The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bauer, K.
Right arrow Articles by Berek, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bauer, K.
Right arrow Articles by Berek, C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*Substance via MeSH
Medline Plus Health Information
*Premature Babies
The Journal of Immunology, 2002, 169: 1349-1356.
Copyright © 2002 by The American Association of Immunologists

Diversification of Ig Heavy Chain Genes in Human Preterm Neonates Prematurely Exposed to Environmental Antigens1

Karl Bauer2,*, Michael Zemlin*, Michael Hummel{dagger}, Sabine Pfeiffer*, Julia Karstaedt*, Gudrun Steinhauser{ddagger}, Xin Xiao*, Hans Versmold* and Claudia Berek{ddagger}

Departments of * Pediatrics and {dagger} Pathology, Freie Universität Berlin, and {ddagger} Deutsches Rheuma ForschungsZentrum, Berlin, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Preterm neonates are exposed to extrauterine environmental Ags during the time period that corresponds to the last trimester of normal intrauterine development. To study whether this precocious exposure to Ags accelerates the Ig repertoire diversification, we compared IgH chain genes of preterm neonates (gestational age, 25–29 wk) during their first postnatal months with those of term neonates. Preterm infants approaching their expected date of delivery after 8–13 wk of extrauterine life used a similar VH, DH, and JH gene segment repertoire as term neonates born after intrauterine development. Furthermore, the length increase of the NDN region between VH and JH by 0.25 nt per gestational week (r = 0.556, p < 0.0001) was not accelerated. Thus, the generation of the VH region gene repertoire is developmentally controlled and independent of environmental influences. However, exposure to extrauterine Ags induced class switch and somatic mutations in IgH chain genes within 2 wk after premature birth and IgG transcript diversity and mutational frequency increased with the duration of extrauterine life. Three-month-old preterm infants expressed a heterogeneous IgG repertoire at their expected date of delivery with VH region genes carrying significant numbers of somatic mutations with evidence for Ag selection. Term neonates, however, had no such IgG repertoire. We conclude that restrictions in the neonatal Ig VH region gene repertoire persist until term despite exposure to environmental Ags. Yet, many weeks before term the immune system of the preterm neonate can already support germinal center reactions in response to environmental Ags.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The specificity of the B cell Ag receptor is determined by the combined V regions of the Ig H and L chains. The diversity of the V regions allows the recognition of a broad range of antigenic determinants and thus ensures an efficient, specific immune response. In particular, the V region of the IgH chain (VH region), is essential for Ag recognition (1). The VH region is encoded by the VH region gene which is generated during B cell development by the combination of the VH, DH, and JH gene segments. The rearrangement of the gene segments occurs in two steps. First, at the pro-B cell stage, a DH segment is joined with a JH segment. During this recombination, the enzyme TdT is activated and randomly inserts nucleotides (N nucleotides) between the rearranged DH and JH segments. Second, the DH-N-JH rearrangement is joined with a VH gene segment. Again, TdT is active and inserts N-nucleotides during joining (2). Thus, the NDN region is the most diverse part of the rearranged VH gene because it contains the randomly inserted N nucleotides and most of the DH segments can be translated in more than one reading frame (3).

Diversity of the rearranged VH region genes is limited during the early development of the immune system and evolves during ontogeny. In fetal mice, restrictions due to overrepresentation of a few gene segments and lack of N regions persist throughout gestation (4, 5). In human fetal liver lymphocytes, a considerably restricted VH region gene repertoire with overrepresentation of certain gene segments, like VH6–1 and DH7–27, and length restrictions in the NDN region has been described in the first and second trimester of pregnancy (6, 7, 8). We recently demonstrated that the third trimester of gestation is a period of intensive development of the B cell receptor repertoire in peripheral blood, but restrictions nevertheless persist until term (9). Constraints in the VH gene repertoire may be of functional significance because in preterm and term neonates the humoral immune responses to infection or vaccination are weaker and less protective than later in life (10).

Little is known about the effect of early antigenic exposure on the evolution of the VH region gene repertoire (11). In this study, we present a first analysis of the IgG response of extremely premature infants during their first postnatal weeks. To compare premature infants at their expected date of delivery with term neonates offered the unique opportunity to compare human subjects at the same developmental stage, but after different Ag exposure.

Rearranged VH region genes were amplified and sequenced from B cells of term neonates (gestational age, 36–40 wk) and of preterm neonates (gestational age, 25–29 wk) at different time points after birth until they reached term. We found that the exposure to Ag had no influence on the VH, DH, and JH diversity and did not accelerate the NDN length increase. However, the environmental Ags activated the immune system of preterm neonates and induced both class switch and somatic mutations. The complexity of the resulting IgG repertoire correlated with the time of Ag exposure.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Patients

Cord blood or peripheral blood was collected from three groups: extremely preterm neonates at birth, extremely preterm infants at a postnatal age of 12–14 wk corresponding to their expected date of delivery, and healthy term neonates. The numbers of the neonates and the sequences in each group subdivided for analysis of genomic DNA rearrangements, IgM transcripts, and IgG transcripts are given in Table IGo. Additional peripheral blood samples were taken from the preterm neonates between 2 and 14 wk after birth (Table IIGo).


View this table:
[in this window]
[in a new window]
 
Table I. Somatic diversity of the VH rearrangements

 

View this table:
[in this window]
[in a new window]
 
Table II. IgM and IgG response in neonates

 
All extremely preterm neonates studied were delivered by cesarean section without clinical or laboratory signs of intrauterine infection. During extrauterine life, each of the preterm neonates developed between one and four episodes of bacterial infection. Blood culture-proven sepsis was defined as positive blood cultures combined with clinical and/or laboratory symptoms of infection. Clinically suspected sepsis was defined as clinical signs of infection and elevation of C-reactive protein >15 mg/L, and/or >20% immature granulocytes in the differential blood count. The healthy term neonates were born spontaneously after uncomplicated normal pregnancies with no history or clinical signs of prenatal or perinatal infection. Enteral nutrition with preterm formula or mother’s milk was started on the first day of life. At 3 wk of age, all preterm infants received exclusively enteral nutrition. Gestational age was calculated from the first day of the last menstrual period and confirmed by early ultrasound and by clinical examination. Postconceptional age was calculated as gestational age plus postnatal age. Neonates of the same postconceptional age are at the same developmental stage. The institutional review board had approved the study protocol and written consent of parents was obtained.

DNA extraction and nested primer PCR amplification

DNA was extracted from 0.2 ml of heparinized blood using a commercial kit (QIAamp DNA Blood Mini kit; Qiagen, Hilden, Germany). Briefly, 0.5–1.0 µg of DNA were used for the amplification of the VH region gene with a nested primer PCR procedure previously established by our group (12). Briefly, for the first-round PCR, a mixture of family-specific primers for a conserved region of the framework region (FR)3 1 was combined with a JH consensus primer. For the second PCR, a mixture of family-specific primers for FR2 was combined with a nested consensus JH primer. The amplification products of the second PCR were ~230–280 nt long. Positive (B cell line Raji) and negative (water) controls were run with each PCR. The Taq error rate measured by repeated sequence reactions of the B cell line Raji was 0.08%. This was similar to previous estimates of the Taq polymerase error rate for the amplification of VH region genes using nested PCR (13).

RNA extraction, RT-PCR amplification

RNA was extracted from 0.2 ml of heparinized blood with a commercial kit (QIAamp RNA Blood Mini kit). RT-PCR was performed with 0.1–0.2 µg of RNA using a 30-cycle Qiagen One-Step RT-PCR kit (Qiagen) with a mixture of family-specific consensus primers for the FR1 (14) and two antisense primers binding to the CH1 domain of the {gamma} (5-CACGTCGCAGATGTAGGTCTGG) or µ (ACGGGGAATTCTCACAGGAGAC) C region gene. The Taq error of the RT-PCR measured by analyzing sequences of the IgH chain constant region was 0.07%.

Cloning and sequencing

After separation by PAGE, PCR products were eluted from the gel and cloned using the TOPO TA cloning kit (Invitrogen, Leek, The Netherlands). After the transformed cells had grown on agar plates, 25–35 clones from each subject were randomly selected. The plasmid DNA was isolated, linearized, and sequenced. The sequence reaction was analyzed on the Applied Biosystems automated sequencer (ABI 377A; Applied Biosystems, Weiterstadt, Germany).

Sequence analysis

Only functional rearrangements, defined as in-frame rearrangements without stop codons, were analyzed using the VBASE directory (15). We first identified VH and JH gene segments. The NDN region length was defined as the number of nucleotides between the last nucleotide matching with the 3' end of the VH gene segment and the first nucleotide matching with the 5' end of the JH gene segment.

Assignment of a DH segment to the NDN region required at least six consecutive nucleotides sequence identity with a known germline DH segment or seven nucleotides of sequence identity interrupted by no more than one mismatch and with at least two identical nucleotides both at the 3' and 5' ends. We accepted only conventional VHDHJH recombinations without DIR segments, inverted DH segments, or DH-DH recombinations as proposed by Corbett et al. (3). To estimate the diversity of the respective B cell population, the percentage of different VHDHJH rearrangements among all sequences was calculated. The numbers of nucleotide exchanges were determined in CDR2 and FR3 by comparison with the germline sequence of the respective VH gene segment. The frequency of nucleotide exchanges was not corrected for Taq polymerase error.

GeneScan analysis of IgG amplificates

To determine the size distribution of IgG transcripts, a RT-PCR (denaturation, 94°C for 1 min; annealing, 60°C for 1 min; and extension, 72°C for 1 min) employing six family-specific FR3 primers in conjunction with a primer specific for the IgG constant region (5'-GGGAAGTAGTCCTTGACCAG; 5'-FAM-labeled) was performed after reverse transcription (Qiagen One-Step RT-PCR kit). An aliquot of the RT-PCR mixture was then separated on a 6% polyacrylamide sequencing gel (ABI 310C; Applied Biosystems) and analyzed with the GeneScan software (ABI 672; version 3.1).

Statistical analysis

Statistical calculations were done with the SPSS statistical software version 9.0 (SPSS, Chicago, IL). Normally distributed data are presented as mean ± SD and comparisons between groups were made using ANOVA. Data that were not normally distributed are presented as median and range. Correlations between parameters were determined by regression analysis.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The frequencies of rearranged VH, DH, and JH gene segments after extrauterine development were similar to those after intrauterine development

To address the question whether exposure to environmental Ags alters the VH gene repertoire, VH, DH, and JH gene segment usage was determined for lymphocytes isolated from the cord blood of term neonates and from the peripheral blood of premature infants at their expected date of delivery. In both groups rearrangements using VH gene segments of the VH3 family were dominant (Fig. 1GoA). There was no overrepresentation of VH 6–1, the most DH proximal VH gene segment. Overall, the VH family usage in neonates resembled that seen in adults. Other similarities between the Ag-exposed and nonexposed neonates emerged, when individual gene segments were analyzed: 1) A similar number of different gene segments was used in each group: 30 different VH gene segments in term neonates compared with 33 in preterm infants at their expected date of delivery. 2) The rearranged VH gene segments were taken from across the entire gene locus. 3) VH gene segment usage was nonrandom, i.e., some gene segments were overrepresented, while others were not used at all. DH gene segments could be identified in 81% of functional sequences from preterm infants and in 73% of functional sequences from term neonates. In both groups, all seven DH families were found. Extrauterine development had not reduced the overrepresentation of the DH6 and DH7 family in neonates compared with adults (Fig. 1GoB). Furthermore, there was a clear bias toward the JH3 gene segment in both groups of neonates. This occurred at the expense of the JH6 gene segment which was used considerably less often in neonates than in adults (Fig. 1GoC).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 1. The frequencies of rearranged gene segments were similar after extrauterine and intrauterine development. VH, DH, and JH gene segment usage was determined for lymphocytes isolated from the cord blood of term neonates ({square}) and from the peripheral blood of premature infants at their expected date of delivery corresponding to a postnatal age of 8–13 wk ({blacksquare}). Frequencies are shown for VH families (A), DH families (B), and JH gene segments (C). Data are mean ± SD. Lines indicate the frequencies of gene segments previously determined for PBL from six healthy adults (9 ).

 
In conclusion, exposure to extrauterine Ags during the last trimester of gestation did not shift the frequencies of the expressed gene segments toward a more adult-like distribution.

The increase in NDN region length was not accelerated by extrauterine development

DNA rearrangements from cord blood lymphocytes of preterm and term neonates showed a slow increase in the length of the NDN region by 0.25 nt/wk (r = 0.556; p < 0.001; Fig. 2GoA). Consequently, NDN regions in cord blood lymphocytes of term neonates were significantly longer than in cord blood lymphocytes of preterm neonates (22 ± 3 vs 19 ± 2 nt; p < 0.001). Within the NDN region the number of nucleotides inserted during joining of DH and JH was most closely related to gestational age (r = 0.693; p < 0.001) and 48% of sequences from preterm neonates (gestational age, 25–29 wk) had no N nucleotides between DH and JH. This percentage decreased to 30% after normal intrauterine development until term.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 2. NDN region length is developmentally controlled. A, The NDN region lengths of DNA rearrangements isolated from cord blood lymphocytes of preterm and term neonates are shown in relation to their gestational age. Each data point represents the mean NDN region length of an individual neonate calculated from 20 to 30 different rearrangements. Lines represent regression line (r = 0.556, p < 0.001) and 95% confidence limits. B, The NDN region lengths of DNA rearrangements ({blacktriangleup}) and IgG transcripts ({triangleup}) isolated from PBL of preterm infants are shown in relation to their postconceptional age (gestational age + postnatal age). Lines represent the regression line and 95% confidence limits from A to facilitate comparison.

 
After extrauterine development, NDN region length of preterm infants at their expected date of delivery (22 ± 2 nt) was the same as in term neonates (Fig. 2GoB) and the percentage of sequences without N addition between DH and JH (34%) was not reduced. There was no difference in the NDN region length when IgG transcripts were compared with DNA rearrangements (Fig. 2GoB). In conclusion, the increase in NDN region length until term was not influenced by Ag exposure but rather was developmentally controlled.

The IgM and IgG repertoire in cord blood lymphocytes

To study the IgM and IgG repertoires, RNA was isolated from cord blood. Cord blood lymphocytes of preterm neonates (gestational age, 25–27 wk) expressed a diverse IgM repertoire and 78% of the IgM transcripts were different VHDHJH rearrangements (Table IGo). In contrast, among 23 IgG sequences isolated from the cord blood of three preterm neonates, only four different VHDHJH rearrangements were found (Table IIIGo): in neonate a34a, one VH 5–51 rearrangement was found 3 times, in neonate a42a one VHDHJH rearrangement was isolated 12 times, a second one 6 times, and in neonate a41a, a VH 4–30.4 rearrangement was found 2 times. The repeated finding of identical VHDHJH rearrangements suggests that only a few B cells that switched to IgG were present in the cord blood of preterm neonates.


View this table:
[in this window]
[in a new window]
 
Table III. IgG repertoire in the cord blood of preterm and term neonates

 
All IgG transcripts were unmutated and had short NDN regions with little N region diversity (Table IIIGo). In particular, N nucleotides were missing between the DH segment and JH gene segment. Sequences without N addition often had short overlapping sequences between DH and JH. For example, from PBL of neonate a42, nine different IgG rearrangements were sequenced (sample a42b). In six of the seven sequences without N addition, an overlap of one to three nucleotides was observed. These characteristics indicate that the IgG transcripts were from neonatal cells and not a contamination with maternal cells.

Similarly, a diverse IgM repertoire, but only a few IgG transcripts were isolated from cord blood lymphocytes of term neonates (gestational age, 36–39 wk). From each of two neonates (c38a and c39a), eight sequences were analyzed and in both cases only two different VHDHJH rearrangements were seen (Table IIIGo). From a third neonate (c43a), 35 IgG transcripts were sequenced, but only 13 different VHDHJH rearrangements were found (Table IIGo). In the IgG transcripts of the term neonates, the NDN regions were longer and N insertions between DH and JH occurred more frequently than in the sequences from the preterm neonates. Nevertheless, their overall characteristics were those of a neonatal repertoire.

Taken together, these results demonstrated that a diverse IgM repertoire already existed at the end of the second trimester of gestation. However, there were only a few IgG transcripts in cord blood, suggesting that class switch occurred only sporadically during intrauterine development.

Ag exposure induced class switch

The exposure to extrauterine Ags induced an immune response with class switch in preterm neonates and their IgG repertoire increased rapidly with postnatal age. Whereas in the cord blood of the infant a42 (gestational age, 27 wk), only 2 (11%) among 18 IgG transcripts were different VHDHJH rearrangements, already 15 days after birth (sample a42b) a much more heterogeneous IgG repertoire was detectable with 8 different rearrangements among a total of 13 sequences (61%). When another blood sample (a42 day) of the same baby was analyzed 14 wk after birth, a further increase in the diversity of the IgG repertoire was seen with 23 (92%) different sequences of 25 (Table IIGo).

This rapid increase in the diversity of the IgG repertoire estimated from the percentage of different sequences was confirmed by gene scan analysis of RNA from these three postnatal blood samples of neonate a42. In the cord blood gene scan, there was one single peak. Already in the sample 15 days after birth a oligoclonal length distribution was seen and in the sample 14 wk after birth further diversification was detectable with a polyclonal length spectrum that was normally distributed (Fig. 3Go). Comparable results were found when the RNA samples of baby a41 were spectratyped (data not shown).



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 3. Exposure to environmental Ags induces diversification of the IgG repertoire. The spectratypes (GENESCAN) show the length distribution of IgG transcripts of the preterm neonate a42 (gestational age, 27 wk) isolated from cord blood (A), from peripheral blood at a postnatal age of 15 days (B), and of 14 wk (C). The x-axis depicts the length of the amplified fragments (nucleotides), the y-axis the intensity of the bands detected on the gel (arbitrary units). The infant had a culture-proven sepsis with group B streptococci in the first week of life and three episodes of clinically suspected sepsis between weeks 2 and 14 of life.

 
The close relationship between IgG diversification and the duration of exposure to environmental Ags was also confirmed when the percentages of different rearrangement in the postnatal blood samples were plotted against postnatal age: this percentage increased linearly with postnatal age from 35% at birth (gestational age, 27 wk) to 80% at 14 wk of postnatal age, corresponding to a postconceptional age of 40 wk (r = 0.768, p < 0.016; Fig. 4Go).



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 4. Interclonal diversity of IgG transcripts increased with postnatal age. Shown is the correlation between the diversity of IgG transcripts of preterm neonates and their postnatal age (•). Diversity was estimated by calculating the percentage of transcripts with different VHDHJH rearrangements. For comparison, the diversity of the IgG repertoires in cord blood lymphocytes of term neonates is given ({blacktriangleup}). Each data point represents an individual neonate; between 3 and 25 sequences per neonate were available for analysis (Table IIGo). The number of sepsis episodes each neonate had encountered between birth and the collection of the blood sample is provided for each data point.

 
Ag exposure induced somatic mutations with evidence of Ag selection

The mutational frequency in VH rearrangements isolated from cord blood lymphocytes of both preterm and term neonates was low (Table IGo). IgG transcripts in cord blood of term neonates were also practically unmutated, 65% had no nucleotide exchange, 5 sequences had single nucleotide exchanges, and no sequence had >1 exchange. Thus, it is most likely that these substitutions are errors introduced by the Taq polymerase or polymorphisms, rather than somatic mutations.

A different result was found in PBL of preterm neonates after birth. The mutational frequency in IgG transcripts was closely related to the duration of exposure to extrauterine Ags (Fig. 5Go). It increased from 0% at birth (gestational age, 27 wk) to 0.6–0.9% after 12–14 wk postnatal age, corresponding to a postconceptional age of 39–41 wk (r = 0.897; p = 0.002).



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 5. The frequency of somatic mutations increased with postnatal age. Shown is the correlation between mutational frequency calculated from the number of nucleotide exchanges in CDR2 and FR3 and postnatal age. For this figure, the same set of IgG transcripts was used as described in Fig. 4Go.

 
In preterm infants at their expected date of delivery, the mutational frequency in IgG transcripts was clearly higher than in DNA rearrangements or IgM transcripts (0.60 vs 0.27% or 0.30%, respectively; Table IGo). Fifteen percent of the IgG transcripts had three or more nucleotide exchanges per sequence. Nucleotide exchanges in IgG transcripts of these preterm infants showed the characteristics of Ag-selected somatic mutations (16): they were more frequent in CDR2 (mutational frequency, 0.91%) than in FR3 (mutational frequency, 0.47) and in CDR2 replacement mutations dominated (ratio of replacement:silent mutation, 20:1). In one preterm neonate at term (a34b), five clonally related IgG transcripts with an identical NDN region but a different pattern of three to six somatic mutations were found. Clonal expansion of B cells and Ag-selected somatic mutations are typical results of germinal center reactions.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Comparing the IgH chain gene diversity of preterm neonates exposed to environmental Ags throughout the last trimester of gestation with that of term neonates offered a unique opportunity to study the effects of environmental Ags on the development of the IgH chain gene repertoire in individuals of the same maturational stage. To obtain a representative picture of VH region gene rearrangements without bias from B cells at different activation status, an analysis of genomic DNA was performed. In addition, the expressed mRNA was analyzed to distinguish between the IgM and the IgG repertoire. Otherwise, the small, but relevant subset of IgG-expressing B cells might be overlooked within the predominant IgM-expressing B cell population of neonates (17).

This study presents three novel observations about the evolution of the IgH chain gene repertoire during early human development: 1) Premature exposure to extrauterine environmental Ags did not result in a more adult-like pattern of gene segment usage. 2) During normal intrauterine development class switch occurred only in a few B cells and the observed IgG rearrangements were unmutated. 3) Exposure of preterm neonates to environmental Ags induced class switch and somatic mutations within 2 wk of postnatal life and resulted in a heterogeneous population of IgG-expressing B cells. The pattern of somatic mutations suggested Ag selection.

Restrictions in the neonatal VH, DH, and JH gene segment utilization persisted despite Ag exposure

In neonates, VH gene segments from across the entire locus were used in a frequency pattern similar to the one seen in adults, suggesting that proximity of the VH gene segment to the DH locus seems to play a much more limited role in rearrangement bias in humans than in mice (9, 18, 19). Furthermore, the IgG and the IgM repertoire showed a similar VH gene segment usage. This preponderance of gene locus inherent characteristics over environmental factors on the pattern of VH gene expression is in line with the finding that in mice transgenic for part of the human Ig locus, the VH gene segment usage was similar to that in human adults (20).

Early in gestation proximity between DH and JH gene segments in the genome favors rearrangement of the DH7 family and JH1, JH2, and JH3 (8). With increasing fetal maturity, the importance of proximity decreases but still plays a role in neonates at term who favor the DH6, DH7 families and JH3, JH4, whereas in adults DH2, DH3 families and JH6 are preferably used (9, 21). We found that Ag exposure did not accelerate these developmental trends in the repertoire.

Restrictions in NDN region length persisted despite Ag exposure

The length of the NDN region increased during normal intrauterine development. However, this prolongation was not accelerated by premature exposure to environmental Ags. Instead, the NDN length seemed to be developmentally controlled by a stepwise activation of TdT activity during fetal life.

Sequences without N addition between DH and JH often had short overlapping sequences. Thus, the absence of N regions between DH and JH gene segments decreases diversity not only by the absence of randomly inserted nucleotides, but also because it favors rearrangements between gene segments that share short sequence homologies (22).

The IgM and IgG repertoire during intrauterine development

The analysis of rearrangement length diversity with "spectratyping" demonstrated highly variable IgM transcripts already in fetal liver (23). In support of these spectratyping results, we found that 78–100% of the IgM transcripts and of the DNA rearrangements isolated from cord blood lymphocytes had different NDN region sequences. This indicates that the establishment of a diverse primary repertoire in humans occurs early in gestation independent of exogenous Ags. In agreement with previous results (24, 25, 26), the frequency of somatic mutations in DNA rearrangements and IgM transcripts in cord blood was consistently low and the nucleotide exchanges were randomly distributed.

IgG transcripts could be detected as early as 27 wk of gestation, but the IgG repertoire seemed to be markedly restricted, as most of the isolated IgG transcripts had identical VHDHJH rearrangements. These IgG transcripts were not due to contamination with maternal cells for two reasons. First, they had no N insertions between DH and JH, which is a characteristic feature of the human fetal VH region gene repertoire, and, second, they were unmutated. The diversity of the IgG repertoire remained low throughout normal intrauterine development.

During the third trimester of gestation, peripheral lymph nodes complete the development of their basic primary structure (27). After normal intrauterine development germinal centers are absent in the human fetus (28). Nevertheless, in the cord blood of preterm neonates, IgG sequences were found, although unmutated. Thus, it seems that in human neonates switch recombination may take place before the development of germinal centers. It is known that class switch and hypermutation are independently regulated (29) and that, in KO mice unable to form germinal centers, class switch can occur although at a lower frequency but that these class-switched rearrangements are unmutated (30).

Studies in Ag-deprived environments have previously only been made in animals, but point in the same direction as our findings during intrauterine development. In mice living in a sterile environment and consuming an ultrafiltered low Ag diet (germfree Ag-free mice), IgM levels were nearly normal and the IgM repertoire showed a normal diversity. But levels of circulating IgG and IgA were profoundly depressed and peripheral lymph nodes and mucosal lymphoid tissue were smaller than in conventionally housed animals (31, 32).

In conclusion, in human neonates class switch during intrauterine development is a sporadic event throughout gestation without evidence of Ag-driven or developmentally driven expansion of class-switched cells.

Evolution of class-switched IgG rearrangements during Ag exposure

The population of class-switched B cells rapidly expanded after preterm birth and hence with exposure to extrauterine environmental Ags from nutrition, from the developing gut microflora, and from infectious pathogens. The finding of heterogeneous, somatically mutated IgG sequences as early as 14 days after premature birth suggests that already early in the third trimester of gestation the immune system of the neonate is sufficiently developed to respond to an external antigenic stimulus. The findings of somatic mutations with evidence of Ag selection and of clonally related sequences are hallmarks of the germinal center reaction (33, 34). The knowledge of the development of the IgG memory B cell population in infancy is still incomplete. We observed an increasing heterogeneity of IgG rearrangements within 12 wk but these rearrangements were very different from IgG later in life because they had short NDN regions and a low frequency of somatic mutations (0.68%). Already in early childhood the frequency of somatic mutations has increased to 3.2% (35).

In conclusion, these data show that VH region gene diversity is mainly developmentally regulated. It evolves without stimulation by non-self-Ags until term and repertoire restrictions persist despite premature contact with exogenous Ags. However, premature exposure to Ag accelerates the development of the functional immune system. Preterm infants exposed to environmental Ags develop a polyclonal population of IgG-expressing memory B cells that are not found after normal intrauterine development. Thus, restrictions in the VH region gene repertoire, in particular in the diversity of the CDR3 region rather than functional defects of the B cells, seem to be responsible for the poor immune responses often described for the neonate.


    Acknowledgments
 
We thank W. Jekabsons, I. Gläser, H. H. Müller, and H. Lammert for the excellent technical assistance.


    Footnotes
 
1 This work was supported by Deutsche Forschungsgemeinschaft (Grant BA1187/6-1) and by a scholarship from the Humboldt Foundation (FLF 1071857). The Deutsche Rheuma ForschungsZentrum is supported by the Berlin Senate of Research and Education. Back

2 Address correspondence and reprint requests to Dr. Karl Bauer, Department of Pediatrics, Freie Universität Berlin, Hindenburgdamm 30, 12200 Berlin, Germany. E-mail address: karl.bauer{at}medizin.fu-berlin.de Back

3 Abbreviation used in this paper: FR, framework region. Back

Received for publication January 29, 2002. Accepted for publication May 21, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kabat, E. A., T. T. Wu. 1991. Identical V region amino acid sequences and segments of sequences in antibodies of different specificities: relative contributions of VH and VL genes, minigenes, and complementarity-determining regions to binding of antibody-combining sites. J. Immunol. 147:1709.[Abstract]
  2. Stewart, K. A., R. Schwartz. 1994. Immunoglobulin V regions and the B cell. Blood 83:1717.[Abstract/Free Full Text]
  3. Corbett, S. J., I. M. Tomlinson, E. L. L. Sonnhammer, D. Buck, G. Winter. 1997. Sequence of the human Ig diversity segment locus: a systematic analysis provides no evidence for the use of DIR segments, inverted D segments, "minor" D segments or D-D recombination. J. Mol. Biol. 270:587.[Medline]
  4. Feeney, A. J.. 1990. Lack of N regions in fetal and neonatal mouse immunoglobulin V-D-J junctional sequences. J. Exp. Med. 172:1377.[Abstract/Free Full Text]
  5. Yancopoulos, G. D., S. V. Desiderio, M. Paskind, J. F. Kearney, D. Baltimore, F. W. Alt. 1984. Preferential utilisation of the most JH-proximal VH gene segments in pre-B cell lines. Nature 311:727.[Medline]
  6. Sanz, I.. 1991. Multiple mechanisms participate in the generation of diversity of human H chain CDR3 regions. J. Immunol. 147:1720.[Abstract]
  7. Schroeder, H. W., F. Mortari, S. Shiokawa, P. M. Kirkham, R. A. Elgavish, III F. E. Bertrand. 1995. Developmental regulation of the human antibody repertoire. Ann. NY Acad. Sci. 764:242.[Medline]
  8. Shiokawa, S., F. Mortari, J. O. Lima, C. Nunez, III F. E. Bertrand, P. M. Kirkham, S. Zhu, A. P. Dasanayake, H. W. Schroeder. 1999. IgM heavy chain complementarity determining region 3 diversity is constrained by genetic and somatic mechanisms until two months after birth. J. Immunol. 162:6060.[Abstract/Free Full Text]
  9. Zemlin, M., K. Bauer, M. Hummel, S. Pfeiffer, D. Devers, C. Zemlin, H. Stein, H. Versmold. 2001. The diversity of rearranged immunoglobulin heavy chain variable region genes in peripheral blood B cells of preterm infants is restricted by short third complementary determining regions but not by limited gene usage. Blood 97:1511.[Abstract/Free Full Text]
  10. Siegrist, C. A.. 2001. Neonatal and early life vaccinology. Vaccine 19:3331.[Medline]
  11. Jr Schroeder, H. W., L. Zhang, III J. B. Philips. 2001. Slow, programmed maturation of the immunoglobulin HCDR3 repertoire during the third trimester of fetal life. Blood 98:2745.[Abstract/Free Full Text]
  12. Marafioti, T., M. Hummel, I. Anagnostopoulos, H. D. Foss, B. Falini, G. Delsol, P. G. Isaacson, S. Pileri, H. Stein. 1997. Origin of nodular lymphocyte-predominant Hodgkin’s disease from a clonal expansion of highly mutated germinal-center B cells. N. Engl. J. Med. 337:453.[Abstract/Free Full Text]
  13. Sims, G. P., H. Shiono, N. Willcox, D. I. Stott. 2001. Somatic hypermutation and selection of B cells in thymic germinal centers responding to acetylcholine receptor in myasthenia gravis. J. Immunol. 167:1935.[Abstract/Free Full Text]
  14. Schröder, A. E., A. Greiner, C. Seyfert, C. Berek. 1996. Differentiation of B cells in the nonlymphoid tissue of the synovial membrane of patients with rheumatoid arthritis. Proc. Natl. Acad. Sci. USA 93:221.[Abstract/Free Full Text]
  15. Tomlinson, I. M., S. C. Williams, O. Ignatovic, S. J. Corbett, and G. Winter. 1998. VBASE sequence directory. http://www.mrc-cpe.cam.ac.uk/imt-doc/public/INTRO.html. Medical Research Council Centre for Protein Engineering, Cambridge, U.K.
  16. Weigert, M.. 1986. The influence of somatic mutation on the immune response. Prog. Immunol. VI:138.
  17. Heldrup, J., O. Kalm, K. Prellner. 1992. Blood T and B lymphocyte subpopulations in healthy infants and children. Acta Paediatr. 81:125.[Medline]
  18. Malynn, B. A., G. D. Yancopoulos, J. E. Barth, C. A. Bona, F. W. Alt. 1990. Biased expression of JH-proximal VH genes occurs in the newly generated repertoire of neonatal and adult mice. J. Exp. Med. 171:843.[Abstract/Free Full Text]
  19. Pascual, V., L. Verkruyse, M. L. Casey, D. J. Capra. 1993. Analysis of the IgH chain gene segment utilization in human fetal liver. J. Immunol. 151:4164.[Abstract]
  20. Gallo, M. L., V. E. Ivanov, A. Jakobovits, C. G. Davis. 2000. The human immunoglobulin loci introduced into mice: V, D, and J gene segment usage similar to that of adult humans. Eur. J. Immunol. 30:534.[Medline]
  21. van Dijk-Härd, I., I. Söderström, D. Holmberg, I. Lundkvist. 1997. Age-related impaired affinity maturation and differential D-JH gene usage in human VH6 expressing B lymphocytes from healthy individuals. Eur. J. Immunol. 27:1381.[Medline]
  22. Feeney, A. J.. 1992. Predominance of VH-D-JH junctions occurring at sites of short sequence homology results in limited junctional diversity in neonatal antibodies. J. Immunol. 149:222.[Abstract]
  23. Raaphorst, F. M., J. Tami, I. E. Sanz. 1996. Cloning of size selected human immunoglobulin heavy chain rearrangements from third complementary determining region fingerprint profiles. BioTechniques 20:78.[Medline]
  24. Ridings, J., I. C. Nicholson, W. Goldsworthy, R. Haslam, D. M. Roberton, H. Zola. 1997. Somatic hypermutation of immunoglobulin genes in human neonates. Clin. Exp. Immunol. 108:366.[Medline]
  25. Mortari, F., J. Y. Wang, H. W. Schroeder. 1993. Human cord blood antibody repertoire: mixed population of VH gene segments and CDR3 distribution in the expressed C{alpha} and C{gamma} repertoires. J. Immunol. 150:1348.[Abstract]
  26. Van Es, J. H., F. H. J. Gmelig Meyling, T. Logtenberg. 1992. High frequency of somatically mutated IgM molecules in the human adult blood B cell repertoire. Eur. J. Immunol. 22:2761.[Medline]
  27. Kyriazis, A. A., J. R. Esterly. 1971. Fetal and neonatal development of lymphoid tissues. Arch. Pathol. 91:1444.
  28. Asano, S., Y. Akaike, T. Muramatsu, M. Mochizuki, T. Tsuda, H. Wakasa. 1993. Immunohistologic detection of the primary follicle in human fetal and newborn lymph node anlages. Pathol. Res. Pract. 189:921.[Medline]
  29. Manser, T.. 1989. Evolution of antibody structure during the immune response: the differentiative potential of a single B lymphocyte. J. Exp. Med. 170:1211.[Abstract/Free Full Text]
  30. Wang, Y., G. Huang, J. Wang, H. Molina, D. D. Chaplin, Y. X. Fu. 2000. Antigen persistence is required for somatic mutation and affinity maturation of immunoglobulin. Eur. J. Immunol. 30:2226.[Medline]
  31. Haury, M., A. Sundblad, A. Grandien, C. Barreau, A. Coutinho, A. Nobrega. 1997. The repertoire of serum IgM in normal mice is largely independent of external antigenic contact. Eur. J. Immunol. 27:1557.[Medline]
  32. Hooijkas, H., R. Benner, J. R. Plesants, B. S. Wostman. 1994. Isotypes and specificities of immunoglobulins produced by germ-free mice fed chemically defined ultrafiltrated "antigen-free" diet. Eur. J. Immunol. 14:1127.
  33. Jacob, J., G. Kelsoe, K. Rajewsky, U. Weiss. 1991. Intraclonal generation of antibody mutants in germinal centres. Nature 354:389.[Medline]
  34. Berek, C., A. Berger, M. Apel. 1991. Maturation of the immune response in germinal centers. Cell 67:1121.[Medline]
  35. Klein, U., R. Küppers, K. Rajewsky. 1997. Evidence for a large compartment of IgM-expressing memory B cells in humans. Blood 89:1288.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
JEMHome page
S. Weller, M. Mamani-Matsuda, C. Picard, C. Cordier, D. Lecoeuche, F. Gauthier, J.-C. Weill, and C.-A. Reynaud
Somatic diversification in the absence of antigen-driven responses is the hallmark of the IgM+IgD+CD27+ B cell repertoire in infants
J. Exp. Med., June 9, 2008; 205(6): 1331 - 1342.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. G. Tangye and K. L. Good
Human IgM+CD27+ B Cells: Memory B Cells or "Memory" B Cells?
J. Immunol., July 1, 2007; 179(1): 13 - 19.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
A. F. Carlin, A. L. Lewis, A. Varki, and V. Nizet
Group B Streptococcal Capsular Sialic Acids Interact with Siglecs (Immunoglobulin-Like Lectins) on Human Leukocytes
J. Bacteriol., February 15, 2007; 189(4): 1231 - 1237.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Zemlin, G. Hoersch, C. Zemlin, A. Pohl-Schickinger, M. Hummel, C. Berek, R. F. Maier, and K. Bauer
The Postnatal Maturation of the Immunoglobulin Heavy Chain IgG Repertoire in Human Preterm Neonates Is Slower than in Term Neonates
J. Immunol., January 15, 2007; 178(2): 1180 - 1188.
[Abstract] [Full Text] [PDF]


Home page
Arch. Dis. Child.Home page
J Bonhoeffer, C-A Siegrist, and P T Heath
Immunisation of premature infants
Arch. Dis. Child., November 1, 2006; 91(11): 929 - 935.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
P. Henneke and R. Berner
Interaction of neonatal phagocytes with group B streptococcus: recognition and response.
Infect. Immun., June 1, 2006; 74(6): 3085 - 3095.
[Full Text] [PDF]


Home page
J. Immunol.Home page
S. Kenzel, G. Mancuso, R. Malley, G. Teti, D. T. Golenbock, and P. Henneke
c-Jun Kinase Is a Critical Signaling Molecule in a Neonatal Model of Group B Streptococcal Sepsis.
J. Immunol., March 1, 2006; 176(5): 3181 - 3188.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. M. Souto-Carneiro, G. P. Sims, H. Girschik, J. Lee, and P. E. Lipsky
Developmental Changes in the Human Heavy Chain CDR3
J. Immunol., December 1, 2005; 175(11): 7425 - 7436.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. P. Sims, R. Ettinger, Y. Shirota, C. H. Yarboro, G. G. Illei, and P. E. Lipsky
Identification and characterization of circulating human transitional B cells
Blood, June 1, 2005; 105(11): 4390 - 4398.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
R. J. Bende, W. M. Aarts, R. G. Riedl, D. de Jong, S. T. Pals, and C. J.M. van Noesel
Among B cell non-Hodgkin's lymphomas, MALT lymphomas express a unique antibody repertoire with frequent rheumatoid factor reactivity
J. Exp. Med., April 18, 2005; 201(8): 1229 - 1241.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. R. Kolar, T. Yokota, M. I. D. Rossi, S. K. Nath, and J. D. Capra
Human fetal, cord blood, and adult lymphocyte progenitors have similar potential for generating B cells with a diverse immunoglobulin repertoire
Blood, November 1, 2004; 104(9): 2981 - 2987.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. M. Souto-Carneiro, N. S. Longo, D. E. Russ, H.-w. Sun, and P. E. Lipsky
Characterization of the Human Ig Heavy Chain Antigen Binding Complementarity Determining Region 3 Using a Newly Developed Software Algorithm, JOINSOLVER
J. Immunol., June 1, 2004; 172(11): 6790 - 6802.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bauer, K.
Right arrow Articles by Berek, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bauer, K.
Right arrow Articles by Berek, C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*Substance via MeSH
Medline Plus Health Information
*Premature Babies


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS