| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Departments of
* Pediatrics and
Pathology, Freie Universität Berlin, and
Deutsches Rheuma ForschungsZentrum, Berlin, Germany
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Diversity of the rearranged VH region genes is limited during the early development of the immune system and evolves during ontogeny. In fetal mice, restrictions due to overrepresentation of a few gene segments and lack of N regions persist throughout gestation (4, 5). In human fetal liver lymphocytes, a considerably restricted VH region gene repertoire with overrepresentation of certain gene segments, like VH6–1 and DH7–27, and length restrictions in the NDN region has been described in the first and second trimester of pregnancy (6, 7, 8). We recently demonstrated that the third trimester of gestation is a period of intensive development of the B cell receptor repertoire in peripheral blood, but restrictions nevertheless persist until term (9). Constraints in the VH gene repertoire may be of functional significance because in preterm and term neonates the humoral immune responses to infection or vaccination are weaker and less protective than later in life (10).
Little is known about the effect of early antigenic exposure on the evolution of the VH region gene repertoire (11). In this study, we present a first analysis of the IgG response of extremely premature infants during their first postnatal weeks. To compare premature infants at their expected date of delivery with term neonates offered the unique opportunity to compare human subjects at the same developmental stage, but after different Ag exposure.
Rearranged VH region genes were amplified and sequenced from B cells of term neonates (gestational age, 36–40 wk) and of preterm neonates (gestational age, 25–29 wk) at different time points after birth until they reached term. We found that the exposure to Ag had no influence on the VH, DH, and JH diversity and did not accelerate the NDN length increase. However, the environmental Ags activated the immune system of preterm neonates and induced both class switch and somatic mutations. The complexity of the resulting IgG repertoire correlated with the time of Ag exposure.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cord blood or peripheral blood was collected from three groups:
extremely preterm neonates at birth, extremely preterm infants at a
postnatal age of 12–14 wk corresponding to their expected date of
delivery, and healthy term neonates. The numbers of the neonates and
the sequences in each group subdivided for analysis of genomic DNA
rearrangements, IgM transcripts, and IgG transcripts are given in Table I
. Additional peripheral blood samples
were taken from the preterm neonates between 2 and 14 wk after birth
(Table II).
|
|
DNA extraction and nested primer PCR amplification
DNA was extracted from 0.2 ml of heparinized blood using a
commercial kit (QIAamp DNA Blood Mini kit; Qiagen, Hilden, Germany).
Briefly, 0.5–1.0 µg of DNA were used for the amplification of the
VH region gene with a nested primer PCR procedure
previously established by our group (12). Briefly, for the
first-round PCR, a mixture of family-specific primers for a conserved
region of the framework region
(FR)3 1 was combined
with a JH consensus primer. For the second PCR, a
mixture of family-specific primers for FR2 was combined with a nested
consensus JH primer. The amplification products
of the second PCR were 
230–280 nt long. Positive (B cell line Raji)
and negative (water) controls were run with each PCR. The
Taq error rate measured by repeated sequence reactions of
the B cell line Raji was 0.08%. This was similar to previous estimates
of the Taq polymerase error rate for the amplification of
VH region genes using nested PCR
(13).
RNA extraction, RT-PCR amplification
RNA was extracted from 0.2 ml of heparinized blood with a
commercial kit (QIAamp RNA Blood Mini kit). RT-PCR was performed with
0.1–0.2 µg of RNA using a 30-cycle Qiagen One-Step RT-PCR kit
(Qiagen) with a mixture of family-specific consensus primers for the
FR1 (14) and two antisense primers binding to the CH1
domain of the 
(5-CACGTCGCAGATGTAGGTCTGG) or µ
(ACGGGGAATTCTCACAGGAGAC) C region gene. The Taq error of the
RT-PCR measured by analyzing sequences of the IgH chain constant region
was 0.07%.
