|
|
||||||||
Department of Pathology and Laboratory Medicine, Abramson Family Cancer Research Institute, University of Pennsylvania School of Medicine, Philadelphia, PA 19104
| Abstract |
|---|
|
|
|---|
B activation and up-regulated TNF-
production in osteoclast
precursor cells. Unexpectedly, however, TLR stimulation of osteoclast
precursors by these microbial products strongly inhibited their
differentiation into multinucleated, mature osteoclasts induced by
TNF-related activation-induced cytokine. Rather, TLR stimulation
maintained the phagocytic activity of osteoclast precursors in the
presence of osteoclastogenic stimuli M-CSF and TNF-related
activation-induced cytokine. Taken together, these results suggest that
TLR stimulation of osteoclast precursors inhibits their differentiation
into noninflammatory mature osteoclasts during microbial infection.
This process favors immune responses and may be critical to prevent
pathogenic effects of microbial invasion on
bone. | Introduction |
|---|
|
|
|---|
B ligand, osteoprotegerin ligand,
or osteoclast differentiation factor) and M-CSF are essential to
develop osteoclasts in vivo and in vitro (2 ).
Many microbial constituents are recognized by Toll-like receptors
(TLRs) expressed on macrophages or dendritic cells. TLR engagement can
trigger immune responses. Peptidoglycan (PGN), and lipoteichoic acid
act as ligands of TLR2 (7, 8). Double-stranded RNA
(poly(I:C) RNA), LPS, flagellin, and the CpG motif of unmethylated DNA
(CpG DNA) act as ligands of TLR3, TLR4, TLR5, and TLR9, respectively
(9, 10, 11, 12, 13). In response to TLR ligands, macrophages and
dendritic cells produce several inflammatory cytokines such as TNF-
,
IL-6, IFN-
, and IL-12 to activate immune responses
(14, 15, 16, 17). In addition, TLR stimulation by diverse
microbial products directly induces the maturation of dendritic cells,
which is an essential step for subsequent adaptive immune responses
(15).
LPS, a major constituent of Gram-negative bacteria, has been suggested
to be a potent stimulator of bone loss (18, 19, 20, 21). LPS has
been shown to increase the number of osteoclast precursors via TNF-
action in vivo (19). PGs and the EP4 subtype receptor are
implicated in osteoclast differentiation induced by LPS, suggesting an
indirect role of LPS in osteoclast differentiation by promoting
inflammatory responses accompanied by the production of TNF-
and PGs
(19, 20). However, it has recently been shown that LPS can
enhance the survival, fusion, and activation of osteoclasts independent
of IL-1, TNF-
, and TRANCE (22). In osteoclasts, LPS
stimulation induces NF-
B activation, leading to increased survival
(22). These observations suggest that bacterial
constituents such as LPS may also modulate osteoclasts directly.
However, the precise expression profile and function of TLRs in
osteoclasts and osteoclast precursors has not been determined.
Since osteoclasts are derived from common precursors for macrophages
and dendritic cells, we hypothesized that some of the microbial
products interacting with TLRs may modulate osteoclast differentiation,
thus contributing to the pathology of bone diseases such as
periodontitis, osteomyelitis, and bacterial arthritis caused by
microbial infection (18). To explore potential roles of
various TLRs during osteoclast differentiation, we have analyzed gene
expression patterns of TLRs and their potential function. We show here
that mouse osteoclast precursors express all known TLRs, and their
stimulation induces the activation of NF-
B and production of the
proinflammatory cytokine TNF-
. Unexpectedly, TLR stimulation on
osteoclast precursors inhibited osteoclast differentiation induced by
M-CSF and TRANCE. This is in contrast to the positive role of TLRs on
the immune system. Thus, it appears that TLR stimulation skews the
differentiation of common precursors toward immune responses.
| Materials and Methods |
|---|
|
|
|---|
Three- to 4-wk-old C57BL/6 and C3H/HeJ male mice were obtained from The Jackson Laboratory (Bar Harbor, ME) and housed in a specific pathogen-free facility at the University of Pennsylvania (Philadelphia, PA). All procedures were performed according to the University of Pennsylvania Institutional Animal Care and Use Committee Guidelines.
Cytokines and chemicals
A soluble form of recombinant TRANCE was purified from insect cells as described previously (23). Recombinant human M-CSF was obtained from Genetics Institute (Cambridge, MA). LPS from Escherichia coli (O55:B5), PGN from Staphylococcus aureus, and poly(I:C) RNA were purchased from Sigma-Aldrich (St. Louis, MO), Fluka (Sigma-Aldrich Group), and Amersham Biotech (Piscataway, NJ), respectively. Phosphothioate-stabilized CpG DNA (TCCATGACGTTCCTGATGCT) was synthesized in the core facility of the University of Pennsylvania.
