and SW982), a erythroleukemia cell line (K562), a lymphoblastoid cell line transfected with HLA-A*2402 (C1R-A*2402) and HLA-A*31012 (C1R-A*31012), and a mouse lymphoma cell line transfected with a chimera gene, A*2402/Kb (RMA-S-A*2402/Kb). Fuji cells (17) were obtained from Dr. T. Nojima (Kanazawa Medical University, Kanazawa, Japan), HS-SY-II cells (18) were from Dr. H. Sonobe (Kochi Medical College, Kochi, Japan), C1R-A*2402 cells (19) and C1R-A*31012 cells (19) were from Dr. M. Takiguchi (Kumamoto University School of Medicine, Kumamoto, Japan), and RMA-S-A*2402/Kb cells (20) were from H. Takasu (Research Institution of Sumitomo Pharmaceuticals, Osaka, Japan). SW982 cells and K562 cells were purchased from American Type Culture Collection (Manassas, VA). Cells were cultured in either RPMI 1640 (Fuji, SW982, C1R-A*2402, and C1R-A*31012) or DMEM (HS-SY-II) medium supplemented with 2 mM L-glutamine, 10% FCS, 100 U/ml penicillin G, and 100 µg/ml streptomycin and were maintained at 37°C in a humidified 5% CO2 atmosphere. Hygromycin (0.5 mg/ml) was continuously added in the culture medium for C1R-A*2402 cells and C1R-A*31012 cells.
SW982 cells were transfected with the expression vector pIRES-puro (Clontech Laboratories, Palo Alto, CA) encoding the cDNA for HLA-A24 using lipofectin reagent (Life Technologies, Rockville, MD). The cDNA for HLA-A24 was cloned from the RNA extracts of the LHK-2 lung adenocarcinoma cell line with ISOGEN reagent according to the manufacturer’s protocol (Nippon Gene, Tokyo, Japan) and was reverse transcribed by using SuperscriptII reverse transcriptase with oligo(dT) primer (Life Technologies). The incubation was conducted at 42°C for 60 min and then at 70°C for 15 min. PCR procedure with Pfu DNA polymerase was performed using the forward primer 5'-GACTCAGATGATATCCAGACGCCGAGGATGGCCGTCATG-3' and the reverse primer 5'-CGCGGATCCGCGGCCGCAGGGAGCACAGGTCAGCGTGGGAA-3', which are specific for the HLA-A24 gene and contain the EcoRV and BamHI restriction sites, respectively. The mixture was denatured at 98°C for 5 min, followed by 30 cycles at 98°C for 15 s, 58°C for 45 s, and 72°C for 4 min. Purified PCR products were cloned into the pIRES-puro vector and the insert was sequenced by the ABI genetic analyzer PRIM 310 using the AmpliCycle sequencing kit (PerkinElmer, Foster City, CA). Stable transfectants were selected in RPMI 1640 medium in the presence of puromycin (1 µM) and designated as SW982-A24.
Peptide synthesis
The entire sequence of SYT-SSX1 (3) and SYT-SSX2
(4) fusion genes was searched to identify regions that
contain anchor motif residues required for binding to HLA-A24 class I
molecules. Criteria for selection were the presence of tyrosine,
phenylalanine, tryptophan, or methionine at the 2nd portion and the
presence of isoleucine, phenylalanine, leucine, tryptophan, arginine,
or lysine at the 9th or 10th portion (21, 22).
Consequently, two regions fulfilled the criteria from which four
synthetic peptides were designated (Fig. 1
). Two peptides designated as SS391
(PYGYDQIMPK) and SS393 (GYDQIMPKK) were derived from the
breakpoint, and the remaining two peptides, SS449a (AWTHRLRER) and
SS449b (AWTHRLRERK), were from an SSX region. The amino acid
sequences at the SYT-SSX junctional region as well as the SSX region
used to designate peptides were conserved in SYT-SSX1, SYT-SSX2, and
SYT-SSX4 genes (3, 4, 5).
|
Peptide-binding assay
The peptide-binding assay was performed as described by
Nakao et al. (20).