Cloning and sequencing
After separation by PAGE, PCR products were eluted from the gel and cloned using the TOPO TA cloning kit (Invitrogen, Leek, The Netherlands). After the transformed cells had grown on agar plates, 25–35 clones from each subject were randomly selected. The plasmid DNA was isolated, linearized, and sequenced. The sequence reaction was analyzed on the Applied Biosystems automated sequencer (ABI 377A; Applied Biosystems, Weiterstadt, Germany).
Sequence analysis
Only functional rearrangements, defined as in-frame rearrangements without stop codons, were analyzed using the VBASE directory (15). We first identified VH and JH gene segments. The NDN region length was defined as the number of nucleotides between the last nucleotide matching with the 3' end of the VH gene segment and the first nucleotide matching with the 5' end of the JH gene segment.
Assignment of a DH segment to the NDN region required at least six consecutive nucleotides sequence identity with a known germline DH segment or seven nucleotides of sequence identity interrupted by no more than one mismatch and with at least two identical nucleotides both at the 3' and 5' ends. We accepted only conventional VHDHJH recombinations without DIR segments, inverted DH segments, or DH-DH recombinations as proposed by Corbett et al. (3). To estimate the diversity of the respective B cell population, the percentage of different VHDHJH rearrangements among all sequences was calculated. The numbers of nucleotide exchanges were determined in CDR2 and FR3 by comparison with the germline sequence of the respective VH gene segment. The frequency of nucleotide exchanges was not corrected for Taq polymerase error.
GeneScan analysis of IgG amplificates
To determine the size distribution of IgG transcripts, a RT-PCR (denaturation, 94°C for 1 min; annealing, 60°C for 1 min; and extension, 72°C for 1 min) employing six family-specific FR3 primers in conjunction with a primer specific for the IgG constant region (5'-GGGAAGTAGTCCTTGACCAG; 5'-FAM-labeled) was performed after reverse transcription (Qiagen One-Step RT-PCR kit). An aliquot of the RT-PCR mixture was then separated on a 6% polyacrylamide sequencing gel (ABI 310C; Applied Biosystems) and analyzed with the GeneScan software (ABI 672; version 3.1).
Statistical analysis
Statistical calculations were done with the SPSS statistical software version 9.0 (SPSS, Chicago, IL). Normally distributed data are presented as mean ± SD and comparisons between groups were made using ANOVA. Data that were not normally distributed are presented as median and range. Correlations between parameters were determined by regression analysis.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To address the question whether exposure to environmental Ags
alters the VH gene repertoire,
VH, DH, and
JH gene segment usage was determined for
lymphocytes isolated from the cord blood of term neonates and from the
peripheral blood of premature infants at their expected date of
delivery. In both groups rearrangements using VH
gene segments of the VH3 family were dominant
(Fig. 1A). There was no
overrepresentation of VH 6–1, the most
DH proximal VH gene
segment. Overall, the VH family usage in neonates
resembled that seen in adults. Other similarities between the
Ag-exposed and nonexposed neonates emerged, when individual gene
segments were analyzed: 1) A similar number of different gene segments
was used in each group: 30 different VH gene
segments in term neonates compared with 33 in preterm infants at their
expected date of delivery. 2) The rearranged VH
gene segments were taken from across the entire gene locus. 3)
VH gene segment usage was nonrandom, i.e., some
gene segments were overrepresented, while others were not used at all.
DH gene segments could be identified in 81% of
functional sequences from preterm infants and in 73% of functional
sequences from term neonates. In both groups, all seven
DH families were found. Extrauterine development
had not reduced the overrepresentation of the DH6
and DH7 family in neonates compared with adults
(Fig. 1B). Furthermore, there was a clear bias toward the
JH3 gene segment in both groups of neonates. This
occurred at the expense of the JH6 gene segment
which was used considerably less often in neonates than in adults (Fig. 1C).