Cells and culture systems
Osteoclast precursors were prepared essentially as described
elsewhere (24, 25). In brief, mouse bone marrow cells were
cultured in
-MEM (Life Technologies, Grand Island, NY) containing
10% FBS with M-CSF (5 ng/ml) for 12 h in 100-mm diameter dishes
(Corning, Glass, Corning, NY; 1 x 107
cells/10 ml/dish) to separate adherent cells and nonadherent cells.
Then, nonadherent cells were harvested and cultured with M-CSF (30
ng/ml) in 100-mm diameter dishes (1 x 107
cells/10 ml/dish). After 2 days of culture, floating cells were removed
and attached cells were used as osteoclast precursors. To generate
osteoclasts, osteoclast precursors were cultured with TRANCE (300
ng/ml) and M-CSF (30 ng/ml) for 3 days in 96-well culture plates
(Corning; 2 x 104 cells/0.2 ml/well) or in
60-mm diameter dishes (Corning; 2.5 x 106
cells/5 ml/dish). To purify mature osteoclasts, cells were treated with
cell dissociation solution (Sigma-Aldrich) for 5 min, and the sides of
the plates were tapped. Most mononuclear cells were detached after
tapping, but multinucleated osteoclasts remained attached to the
culture plates. More than 98% of cells were tartrate-resistant acid
phosphatase (TRAP)-positive osteoclasts after purification (data not
shown). To generate osteoclasts from the murine myeloid RAW264.7 cell
line (American Type Culture Collection, Manassas, VA), cells were
cultured in 96-well culture plates (1 x 103
cells/0.2 ml/well) with TRANCE (300 ng/ml) for 4 days. Old media were
replaced with fresh media containing TRANCE (300 ng/ml) on day 3. To
generate human osteoclasts, freshly isolated human peripheral blood
monocytes were cultured in 96-well culture plates (5 x
104 cells/0.2 ml/well) with TRANCE (300 ng/ml)
and M-CSF (30 ng/ml) for 5 days. Old media were replaced with fresh
media containing TRANCE (300 ng/ml) and M-CSF (30 ng/ml) on day 3. In
some experiments, indicated concentration of PGN, poly(I:C) RNA, LPS,
or CpG DNA was added to the cultures with or without TRANCE and M-CSF.
All cells were cultured at 37°C and 5%
CO2.
Phagocytosis assay
Fluorescein-conjugated zymosan A (Saccharomyces cerevisiae) Bio Particle (Molecular Probes, Eugene, OR) was added to osteoclast precursor and osteoclast cultures in 96-well culture plates (20 µg/0.2 ml/well). After 1 h of culture, cells were washed with PBS to remove the particles that were not incorporated by the cells. Cells were fixed and stained for TRAP, which is strongly expressed in osteoclasts (26). Zymosan particles incorporated by the cells were visualized by UV light illumination under microscopic examination.
Pit formation assay
Mouse osteoclast precursors (5 x 104
cells/0.2 ml/well) or human peripheral blood monocytes (1 x
105 cells/0.2 ml/well) were placed on dentine
slices (4 mm in diameter) in 96-well culture plates and cultured for
1 h with M-CSF (30 ng/ml). Dentine slices were then transferred
into 48-well culture plates (Corning Glass) by the use of forceps.
Cells on dentine slices were cultured in the presence of M-CSF (30
ng/ml) with or without TRANCE (300 ng/ml) for 4 days (mouse) or 6 days
(human). In some experiments, mouse IL-1
(10 ng/ml) was added to the
cultures. Old media were replaced with fresh media on day 3. After
wiping the cells off dentine slices with cotton, the slices were
immersed in Mayers hematoxylin (Sigma-Aldrich) to stain the
resorption pits formed by osteoclasts.