RMA-S-A*2402/Kb cells were incubated at 26°C
for 18 h. After washing with PBS, the cells (2 x
105) were suspended with OPTI-MEM (Life
Technologies), 3 µg/ml human 
2-microgloblin,
and 100 µg/ml of peptides. Then the cells were incubated at 26°C
for 3 h and at 37°C for 3 h. After washing with PBS, the
cells were incubated with an anti-HLA-A24 mAb, C7709A2.6 (a kind
gift from Dr. P. G. Coulie, Université Catholique de
Louvain, Brussels, Belgium) (26), at 4°C for 30 min and
then with PE-conjugated goat anti-mouse IgG Ab (Cappel, Aurora, OH)
at 4°C for 30 min. After washing, the cells were suspended with 1 ml
of PBS containing 1% formaldehyde and were analyzed with FACScan (BD
Biosciences, Mountain View, CA) using the EXPO32 program (EPICS;
Beckman Coulter, Fullerton, CA). Binding activity was evaluated by the
mean fluorescence intensity
(MFI)3 of the
HLA-A*2402 molecule of the RMA-S-A*2402/Kb cells
that were pulsed with a peptide (100 µM).
Participants
This study was approved by the ethical committees of the individual participating institutions. Peripheral blood samples were collected from patients with synovial sarcoma, patients with other soft tissue malignant tumors, and normal donors after they had given informed consent. Mononuclear cells isolated from blood samples using Ficoll-Conray density gradient centrifugation were screened for the expression of HLA-A24 by RT-PCR as described above, and those defined as HLA-24-positive were subjected to the analysis. There were 16 patients with synovial sarcoma, 5 with osteosarcoma, 3 with malignant fibrous histiocytoma (MFH), 1 with Ewing’s sarcoma, 1 with liposarcoma, and 10 normal donors. Diagnosis of the tumors was made histologically. Of 16 synovial sarcomas, 10 tumors were confirmed for the presence of SYT-SSX mRNA by RT-PCR.
Tetramer construction and FACS analysis
HLA-A24/peptide tetramers were constructed according the procedure described by Altman et al. (27). To improve translation efficiency, we developed a soluble form of mutated HLA-A24 heavy chain by PCR. HLA-A24 cDNA from LHK-2 cells was used as a template of soluble HLA class I heavy chain. Forward primer was designated as 5'-CATACCATGGGCAGCCATTCTATGCGCTATTTTTCTACCTCCGT-3'. This contains an NcoI site (CATACC) followed by the start codon (ATG) at the 5' terminus. Oligonucleotide from the 10th base represents the nucleotide sequence of HLA-A24 (73–107 from the N terminus), in which mammalian codon usage was exchanged for that of Escherichia coli: TCC, CAC, TCC, AGG, TTC, and ACA to AGC, CAT, TCT, CGC, TTT, TCT, and ACC, respectively. Reverse primer was designated as 5'-TAAAGCGGCCGC1GGAACCACGCGGAAC CAGACGATGATTCCACACCATTTTCTGTGCATCCAGAATATGATGCAGGGATCC2TGGCTCCCATCTCAGGGTGAGGGGCTTGGGCAGACCCTC-3'. Underlines 1 and 2 encode NotI and BamHI restricted sites, respectively. Oligonucleotide from the 13th to 30th bases represents the thrombin recognition site. The bold character region encodes BirA substrate peptide that is specifically recognized by biotin-protein ligase. The last oligonucleotide sequence represents the 900-862 nucleotide sequence of HLA-A24, thus deleting the transmembrane domain.
PCR amplifications were performed according to a LA-Taq polymerase
system (Takara, Tokyo, Japan) in the following conditions: starting at
95°C for 1 min for denaturation, followed by 30 cycles at 95°C for
45 s, at 40°C for 1.5 min, at 68°C for 1 min, and then at
72°C for 10 min. The amplified DNAs were gel purified, digested with
NcoI/NotI, and ligated into pET21d (Novagen,
Madison, WI) that had been digested with the corresponding enzymes.