|
The increase in NDN region length was not accelerated by extrauterine development
DNA rearrangements from cord blood lymphocytes of preterm and term
neonates showed a slow increase in the length of the NDN region by 0.25
nt/wk (r = 0.556; p < 0.001; Fig. 2A). Consequently, NDN regions
in cord blood lymphocytes of term neonates were significantly longer
than in cord blood lymphocytes of preterm neonates (22 ± 3 vs
19 ± 2 nt; p < 0.001). Within the NDN region the
number of nucleotides inserted during joining of
DH and JH was most closely
related to gestational age (r = 0.693;
p < 0.001) and 48% of sequences from preterm neonates
(gestational age, 25–29 wk) had no N nucleotides between
DH and JH. This percentage
decreased to 30% after normal intrauterine development until
term.
|
B) and the percentage of sequences
without N addition between DH and
JH (34%) was not reduced. There was no
difference in the NDN region length when IgG transcripts were compared
with DNA rearrangements (Fig. 2B). In conclusion, the
increase in NDN region length until term was not influenced by Ag
exposure but rather was developmentally controlled. The IgM and IgG repertoire in cord blood lymphocytes
To study the IgM and IgG repertoires, RNA was isolated from cord
blood. Cord blood lymphocytes of preterm neonates (gestational age,
25–27 wk) expressed a diverse IgM repertoire and 78% of the IgM
transcripts were different
VHDHJH
rearrangements (Table I). In contrast, among 23 IgG sequences isolated
from the cord blood of three preterm neonates, only four different
VHDHJH
rearrangements were found (Table III): in
neonate a34a, one VH 5–51 rearrangement was
found 3 times, in neonate a42a one
VHDHJH
rearrangement was isolated 12 times, a second one 6 times, and in
neonate a41a, a VH 4–30.4 rearrangement was
found 2 times. The repeated finding of identical
VHDHJH
rearrangements suggests that only a few B cells that switched to IgG
were present in the cord blood of preterm neonates.
|
). In particular, N nucleotides
were missing between the DH segment and
JH gene segment. Sequences without N addition
often had short overlapping sequences between DH
and JH. For example, from PBL of neonate a42,
nine different IgG rearrangements were sequenced (sample a42b). In six
of the seven sequences without N addition, an overlap of one to three
nucleotides was observed. These characteristics indicate that the IgG
transcripts were from neonatal cells and not a contamination with
maternal cells.
Similarly, a diverse IgM repertoire, but only a few IgG transcripts
were isolated from cord blood lymphocytes of term neonates (gestational
age, 36–39 wk). From each of two neonates (c38a and c39a), eight
sequences were analyzed and in both cases only two different
VHDHJH
rearrangements were seen (Table III). From a third neonate (c43a), 35
IgG transcripts were sequenced, but only 13 different
VHDHJH
rearrangements were found (Table II). In the IgG transcripts of the
term neonates, the NDN regions were longer and N insertions between
DH and JH occurred more
frequently than in the sequences from the preterm neonates.
Nevertheless, their overall characteristics were those of a neonatal
repertoire.
Taken together, these results demonstrated that a diverse IgM repertoire already existed at the end of the second trimester of gestation. However, there were only a few IgG transcripts in cord blood, suggesting that class switch occurred only sporadically during intrauterine development.
Ag exposure induced class switch
The exposure to extrauterine Ags induced an immune response with
class switch in preterm neonates and their IgG repertoire increased
rapidly with postnatal age. Whereas in the cord blood of the infant a42
(gestational age, 27 wk), only 2 (11%) among 18 IgG transcripts were
different
VHDHJH
rearrangements, already 15 days after birth (sample a42b) a much more
heterogeneous IgG repertoire was detectable with 8 different
rearrangements among a total of 13 sequences (61%). When another blood
sample (a42 day) of the same baby was analyzed 14 wk after birth, a
further increase in the diversity of the IgG repertoire was seen with
23 (92%) different sequences of 25 (Table II).