PCR amplification of reversed-transcribed mRNA (RT-PCR) and Southern blot analysis
Total RNA from osteoclast precursors and purified mature osteoclasts in culture dishes (60-mm diameter) was prepared using TRIzol solution (Life Technologies) according to the manufacturers protocols. First-strand cDNA was synthesized from total RNA using Superscript II (Life Technologies) and was subjected to PCR amplification with Taq polymerase (Sigma-Aldrich). For Southern blot hybridization, PCR products were separated by electrophoresis on 1.5% agarose gels and transferred to the nylon membranes (GeneScreen; NEN Life Science, Boston, MA). cDNA probes encoding each gene of TLRs and hypoxanthine phosphoribosyltransferase (HPRT) were labeled with 32P using a cDNA labeling kit (Amersham, Arlington Heights, IL). Primers for mouse TLRs and mouse HPRT used in these studies are as follows: TLR1, 5'-CTTCAGACTTCTGACATCCTCTCA-3' (forward, nt 355378) and 5'-TTCAAGCACACACTTGATGTTAGA-3' (reverse, nt 855878); TLR2, 5'-TGGAGACGCCAGCTCTGGCTCA-3' (forward, nt 19531974) and 5'-CTGACCCGCCCTTTAAGCTG-3' (reverse, nt 23132332); TLR3, 5'-ATTTAGAGTCCAACGGCTTAGATG-3' (forward, nt 17491772) and 5'-TTCCAGTAAAAAGAGATCCTCCAG-3' (reverse, nt 22502273); TLR4, 5'-AGTGGGTCAAGGAACAGAAGCA-3' (forward, nt 17661787) and 5'-CTTTACCAGCTCATTTCTCACC-3' (reverse, nt 20552076); TLR5, 5'-GAAAGTAAGAGGTCCAGAAAGCTG-3' (forward, nt 37483771) and 5'-TATAGTTGTGGGGAAGAAAGAAGG-3' (reverse, nt 42494272); TLR6, 5'-GCCTGACTCTTACAGGTGTGACTA-3' (forward, nt 16981721) and 5'-TTATGATGGGCAAAATAGAGTTCA-3' (reverse, nt 21982221); TLR7, 5'-GCAATTGTGTACCTGTTCTACTGG-3' (forward, nt 341364) and 5'-ACATTATAACATCGAGGGCAATTT-3' (reverse, nt 845868); TLR8, 5'-ACATTATAACATCGAGGGCAATTT-3' (forward, nt 914938) and 5'-ACTCATCATCGTCTGTTGAGAGAG-3' (reverse, nt 14121435); TLR9, 5'-AGTGTCACTTCCTCAATTCTCTGA-3' (forward, nt 528) and 5'-ACCATTATAGCTCAGGTTCAGCTC-3' (reverse, nt 508531); HPRT, 5'-GTAATGATCAGTCAACGGGGGAC-3' (forward, nt 404426); and 3'-HPRT, 5'-CCAGCAAGCTTGCAACCTTAACCA-3' (reverse, nt 557580). The PCR program was as follows: 35 cycles at 94°C for 30 s, 55°C for 40 s, and 72°C for 1 min for all mouse TLRs and HPRT.
Western and Northern blot analysis
For Western blot analysis, osteoclast precursors were cultured
for indicated periods in the presence of PGN (10 µg/ml), poly(I:C)
RNA (100 µg/ml), LPS (1000 ng/ml), or CpG DNA (1 µM). Cells were
then washed with ice-cold PBS and lysed in sample buffer (62.5 mM
Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, 50 mM DTT, and 0.1%
bromphenol blue). Cell lysates were resolved by 10% SDS-PAGE and
transferred onto polyvinylidene difluoride membranes (Millipore,
Bedford, MA) and probed with anti-phospho-I
B
Abs (1 µg/ml)
(New England Biolabs, Beverly, MA) or anti-
-actin (1 µg/ml;
Oncogene, San Diego, CA) Abs. For Northern blot analysis, osteoclast
precursors in 60-mm diameter dishes were cultured with PGN (10
µg/ml), poly(I:C) RNA (100 µg/ml), LPS (1000 ng/ml), and CpG DNA (1
µM) for the indicated periods, and then were subjected to total RNA
isolation using TRIzol (Life Technologies). cDNA probes encoding mouse
TNF-
and G3PDH were labeled with 32P using a
cDNA labeling kit (Amersham).
Determination of TNF-
production in culture medium
Osteoclast precursors (1 x 105
cells/0.2 ml/well) in 96-well culture plates were cultured with or
without PGN (10 µg/ml), poly(I:C) RNA (100 µg/ml), LPS (1000
ng/ml), or CpG DNA (1 µM) for 24 h. Then the quantity of TNF-
protein in the medium was determined by ELISA kit (Quantikine M for
mouse TNF-
; R&D Systems, Minneapolis, MN) according to the
manufacturers protocol. The results are expressed as the means
± SD of four cultures. For statistical analysis of the results, groups
were compared with Students t test.