HLA-A24 constructs in pET21d were transformed into the BL21 (DE3)
strain of E. coli. Recombinant human
2-microgloblin was expressed in E.
coli (a gift from Sumitomo Pharmaceuticals). After purification,
HLA-A24 and human 2-microgloblin were refolded
with the synthesized SYT-SSX peptides. The refolded HLA-A24-peptide
complexes were biotinylated by incubation for 17 h at room
temperature with BirA enzyme (Avidity, Denver, CO). The biotinylated
product was purified using fast protein liquid chromatography.
Tetrameric HLA-peptide complexes were produced by adding
streptavidin-PE (Vector Laboratories, Burlingame, CA) to achieve a 1:4
molar ratio. Four types of tetramers were constructed: HLA-A24/SS391,
HLA-A24/SS393, HLA-A24/SS449a+b (the mixture of SS449a and SS449b
peptides), and HLA-A24/R49.2.
For flow cytometric analysis, PBMCs were isolated from the blood samples using Ficoll-Conray density gradient centrifugation and then were stained with the appropriate PE-labeled tetramers at 37°C for 20 min and with FITC-conjugated anti-CD8 mAb (BD Biosciences) at 4°C for 30 min. Cells were washed twice with PBS before fixation in 1% formaldehyde. Analysis of stained PBMCs was performed using FACScan (BD Biosciences) and CellQuest software (BD Biosciences). The frequency of CTL precursors was calculated as the number of tetramer-positive cells divided by the number of CD8+ cells.
Statistical analysis
Association between increased frequency of CD8+ T cells to the SYT-SSX peptides and clinical parameters of 16 synovial sarcoma patients was analyzed with respect to age, gender, and the state of primary tumor, pulmonary metastasis, and chemotherapy. Patients were divided into two groups according to the frequency of CD8+ T cells reacting with the MHC/SYT-SSX peptide tetramers, in which those with the T cell frequency of 0.25% or more were referred to the increased group. Association with patients’ ages was statistically analyzed using the Student t test and association with gender and the state of primary tumor, pulmonary metastasis, and chemotherapy was done using Fisher’s probability test. Statistical significance was defined as p < 0.05.
In vitro CTL induction using synthetic peptides
In vitro CTL induction was performed as previously described
(24, 25). PBMCs were isolated from
HLA-A24+ synovial sarcoma patients using
Ficoll-Conray density gradient centrifugation and were cultured in
AIM-V medium (Life Technologies). After 24-h incubation, nonadherent
cells were transferred to another culture dish and maintained in AIM-V
medium (Life Technologies) with 100 U/ml rIL-2 (a gift from Takeda
Pharmaceuticals, Osaka, Japan) until the next procedure. To induce
APCs, the remaining adherent cells were cultured in AIM-V medium (Life
Technologies) with 1000 U/ml IL-4 (Life Technologies) and 1000 U/ml
GM-CSF (a gift from Novartis Pharmaceuticals, Basel, Switzerland) for 5
days, and then 10-µM peptides (the mixture of SS391 and SS393 or that
of SS449a and SS449b) were pulsed for 1 day. On the next day, 10 ng/ml
TNF-
(DAKO, Kyoto, Japan) and 1000 U/ml IFN- (a gift from
Sumitomo Pharmaceuticals) were added to induce maturation of the APCs.
Meanwhile, CD8+ T cells were isolated from
nonadherent cells using an anti-CD8 mAb coupled to magnetic
microbeads (MACS; Miltenyi, Bergisch Gladbach, Germany). On day 7, CD8
+ T cells were cocultured with the peptide-pulsed
APCs. The remaining CD8- PBMCs, including
CD4+ T cells, were cultured in AIM-V with PHA (1
µg/ml) and IL-2 (100 U/ml) for 3 days and without PHA for the next 4
days. On days 14 and 21, the responding CD8 + T
cells were restimulated with PHA-activated CD8-
PBMCs that had been pulsed with the peptides for 2 h and
irradiated with 5000 rad. The cytotoxic activity of the responder cells
was evaluated on day 28.