This rapid increase in the diversity of the IgG repertoire estimated
from the percentage of different sequences was confirmed by gene scan
analysis of RNA from these three postnatal blood samples of neonate
a42. In the cord blood gene scan, there was one single peak. Already in
the sample 15 days after birth a oligoclonal length distribution was
seen and in the sample 14 wk after birth further diversification was
detectable with a polyclonal length spectrum that was normally
distributed (Fig. 3). Comparable results
were found when the RNA samples of baby a41 were spectratyped (data not
shown).
|
).
|
The mutational frequency in VH
rearrangements isolated from cord blood lymphocytes of both preterm and
term neonates was low (Table I). IgG transcripts in cord blood of term
neonates were also practically unmutated, 65% had no nucleotide
exchange, 5 sequences had single nucleotide exchanges, and no sequence
had >1 exchange. Thus, it is most likely that these substitutions are
errors introduced by the Taq polymerase or polymorphisms,
rather than somatic mutations.
A different result was found in PBL of preterm neonates after birth.
The mutational frequency in IgG transcripts was closely related to the
duration of exposure to extrauterine Ags (Fig. 5). It increased from 0% at birth
(gestational age, 27 wk) to 0.6–0.9% after 12–14 wk postnatal age,
corresponding to a postconceptional age of 39–41 wk (r
= 0.897; p = 0.002).
|
). Fifteen percent of the IgG transcripts had
three or more nucleotide exchanges per sequence. Nucleotide exchanges
in IgG transcripts of these preterm infants showed the characteristics
of Ag-selected somatic mutations (16): they were more
frequent in CDR2 (mutational frequency, 0.91%) than in FR3 (mutational
frequency, 0.47) and in CDR2 replacement mutations dominated (ratio of
replacement:silent mutation, 20:1). In one preterm neonate at term
(a34b), five clonally related IgG transcripts with an identical NDN
region but a different pattern of three to six somatic mutations were
found. Clonal expansion of B cells and Ag-selected somatic mutations
are typical results of germinal center reactions. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This study presents three novel observations about the evolution of the IgH chain gene repertoire during early human development: 1) Premature exposure to extrauterine environmental Ags did not result in a more adult-like pattern of gene segment usage. 2) During normal intrauterine development class switch occurred only in a few B cells and the observed IgG rearrangements were unmutated. 3) Exposure of preterm neonates to environmental Ags induced class switch and somatic mutations within 2 wk of postnatal life and resulted in a heterogeneous population of IgG-expressing B cells. The pattern of somatic mutations suggested Ag selection.
Restrictions in the neonatal VH, DH, and JH gene segment utilization persisted despite Ag exposure
In neonates, VH gene segments from across the entire locus were used in a frequency pattern similar to the one seen in adults, suggesting that proximity of the VH gene segment to the DH locus seems to play a much more limited role in rearrangement bias in humans than in mice (9, 18, 19). Furthermore, the IgG and the IgM repertoire showed a similar VH gene segment usage. This preponderance of gene locus inherent characteristics over environmental factors on the pattern of VH gene expression is in line with the finding that in mice transgenic for part of the human Ig locus, the VH gene segment usage was similar to that in human adults (20).
Early in gestation proximity between DH and JH gene segments in the genome favors rearrangement of the DH7 family and JH1, JH2, and JH3 (8). With increasing fetal maturity, the importance of proximity decreases but still plays a role in neonates at term who favor the DH6, DH7 families and JH3, JH4, whereas in adults DH2, DH3 families and JH6 are preferably used (9, 21). We found that Ag exposure did not accelerate these developmental trends in the repertoire.
Restrictions in NDN region length persisted despite Ag exposure
The length of the NDN region increased during normal intrauterine development. However, this prolongation was not accelerated by premature exposure to environmental Ags. Instead, the NDN length seemed to be developmentally controlled by a stepwise activation of TdT activity during fetal life.
Sequences without N addition between DH and JH often had short overlapping sequences. Thus, the absence of N regions between DH and JH gene segments decreases diversity not only by the absence of randomly inserted nucleotides, but also because it favors rearrangements between gene segments that share short sequence homologies (22).