| Results |
|---|
|
|
|---|
Osteoclast precursors were generated from mouse bone marrow cells
by M-CSF treatment (see Materials and Methods). There
were no TRAP-positive or multinucleated cells in osteoclast
precursor preparations (Fig. 1
A, upper left
panel). After 3 days of culture with TRANCE and M-CSF, both mono-
and multinuclear TRAP-positive cells appeared (Fig. 1
A, upper right panel). When osteoclast
precursors were cultured on dentine slices with TRANCE and M-CSF,
resorption pits were formed on the dentine slices, indicating that
TRAP-positive multinucleated cells are mature osteoclasts (data not
shown). Moreover, these precursors differentiated into macrophages in
the presence of M-CSF only or dendritic cells in the presence of GM-CSF
only (data not shown). When FITC-conjugated zymosan particles were
added to the osteoclast precursor culture, >99% of the cells in
osteoclast precursor culture incorporated zymosan particles within
1 h by phagocytosis (Fig. 1
A, lower left
panel, and B). After differentiation into osteoclasts,
however, no TRAP-positive cells incorporated zymosan particles (Fig. 1
A, lower right panel, and B). These
results suggest that osteoclast precursors, which can differentiate
into osteoclasts, macrophages, or dendritic cells, possess phagocytic
function, which they lose upon differentiation into osteoclasts.
|
|
B activation, which is a hallmark of TLR
stimulation (Fig. 3
(Fig. 3
|
To examine the effects of TLR stimulation on osteoclast
differentiation, osteoclast precursors were stimulated with PGN,
poly(I:C) RNA, LPS, or CpG DNA in the presence of TRANCE and M-CSF. As
previously described, combined TRANCE and M-CSF stimulation efficiently
differentiated osteoclast precursors into mature, multinucleated
TRAP-positive osteoclasts (Fig. 4
A). When LPS was added to the
culture in the presence of TRANCE and M-CSF, it strongly inhibited
osteoclast differentiation (Fig. 4
A). However, osteoclast
precursors prepared from C3H/HeJ mice that have a mutation in the gene
encoding TLR4 differentiated to osteoclasts even in the presence of
LPS. In addition to LPS, all the other TLR ligands tested (PGN,
poly(I:C) RNA, and CpG DNA) strongly inhibited osteoclast
differentiation (Fig. 4
A). Cells treated with TLR ligands in
the presence of TRANCE and M-CSF for 3 days still incorporated zymosan
particles within 1 h (Fig. 4
B), showing that they
maintained their phagocytic capacities rather than differentiating into
nonphagocytic mature osteoclasts (Fig. 1
). When human peripheral blood
monocytes were used as osteoclast precursors, TLR ligands also strongly
inhibited osteoclast differentiation induced by M-CSF and TRANCE (Fig. 4
C). Therefore, these results indicate that TLR stimulation
by microbial products elicits strong negative signals for osteoclast
differentiation from monocytic osteoclast precursors. Furthermore, the
combination of TLR ligands in suboptimal concentrations showed strong
inhibitory effects on osteoclast differentiation, suggesting that TLRs
may act in a cooperative manner (data not shown).
|
can inhibit osteoclast differentiation. Although IL-1
is a
potent stimulator of NF-
B and also up-regulates production of
TNF-
in bone marrow-derived osteoclast precursors (data not shown),
IL-1R stimulation did not antagonize osteoclast differentiation and its
function (Fig. 4TLR stimulation inhibits osteoclast differentiation induced by TRANCE
To further explore this unexpected, negative effect of TLR
stimulation on osteoclast differentiation, the murine myeloid RAW264.7
cell line was treated with TRANCE in the presence or absence of various
TLR ligands (Fig. 5
). As reported, the
RAW264.7 cell line differentiates into mature osteoclasts in response
to TRANCE stimulation alone (27). When TLR ligands PGN,
LPS, or CpG DNA are added to the culture, TRANCE-induced
differentiation of osteoclasts from the RAW264.7 cell line was strongly
inhibited. The inhibitory effect of poly(I:C) RNA on TRANCE-induced
osteoclastogenesis of the RAW264.7 cell line was not as potent as on
bone-marrow derived precursors. This is most likely due to lower
expression of TLR3 in the RAW264.7 cell line than in bone
marrow-derived osteoclast precursors (data not shown). Taken together,
these results suggest that TLR stimulation of specific signaling
pathways mediate the inhibition of osteoclast differentiation induced
by TRANCE.