Cytotoxicity assay
The cytotoxic activity of stimulated CD8 + T cells was measured using a conventional 51Cr release assay (24, 25). Cell lines used as targets were Fuji, HS-SY-II, SW982-A24, K562, C1R-A*2402, and C1R-A*31012. The target cells were labeled with 100 µCi of 51Cr for 1 h at 37°C. The peptide-pulsed targets, C1R-A*2402 cells and C1R-A*31012 cells, were prepared by incubating the cells with 10-µM peptides (the mixture of SS391 and SS393, that of SS449a and SS449b, or a control peptide) overnight at 37°C and then labeling with 51Cr. The stimulated CD8 + T cells were mixed with the labeled target cells in the well at a concentration of 5 x 103 cells/well. After a 4-h incubation period at 37°C, the release of the 51Cr label was measured by collecting the supernatant, followed by quantification in an automated gamma counter. The percentage of specific cytotoxicity was calculated as the percentage of specific 51Cr release: [day(experimental 51Cr release - spontaneous 51Cr release)/(maximum 51Cr release - spontaneous 51Cr release) ] x 100.
Detection of SYT-SSX and HLA-A24 mRNAs
Expression of SYT-SSX, SSX, and HLA-A*2402 mRNAs in cell lines was determined using RT-PCR. Briefly, total RNA was isolated from 1 x 107 cells with ISOGEN. The first-strand cDNAs were synthesized with 1 µg of total RNA by using the Superscript Preamplification System (Life Technologies). Target cDNAs were amplified by PCR with KOD Dash polymerase (Toyobo, Osaka, Japan) and gene-specific primer pairs for SYT-SSX (forward primer, 5'-CAACAGCAAGATGCATACCA-3'; reverse primer, 5'-CACTTGCTATGCACCTGATG-3'), SSX1 (forward primer, 5'-CTAAAGCATCAGAGAAGAGAAGC-3'; reverse primer, 5'-AGATCTCTTATTAATCTTCTCAGAAA-3'), SSX2 (forward primer, 5'-GTGCTCAAATACCAGAGAAGATC-3'; reverse primer, 5'-TTTTGGGTCCAGATCTCTCGTG-3'), and HLA-A24 (forward primer, 5'-GGCCGGAGTATTGGGACGA-3'; reverse primer, 5'-CCAAGAGCGCAGGTCCTCT-3'). The conditions for PCR amplification were as follows: 3 min at 94°C, 30 cycles of 30 s at 94°C, 5 s at 55°C, and 1 min at 72°C, followed by an extension for 5 min at 72°C. Reaction products were analyzed by electrophoresis in 1.0% agarose gels with ethidium bromide.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To investigate the immunogenic property of peptides derived from
the synovial sarcoma-specific SYT-SSX fusion gene, we searched the
entire sequence of SYT-SSX1 and SYT-SSX2 genes for identifying regions
that contain anchor motif residues required for binding to HLA-A24
class I molecules. Consequently, we defined two regions, from which
four peptides were synthesized (Fig. 1
). Two peptides designated as
SS391 and SS393 were derived from the breakpoint, and the remaining two
peptides, SS449a and SS449b, were from the SSX region. The amino acid
sequences at the SYT-SSX junctional region as well as the SSX region
used to designate peptides were conserved in SYT-SSX1, SYT-SSX2, and
SYT-SSX4 genes (3, 4, 5).
Binding activity of SYT-SSX peptides to the HLA-A*2402 molecule
We first evaluated the binding activity of these SYT-SSX-derived
peptides to HLA-A*2402 molecules. In this assay, MFI of HLA-A*2402
molecules on RMA-S-A*2402/Kb cells after peptide
pulsation, which reflected the property of peptides to stabilize
HLA-A*2402 molecules on the cell surface, was regarded as the binding
activity. As shown in Fig. 2, RMA-S-A*2402/Kb cells that had been pulsed with
EBV peptide or NA24 peptide (both having an HLA-A24-binding motif)
showed substantially high MFI of HLA-A*2402 molecules (1.15 and 1.55,
respectively). In contrast, pulsation of F4.2 peptide that has binding
activity to HLA-B*31012 but not HLA-A*2402 molecules resulted in MFI of
0.1. Among the SYT-SSX-derived peptides, pulsation of SS393 led to the
highest MFI (0.8), whereas the other three peptides showed relatively
low MFI (SS391, 0.15; SS449a, 0.2; and SS449b, 0.1).