The IgM and IgG repertoire during intrauterine development
The analysis of rearrangement length diversity with "spectratyping" demonstrated highly variable IgM transcripts already in fetal liver (23). In support of these spectratyping results, we found that 78–100% of the IgM transcripts and of the DNA rearrangements isolated from cord blood lymphocytes had different NDN region sequences. This indicates that the establishment of a diverse primary repertoire in humans occurs early in gestation independent of exogenous Ags. In agreement with previous results (24, 25, 26), the frequency of somatic mutations in DNA rearrangements and IgM transcripts in cord blood was consistently low and the nucleotide exchanges were randomly distributed.
IgG transcripts could be detected as early as 27 wk of gestation, but the IgG repertoire seemed to be markedly restricted, as most of the isolated IgG transcripts had identical VHDHJH rearrangements. These IgG transcripts were not due to contamination with maternal cells for two reasons. First, they had no N insertions between DH and JH, which is a characteristic feature of the human fetal VH region gene repertoire, and, second, they were unmutated. The diversity of the IgG repertoire remained low throughout normal intrauterine development.
During the third trimester of gestation, peripheral lymph nodes complete the development of their basic primary structure (27). After normal intrauterine development germinal centers are absent in the human fetus (28). Nevertheless, in the cord blood of preterm neonates, IgG sequences were found, although unmutated. Thus, it seems that in human neonates switch recombination may take place before the development of germinal centers. It is known that class switch and hypermutation are independently regulated (29) and that, in KO mice unable to form germinal centers, class switch can occur although at a lower frequency but that these class-switched rearrangements are unmutated (30).
Studies in Ag-deprived environments have previously only been made in animals, but point in the same direction as our findings during intrauterine development. In mice living in a sterile environment and consuming an ultrafiltered low Ag diet (germfree Ag-free mice), IgM levels were nearly normal and the IgM repertoire showed a normal diversity. But levels of circulating IgG and IgA were profoundly depressed and peripheral lymph nodes and mucosal lymphoid tissue were smaller than in conventionally housed animals (31, 32).
In conclusion, in human neonates class switch during intrauterine development is a sporadic event throughout gestation without evidence of Ag-driven or developmentally driven expansion of class-switched cells.
Evolution of class-switched IgG rearrangements during Ag exposure
The population of class-switched B cells rapidly expanded after preterm birth and hence with exposure to extrauterine environmental Ags from nutrition, from the developing gut microflora, and from infectious pathogens. The finding of heterogeneous, somatically mutated IgG sequences as early as 14 days after premature birth suggests that already early in the third trimester of gestation the immune system of the neonate is sufficiently developed to respond to an external antigenic stimulus. The findings of somatic mutations with evidence of Ag selection and of clonally related sequences are hallmarks of the germinal center reaction (33, 34). The knowledge of the development of the IgG memory B cell population in infancy is still incomplete. We observed an increasing heterogeneity of IgG rearrangements within 12 wk but these rearrangements were very different from IgG later in life because they had short NDN regions and a low frequency of somatic mutations (0.68%). Already in early childhood the frequency of somatic mutations has increased to 3.2% (35).
In conclusion, these data show that VH region gene diversity is mainly developmentally regulated. It evolves without stimulation by non-self-Ags until term and repertoire restrictions persist despite premature contact with exogenous Ags. However, premature exposure to Ag accelerates the development of the functional immune system. Preterm infants exposed to environmental Ags develop a polyclonal population of IgG-expressing memory B cells that are not found after normal intrauterine development. Thus, restrictions in the VH region gene repertoire, in particular in the diversity of the CDR3 region rather than functional defects of the B cells, seem to be responsible for the poor immune responses often described for the neonate.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Karl Bauer, Department of Pediatrics, Freie Universität Berlin, Hindenburgdamm 30, 12200 Berlin, Germany. E-mail address: karl.bauer{at}medizin.fu-berlin.de