|
Since expression of TLR2 and TLR4 was detected in mature
osteoclasts (Fig. 2
), we also examined the effects of TLR ligands on
the survival of mature osteoclasts. To test the direct effects of TLR
ligands on osteoclasts, mature osteoclasts were purified and cultured
in the absence or presence of TLR ligands (Fig. 6
). In the absence of any stimuli, most
multinucleated, mature osteoclasts died within 12 h. However, PGN
and LPS induced the survival of mature osteoclasts in a dose-dependent
manner (Fig. 6
). LPS did not induce the survival of mature osteoclasts
prepared from TLR4-deficient C3H/HeJ mice (Fig. 6
A). On the
other hand, neither poly(I:C) RNA nor CpG DNA promoted the survival of
mature osteoclasts at all, consistent with the lack of TLR3 and TLR9
expression in these cells (Fig. 6
). These results suggest that
stimulation by TLRs can directly enhance the survival of mature
osteoclasts.
|
| Discussion |
|---|
|
|
|---|
As with various cells in the immune system, osteoclast precursors
also expressed TLRs. Stimulation via TLRs induced the activation of
NF-
B and up-regulated the expression levels of TNF-
. However, we
showed here that TLR ligands are potent inhibitors of osteoclast
differentiation induced by M-CSF and TRANCE from mouse bone marrow
osteoclast precursors or from human peripheral blood monocytes. Since
TRANCE-induced differentiation of the RAW264.7 cell line to osteoclasts
can also be inhibited by TLR ligands, it is most likely that TLR
ligands inhibit the osteoclastogenic pathway induced by TRANCE. This
was rather unexpected since TLR ligands are potent inducers of
dendritic cell maturation and macrophage activation (15, 28, 29). In addition, NF-
B activation in osteoclast precursors,
which can be induced by TLR stimulation as shown here, has been
implicated in the successful differentiation of precursors to mature
osteoclasts (30, 31).
IFN-
, IL-4, and GM-CSF are produced by macrophages and known to
inhibit osteoclast differentiation (32, 33, 34). To examine
the effects of these factors on osteoclast differentiation, we added
neutralizing Abs to IFN-
, IL-4, and GM-CSF with TLR ligands to the
cultures. However, none of the neutralizing Abs affected the negative
effect of TLR ligands on osteoclast differentiation, suggesting that
TLR ligands inhibited osteoclast differentiation independent of
IFN-
, IL-4, and GM-CSF (data not shown).
It is not clear how TLR stimulation inhibits osteoclast differentiation
mediated by TRANCE. The cytoplasmic tails of TLRs are extremely similar
to the cytoplasmic domain of the IL-1R called the Toll/IL-1R homology
domain (15, 35). The Toll/IL-1R homology domain makes a
complex with myeloid differentiation factor 88, IRAK, and TRAF6. TRAF6
signaling induces phosphorylation and degradation of I
B
to
activate NF-
B (15, 35, 36, 37). However, different from TLR
ligands, we showed IL-1
did not inhibit osteoclast differentiation
induced by TRANCE. Therefore, signaling molecules unique to TLR
stimulation pathway are likely to play roles in the inhibition of
osteoclast differentiation, the mechanism of which may be determined by
future studies.
Our observation that microbial products inhibit osteoclast
differentiation via TLRs is counterintuitive and unexpected, since
bacterial infection can cause inflammatory bone diseases such as
periodontitis, osteomyelitis, and bacterial arthritis
(18). Bone mineral density is reduced in such diseases
because of excessive bone resorption by osteoclasts. In addition, LPS
has been suggested to be a potent stimulator of bone loss by causing
the increase in the number of osteoclasts in mice
(18, 19, 20, 21). Moreover, it has been recently reported
that LPS can also directly enhance the survival of mature osteoclasts
(22), suggesting that TLR stimulation provides
antiapoptotic signals in mature osteoclasts. Indeed, we showed in this
study that mature osteoclasts express TLR4 for LPS. We also showed that
mature osteoclasts express TLR2, and PGN (the ligand for TLR2) enhanced
the survival of mature osteoclasts (Figs. 2
and 6
). However, it
appeared that osteoclast precursors were much more sensitive to TLR
stimulation. For example, a complete inhibition of osteoclast
differentiation can be achieved by 1 ng/ml LPS, at which concentration
LPS has no effect on the survival of mature osteoclasts (Figs. 4
A and 6A).
So how can we explain this apparent discrepancy between our observation that TLR stimulation is a potent negative regulator of osteoclastogenesis and that excessive bone resorption by osteoclasts is associated with bacterial infection? It has been shown recently that alveolar bone destruction in periodontitis caused by infection of Gram-negative bacteria is mediated by enhanced osteoclastogenesis due to T cell immunity (38). CD4+ T cell responses to bacterial infection and TRANCE expressed on activated CD4+ T cells are required for increased numbers of osteoclasts and their enhanced activities leading to bone destruction. Moreover, bacterial infection of immunodeficient mice (SCID) did not lead to significant levels of alveolar bone loss, suggesting that bacterial products may not have a direct role in osteoclastogenesis since SCID mice do not have a defect in osteoclast precursors or osteoblasts (38). Therefore, it is likely that bone loss associated with bacterial infection may be an indirect outcome of exacerbated T cell immune responses.