|
We analyzed the frequency of the CTL precursor (CTLp) specific for
these SYT-SSX-derived peptides in PBMCs using MHC/peptide tetramers
(HLA-A24/SS391 tetramer, HLA-A24/SS393 tetramer, and HLA-A24/SS449a+b
tetramer). To determine the baseline level of CTLp frequency, we
analyzed PBMCs of 10 patients with osteosarcoma, MFH, Ewing’s sarcoma,
and liposarcoma (Table I). The average
number and SD of the frequency of CTLps for SS391, SS393, and
SS449a+b in these patients were 0.11 ± 0.09. Accordingly, the
frequency of 0.25% or higher was determined as significantly high
(Fig. 3). Such high CTLp frequency of
CTLp was observed for SS391 and SS393 peptides in a patient with
Ewing’s sarcoma, whereas none of these 10 sarcoma patients showed CTLp
frequency of 0.25% or higher for SS449a+b peptides.
|
|
) and 16 synovial sarcoma patients (Table III). As
shown in Table II, none of the 10 healthy
donors showed high CTLp frequency of 0.25% or higher for
SYT-SSX peptides. In contrast, high CTLps for SS393 peptide were
detected in 6 of the 16 synovial sarcoma patients (Table III). Of these
six patients, four also showed high CTLp frequency for SS391 peptide
and two patients showed high CTLp frequency for SS499a+b peptides. The
specificity of CTLp for the SYT-SSX sequence was examined using
HLA-A24/Recoverin peptide (R49.2) tetramer. None of the three patients
examined (cases 3, 6, and 10) showed high CTLp frequency to the R49.2
peptide (Table III and Fig. 4). Moreover,
in vitro peptide stimulation procedures that had been repeated three
times further increased the frequency of CTLp. As shown in Fig. 5 (case 3), CTLp frequency to the SS391
and SS393 peptide tetramers increased from 0.40 to 1.17% and from 0.34
to 1.14%, respectively, after a three-time stimulation with the
mixture of SS391 and SS393 peptides. These increases were specific to
the peptides used because this procedure did not increase the CTLp
frequency to SS449a+b peptide tetramer. Likewise, stimulation with the
mixture of SS499a+b peptide increased the CTLp frequency to SS449a+b
tetramer from 0.18 to 2.28%, but it did not increase the frequency to
the SS391 or SS393 peptide tetramers. Also, there was association
between CTLp frequency and successful induction of CTLs. Two patients
(cases 1 and 3) from whom CTLs had been inducible had a CTLp frequency
of 0.25 or more for SYT-SSX peptides, whereas the remaining two
patients (cases 12 and 14) did not show such high CTLp frequency.
|
|
|
|
Induction of CTLs from HLA-A24+ synovial sarcoma patients
To determine whether HLA-A24-restricted SYT-SSX-specific CTLs can
be induced by these synthetic peptides, we conducted CTL assays using
peripheral blood from four HLA-A24+ synovial
sarcoma patients (cases 1, 3, 12, and 14 in Table III). We pulsed APCs
derived from PBMCs of these patients with the peptide mixture of SS391
+ SS393 or SS449a+b and subsequently mixed them with T cells. Such T
cell stimulation was done three times every week. Cytotoxicity assays
were then conducted against target C1R-A*2402 cells pulsed
with those peptides and an irrelevant control peptide, NA24. CTLs were
successfully induced from PBMCs of two synovial sarcoma patients (cases
1 and 3). As shown in Fig. 6A
(case 3), CTLs induced with the SS391 + SS393 peptide mixture lysed
C1R-A*2402 cells that had been pulsed with SS391 or SS393 but not with
those with a control NA24 peptide or K562 cells. In contrast,
cytotoxicity was no longer elicited against C1R-A*31012 cells, despite
stimulation and pulsation with SS391 and SS393 peptides. Similarly,
CTLs induced with SS449a+b mixture showed cytotoxicity to C1R-A*2402
cells that had been pulsed with SS449a or SS449b (Fig. 6B).