3 Abbreviation used in this paper: FR, framework region.
Received for publication January 29, 2002. Accepted for publication May 21, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and C repertoires. J. Immunol. 150:1348.[Abstract]
This article has been cited by other articles:
|
|
 |
|
  S. Weller, M. Mamani-Matsuda, C. Picard, C. Cordier, D. Lecoeuche, F. Gauthier, J.-C. Weill, and C.-A. Reynaud Somatic diversification in the absence of antigen-driven responses is the hallmark of the IgM+IgD+CD27+ B cell repertoire in infants J. Exp. Med., June 9, 2008; 205(6): 1331 - 1342. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. G. Tangye and K. L. Good Human IgM+CD27+ B Cells: Memory B Cells or "Memory" B Cells? J. Immunol., July 1, 2007; 179(1): 13 - 19. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. F. Carlin, A. L. Lewis, A. Varki, and V. Nizet Group B Streptococcal Capsular Sialic Acids Interact with Siglecs (Immunoglobulin-Like Lectins) on Human Leukocytes J. Bacteriol., February 15, 2007; 189(4): 1231 - 1237. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Zemlin, G. Hoersch, C. Zemlin, A. Pohl-Schickinger, M. Hummel, C. Berek, R. F. Maier, and K. Bauer The Postnatal Maturation of the Immunoglobulin Heavy Chain IgG Repertoire in Human Preterm Neonates Is Slower than in Term Neonates J. Immunol., January 15, 2007; 178(2): 1180 - 1188. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J Bonhoeffer, C-A Siegrist, and P T Heath Immunisation of premature infants. Arch. Dis. Child., November 1, 2006; 91(11): 929 - 935. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Henneke and R. Berner Interaction of neonatal phagocytes with group B streptococcus: recognition and response. Infect. Immun., June 1, 2006; 74(6): 3085 - 3095. [Full Text] [PDF]
|
|
|
|
|
|
S. Kenzel, G. Mancuso, R. Malley, G. Teti, D. T. Golenbock, and P. Henneke c-Jun Kinase Is a Critical Signaling Molecule in a Neonatal Model of Group B Streptococcal Sepsis. J. Immunol., March 1, 2006; 176(5): 3181 - 3188. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Souto-Carneiro, G. P. Sims, H. Girschik, J. Lee, and P. E. Lipsky Developmental Changes in the Human Heavy Chain CDR3 J. Immunol., December 1, 2005; 175(11): 7425 - 7436. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. P. Sims, R. Ettinger, Y. Shirota, C. H. Yarboro, G. G. Illei, and P. E. Lipsky Identification and characterization of circulating human transitional B cells Blood, June 1, 2005; 105(11): 4390 - 4398. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Bende, W. M. Aarts, R. G. Riedl, D. de Jong, S. T. Pals, and C. J.M. van Noesel Among B cell non-Hodgkin's lymphomas, MALT lymphomas express a unique antibody repertoire with frequent rheumatoid factor reactivity J. Exp. Med., April 18, 2005; 201(8): 1229 - 1241. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. R. Kolar, T. Yokota, M. I. D. Rossi, S. K. Nath, and J. D. Capra Human fetal, cord blood, and adult lymphocyte progenitors have similar potential for generating B cells with a diverse immunoglobulin repertoire Blood, November 1, 2004; 104(9): 2981 - 2987. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Souto-Carneiro, N. S. Longo, D. E. Russ, H.-w. Sun, and P. E. Lipsky Characterization of the Human Ig Heavy Chain Antigen Binding Complementarity Determining Region 3 Using a Newly Developed Software Algorithm, JOINSOLVER J. Immunol., June 1, 2004; 172(11): 6790 - 6802. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) and
from the peripheral blood of premature infants at their expected date
of delivery corresponding to a postnatal age of 8–13 wk (
).
Frequencies are shown for VH families (A),
DH families (B), and JH gene
segments (C). Data are mean ± SD. Lines indicate
the frequencies of gene segments previously determined for PBL from six
healthy adults (
)
and IgG transcripts (
) isolated from PBL of preterm infants are
shown in relation to their postconceptional age (gestational age
+ postnatal age). Lines represent the regression line and 95%
confidence limits from A to facilitate comparison.