It is becoming clear that TLR stimulation by microbial products such as
LPS plays an essential role in inducing inflammatory
CD4+ T cell immune responses by regulating many
aspects of the innate immune system (36). Most notably,
LPS is a potent inducer of dendritic cell maturation, which is required
for successful priming of Ag-specific T cells. In addition, TLR ligands
can induce the production of various proinflammatory cytokines such as
TNF-
, IL-1, or IL-12 by activating macrophages or dendritic cells
(15, 16, 39). We showed in this study that, similar to
macrophages or dendritic cells, osteoclast precursors also produce
proinflammatory cytokines such as TNF-
in response to various TLR
ligands. Moreover, although TLR stimulation inhibited osteoclast
differentiation, osteoclast precursors treated with TLR ligands still
retained high levels of phagocytic activity, which is a major host
defense mechanism for the clearance of bacterial infection. Therefore,
the net outcome of TLR stimulation in osteoclast precursors is likely
to enhance immune responses for bacterial clearance. This enhancement
of immune responses can be achieved by promoting cytokine production
from precursor cells and by inhibiting their differentiation into
nonphagocytic, nonimmune cells such as mature osteoclasts. Because
these cells can differentiate into mature osteoclasts if TLR ligands
are removed (data not shown), it appears that, after microbial
infection is cleared, the presence of residual activated T cells can
lead to the differentiation of phagocytic precursors into mature,
bone-resorbing osteoclasts.
In addition to promoting inflammatory responses, TNF-
can also
enhance the differentiation and survival of osteoclasts and up-regulate
M-CSF gene expression in osteoblast/stromal cells (24, 40, 41, 42, 43). Therefore, TNF-
produced by osteoclast precursors
upon TLR stimulation can enhance osteoclastic bone resorption.
In summary, osteoclast precursors are extremely responsive to microbial constituents via TLRs. Interaction of these microbial products with TLRs on osteoclast precursors appears to favor the role of osteoclast precursors as part of the proinflammatory system by inhibiting their differentiation into mature osteoclasts and by promoting the production of inflammatory cytokines. TLRs are thus likely to regulate the balance of immune responses and bone metabolism during acute attacks of vertebrate hosts by various microbes.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 M.T. and N.K. contributed equally to this study. ![]()
3 Address correspondence and reprint requests to Dr. Yongwon Choi, Room 308, BRB II/II, 421 Curie Boulevard, Philadelphia, PA 19104. E-mail address: ychoi3{at}mail.med.upenn.edu ![]()
4 Abbreviations used in this paper: TRANCE, TNF-related activation-induced cytokine; TLR, Toll-like receptor; TRAP, tartrate-resistant acid phosphatase; PGN, peptidoglycan; HPRT, hypoxanthine phosphoribosyltransferase; TRAF, TNFR-associated factor. ![]()
Received for publication February 27, 2002. Accepted for publication May 30, 2002.
| References |
|---|
|
|
|---|
B by Toll-like receptor 3. Nature 413:732.[Medline]
through a post-transcriptional mechanism. J. Immunol. 166:6855.
in the differentiation and survival of osteoclasts induced by lipopolysaccharide from Actinobacillus actinomycetemcomitans Y4. J. Periodontal. Res. 33:509.[Medline]
, IL-1 and RANKL. J. Cell. Physiol. 190:101.[Medline]
stimulates osteoclast differentiation by a mechanism independent of the ODF/RANKL-RANK interaction. J. Exp. Med. 191:275.
,25-dihydroxyvitamin D3 in osteoclast differentiation and function. Methods Enzymol. 282:223.[Medline]
B in osteoclast and B-cell development. Genes Dev. 11:3482.
B1 and NF-
B2. Nat. Med. 3:1285.[Medline]
1. Proc. Natl. Acad. Sci. USA 98:2443.
directly inhibits TRANCE/RANKL-induced osteoclastogenesis. Biochim. Biophys. Acta 276:868.
induces osteoclastogenesis by direct stimulation of macrophages exposed to permissive levels of RANK ligand. J. Clin. Invest. 106:1481.[Medline]
supports the survival of osteoclasts through the activation of Akt and ERK. J. Biol. Chem. 276:49343.
induces transcription of the colony-stimulating factor-1 gene in murine osteoblasts. J. Cell. Physiol. 168:199.[Medline]
induces differentiation of and bone resorption by osteoclasts. J. Biol. Chem. 275:4858.This article has been cited by other articles:
![]() |
J.-D. Ji, K.-H. Park-Min, Z. Shen, R. J. Fajardo, S. R. Goldring, K. P. McHugh, and L. B. Ivashkiv Inhibition of RANK Expression and Osteoclastogenesis by TLRs and IFN-{gamma} in Human Osteoclast Precursors J. Immunol., December 1, 2009; 183(11): 7223 - 7233. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yang, Y. H. Ryu, C.-H. Yun, and S. H. Han Impaired osteoclastogenesis by staphylococcal lipoteichoic acid through Toll-like receptor 2 with partial involvement of MyD88 J. Leukoc. Biol., October 1, 2009; 86(4): 823 - 831. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kim, K. Kim, S. H. Lee, H.-S. So, J. Lee, N. Kim, and Y. Choi Identification of LRRc17 as a Negative Regulator of Receptor Activator of NF-{kappa}B Ligand (RANKL)-induced Osteoclast Differentiation J. Biol. Chem., May 29, 2009; 284(22): 15308 - 15316. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Liu, S. Wang, P. Zhang, N. Said-Al-Naief, S. M. Michalek, and X. Feng Molecular Mechanism of the Bifunctional Role of Lipopolysaccharide in Osteoclastogenesis J. Biol. Chem., May 1, 2009; 284(18): 12512 - 12523. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Alnaeeli and Y.-T. A. Teng Dendritic cells differentiate into osteoclasts in bone marrow microenvironment in vivo Blood, January 1, 2009; 113(1): 264 - 265. [Full Text] [PDF] |
||||
![]() |
J. Lorenzo, M. Horowitz, and Y. Choi Osteoimmunology: Interactions of the Bone and Immune System Endocr. Rev., June 1, 2008; 29(4): 403 - 440. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Davey, X. Liu, T. Ukai, V. Jain, C. Gudino, F. C. Gibson III, D. Golenbock, A. Visintin, and C. A. Genco Bacterial Fimbriae Stimulate Proinflammatory Activation in the Endothelium through Distinct TLRs J. Immunol., February 15, 2008; 180(4): 2187 - 2195. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ha, J.-H. Lee, H.-N. Kim, H. B. Kwak, H.-M. Kim, S. E. Lee, J. H. Rhee, H.-H. Kim, and Z. H. Lee Stimulation by TLR5 Modulates Osteoclast Differentiation through STAT1/IFN-{beta} J. Immunol., February 1, 2008; 180(3): 1382 - 1389. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Taniguchi, K. Yoshida, T. Ito, M. Tsuda, Y. Mishima, T. Furumatsu, L. Ronfani, K. Abeyama, K.-i. Kawahara, S. Komiya, et al. Stage-Specific Secretion of HMGB1 in Cartilage Regulates Endochondral Ossification Mol. Cell. Biol., August 15, 2007; 27(16): 5650 - 5663. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kim, J. Lee, J. H. Kim, H. M. Jin, B. Zhou, S. Y. Lee, and N. Kim Protein Inhibitor of Activated STAT 3 Modulates Osteoclastogenesis by Down-Regulation of NFATc1 and Osteoclast-Associated Receptor J. Immunol., May 1, 2007; 178(9): 5588 - 5594. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kim, J. H. Kim, J. Lee, H. M. Jin, H. Kook, K. K. Kim, S. Y. Lee, and N. Kim MafB negatively regulates RANKL-mediated osteoclast differentiation Blood, April 15, 2007; 109(8): 3253 - 3259. [Abstract] [Full Text] [PDF] |
||||
![]() |