In the other patient (case 1), CTLs induced with the SS391 + SS393
peptide mixture lysed C1R-A*2402 cells with peptide specificity (Fig. 7), whereas stimulation with the SS499a+b
peptide mixture failed to elicit such peptide-specific
cytotoxicity.
|
|
). RT-PCR
yielded the amplified products of HLA-A24 mRNA from Fuji,
HS-SY-II, SW982-A24, and C1R-A*2402 cells and SYT-SSX mRNA from Fuji
and HS-SY-II cells, as previously shown in the original papers
(17, 18). SSX mRNA was detected in SW982-A24 cells. As
shown in Fig. 8A, CTLs induced
from a synovial sarcoma patient (case 3) with the peptide mixture of
SS391 + SS393 lysed synovial sarcoma cell lines, Fuji, and HS-SY-II. On
the contrary, no such cytotoxic activity was observed against K562
cells or SW982-A24 synovial sarcoma cells that lacked SYT-SSX. CTLs
induced with SS499a+b mixture lysed SW982-A24 cells (Fig. 8B). Although Fuji cells and HS-SY-II cells were confirmed
to express SSX mRNA at levels similar to those of SW982-A24 cells (data
not shown), no apparent cytotoxicity was observed against these cells.
Likewise, CTLs induced from the case 1 synovial sarcoma patient with
the peptide mixture of SS391 + SS393 lysed Fuji cells (Fig. 9A), whereas those induced
with the SS449a+b mixture showed no apparent cytotoxic activity against
Fuji cells (Fig. 9B).
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
), who was found to have high
CTLp frequency to both SS391 and SS393 peptides, further supporting
this assumption. Four SYT-SSX-derived peptides used in the present study showed distinct property in binding to HLA-A24 molecules, reaction with circulating CTLps, and induction of CTLs. Theoretically, T cells recognize these peptides as Ags, because the junctional region of the SYT-SSX gene is tumor specific and the SSX gene product serves as a cancer-testis Ag (29, 30). Consistent with the relatively high binding activity of the SS393 peptide to HLA-A24 molecules, this peptide most often reacted with CTLp among the peptides and induced CTLs that had specificity for peptide and MHC usage, as defined by experiments using CIR-A*2402 and CIR-A*31012 cells, and showed substantial cytotoxic activity against SYT-SSX+ synovial sarcoma cell lines. In contrast, SS449a and SS449b peptides reacted with CTLp at high frequency (0.25% or more) in only two patients with synovial sarcoma. CTLs induced with the peptide mixture of SS449a+b did not consistently show peptide-specific lysis of CIR-A*2402 cells and failed to lyse SYT-SSX+ synovial sarcoma cell lines. This likely reflects the low binding activity of SS449a and SS449b peptides to HLA-A2402 molecules and the extent of peptide presentation in the context of MHC molecules in cell lines used. Because of the limited availability of PBMCs, we were only able to examine four patients and to induce CTLs from two patients in whom high CTLp frequency to SS391 and SS393 peptides was defined. To exclude the possibility of nonspecific binding of SYT-SSX-derived peptides to T cells, CTL analysis with a larger patient number, CTL clones, or tetramer-sorted cells, as well as tetramer analysis with epitope-specific CTLs or irrelevant CTLs, would be required. The lack of such control cells is a significant limitation in this study. Thus far, cloning and sorting of CTLs have not been successful despite repeated attempts.
Peptide-binding, tetramer, and cytotoxicity analyses consistently supported the superiority of SS393 peptide to other SYT-SSX-derived peptides. In consideration of clinical application, it would be helpful to further improve the efficacy of SS393 peptide in CTL induction. To this end, we are currently examining several SS393 peptide analogs that potentially have higher affinity to HLA-A24 molecules. In our preliminary study, immunization of SS393 peptide in combination with an adjuvant, bacterial-unmethylated CpG DNA (CpG) into HLA-A*2402/Kb transgenic mice led to CTLp frequency of 0.74% to HLA-A24/SS393 tetramer in comparison with mice immunized with CpG alone, showing a frequency of 0.15%. Spleen cells obtained from mice that had been immunized with SS393 and CpG showed peptide-specific cytotoxicity against Jurkat cells expressing HLA-A*2402/Kb (data not shown). No apparent adverse effects such as weight loss or pathological changes in organs were found in the mice immunized with SS393 peptide and CpG. Thus, more efficacious immunization protocols with SS393 peptide analog and adjuvants may be defined using HLA-A*2402/Kb transgenic mice before the clinical study.
In soft tissue sarcomas, several investigators have emphasized the usefulness of translocation gene products as immunotherapeutic targets (31, 32, 33). Recently, Worley et al. (34) have demonstrated the ability of the fusion breakpoint sequences associated with synovial sarcoma, clear cell sarcoma, and desmoplastic small round cell tumor to bind to several class I HLA molecules and induce peptide-specific CTLs from normal donor lymphocytes. In this study, however, in vivo reactivity of T lymphocytes to those sequences has not been defined in patients with the corresponding tumor, which appears to be a prerequisite for subsequent clinical trials.
In conclusion, this is the first report demonstrating the frequency of CD8+ T cells that specifically react with fusion proteins resulting from tumor-specific chromosomal translocation in soft tissue sarcomas. The identification of the SYT-SSX peptides offered the opportunity to design peptide-based immunotherapeutic approaches that might prove to be effective in treating HLA-A24-positive patients with SYT-SSX-positive synovial sarcoma and also provided the basis for the development of target peptides in other soft tissue sarcomas with chromosomal translocation.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Satoshi Kawaguchi, Department of Orthopedic Surgery, Sapporo Medical University School of Medicine, South 1, West 16, Chuo-ku, Sapporo 060-8543, Japan. E-mail address: kawaguch{at}sapmed.ac.jp
3 Abbreviations used in this paper: MFI, mean fluorescence intensity; MFH, malignant fibrous histiocytoma; CTLp, CTL precursor.
Received for publication February 25, 2002. Accepted for publication May 17, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  O. Slater and J. Shipley Clinical relevance of molecular genetics to paediatric sarcomas J. Clin. Pathol., November 1, 2007; 60(11): 1187 - 1194. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Ishibe, T. Nakayama, T. Okamoto, T. Aoyama, K. Nishijo, K. R. Shibata, Y. Shima, S. Nagayama, T. Katagiri, Y. Nakamura, et al. Disruption of Fibroblast Growth Factor Signal Pathway Inhibits the Growth of Synovial Sarcomas: Potential Application of Signal Inhibitors to Molecular Target Therapy Clin. Cancer Res., April 1, 2005; 11(7): 2702 - 2712. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Idenoue, Y. Hirohashi, T. Torigoe, Y. Sato, Y. Tamura, H. Hariu, M. Yamamoto, T. Kurotaki, T. Tsuruma, H. Asanuma, et al. A Potent Immunogenic General Cancer Vaccine That Targets Survivin, an Inhibitor of Apoptosis Proteins Clin. Cancer Res., February 15, 2005; 11(4): 1474 - 1482. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Hariu, Y. Hirohashi, T. Torigoe, H. Asanuma, M. Hariu, Y. Tamura, K. Aketa, C. Nabeta, K. Nakanishi, K. Kamiguchi, et al. Aberrant Expression and Potency as a Cancer Immunotherapy Target of Inhibitor of Apoptosis Protein Family, Livin/ML-IAP in Lung Cancer Clin. Cancer Res., February 1, 2005; 11(3): 1000 - 1009. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Tsukahara, Y. Nabeta, S. Kawaguchi, H. Ikeda, Y. Sato, K. Shimozawa, K. Ida, H. Asanuma, Y. Hirohashi, T. Torigoe, et al. Identification of Human Autologous Cytotoxic T-Lymphocyte-Defined Osteosarcoma Gene That Encodes a Transcriptional Regulator, Papillomavirus Binding Factor Cancer Res., August 1, 2004; 64(15): 5442 - 5448. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Ida, S. Kawaguchi, Y. Sato, T. Tsukahara, Y. Nabeta, H. Sahara, H. Ikeda, T. Torigoe, S. Ichimiya, K. Kamiguchi, et al. Crisscross CTL Induction by SYT-SSX Junction Peptide and Its HLA-A*2402 Anchor Substitute J. Immunol., July 15, 2004; 173(2): 1436 - 1443. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
),
which express SYT-SSX gene and SW982-A24 cells (
) that express the
SSX gene but not SYT-SSX. K562 cells (
) were used as control.