E.-J. Chang, H. J. Kim, J. Ha, H. J. Kim, J. Ryu, K.-H. Park, U.-H. Kim, Z. H. Lee, H.-M. Kim, D. E. Fisher, et al. Hyaluronan inhibits osteoclast differentiation via Toll-like receptor 4 J. Cell Sci., January 1, 2007; 120(1): 166 - 176. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mochizuki, M. Takami, T. Kawawa, R. Suzumoto, T. Sasaki, A. Shiba, H. Tsukasaki, B. Zhao, R. Yasuhara, T. Suzawa, et al. Identification and Characterization of the Precursors Committed to Osteoclasts Induced by TNF-Related Activation-Induced Cytokine/Receptor Activator of NF-{kappa}B Ligand J. Immunol., October 1, 2006; 177(7): 4360 - 4368. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Alnaeeli, J. M. Penninger, and Y.-T. A. Teng Immune Interactions with CD4+ T Cells Promote the Development of Functional Osteoclasts from Murine CD11c+ Dendritic Cells. J. Immunol., September 1, 2006; 177(5): 3314 - 3326. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Fujimura, H. Hotokezaka, N. Ohara, M. Naito, E. Sakai, M. Yoshimura, Y. Narita, H. Kitaura, N. Yoshida, and K. Nakayama The Hemoglobin Receptor Protein of Porphyromonas gingivalis Inhibits Receptor Activator NF-{kappa}B Ligand-Induced Osteoclastogenesis from Bone Marrow Macrophages. Infect. Immun., May 1, 2006; 74(5): 2544 - 2551. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lee, K. Kim, J. H. Kim, H. M. Jin, H. K. Choi, S.-H. Lee, H. Kook, K. K. Kim, Y. Yokota, S. Y. Lee, et al. Id helix-loop-helix proteins negatively regulate TRANCE-mediated osteoclast differentiation Blood, April 1, 2006; 107(7): 2686 - 2693. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Cui, J. Z. Ke, Q. Zhang, H.-Z. Ke, C. Chalouni, and A. Vignery The intracellular domain of CD44 promotes the fusion of macrophages Blood, January 15, 2006; 107(2): 796 - 805. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kim, J. H. Kim, J. Lee, H.-M. Jin, S.-H. Lee, D. E. Fisher, H. Kook, K. K. Kim, Y. Choi, and N. Kim Nuclear Factor of Activated T Cells c1 Induces Osteoclast-associated Receptor Gene Expression during Tumor Necrosis Factor-related Activation-induced Cytokine-mediated Osteoclastogenesis J. Biol. Chem., October 21, 2005; 280(42): 35209 - 35216. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li, E. Cuartas, W. Cui, Y. Choi, T. D. Crawford, H. Z. Ke, K. S. Kobayashi, R. A. Flavell, and A. Vignery IL-1 receptor-associated kinase M is a central regulator of osteoclast differentiation and activation J. Exp. Med., April 4, 2005; 201(7): 1169 - 1177. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sato, N. Takahashi, K. Suda, M. Nakamura, M. Yamaki, T. Ninomiya, Y. Kobayashi, H. Takada, K. Shibata, M. Yamamoto, et al. MyD88 But Not TRIF Is Essential for Osteoclastogenesis Induced by Lipopolysaccharide, Diacyl Lipopeptide, and IL-1{alpha} J. Exp. Med., September 7, 2004; 200(5): 601 - 611. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-I. Hayashi, M. Tsuneto, T. Yamada, M. Nose, M. Yoshino, L. D. Shultz, and H. Yamazaki Lipopolysaccharide-Induced Osteoclastogenesis in Src Homology 2-Domain Phosphatase-1-Deficient Viable Motheaten Mice Endocrinology, June 1, 2004; 145(6): 2721 - 2729. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Cheng, M. Kinosaki, M. Takami, Y. Choi, H. Zhang, and R. Murali Disabling of Receptor Activator of Nuclear Factor-{kappa}B (RANK) Receptor Complex by Novel Osteoprotegerin-like Peptidomimetics Restores Bone Loss in Vivo J. Biol. Chem., February 27, 2004; 279(9): 8269 - 8277. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. O'Gradaigh and J. E. Compston T-cell involvement in osteoclast biology: implications for rheumatoid bone erosion Rheumatology, February 1, 2004; 43(2): 122 - 130. [Full Text] [PDF] |
||||
![]() |
S.-I. Hayashi, T. Yamada, M. Tsuneto, T. Yamane, M. Takahashi, L. D. Shultz, and H. Yamazaki Distinct Osteoclast Precursors in the Bone Marrow and Extramedullary Organs Characterized by Responsiveness to Toll-Like Receptor Ligands and TNF-{alpha} J. Immunol., November 15, 2003; 171(10): 5130 - 5139. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cella, C. Buonsanti, C. Strader, T. Kondo, A. Salmaggi, and M. Colonna Impaired Differentiation of Osteoclasts in TREM-2-deficient Individuals J. Exp. Med., August 18, 2003; 198(4): 645 - 651. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zou, A. Amcheslavsky, and Z. Bar-Shavit CpG Oligodeoxynucleotides Modulate the Osteoclastogenic Activity of Osteoblasts via Toll-like Receptor 9 J. Biol. Chem., May 2, 2003; 278(19): 16732 - 16740. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |