| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Department of Pathology and
Division of Infectious Disease, Case Western Reserve University, Cleveland, OH 44106
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(6 h)
dramatically increased types I and IV CIITA mRNA to similar absolute
levels. Type IV CIITA declined over time, but type I was stable for
over 72 h. Thus, the dominant form of CIITA evolved with time
during activation by IFN-, and type I CIITA explained prolonged
expression of MHC-II by macrophages. mRNA half-life was shorter for
type I than type IV CIITA, suggesting that sustained transcription
contributed to stable expression of type I CIITA induced by IFN-.
Splenic B cells expressed mRNA for type III CIITA but very little for
types I or IV. Treatment with IL-4 increased surface expression of
MHC-II protein, but mRNA for MHC-II and CIITA (total, I, III, and IV)
remained unchanged, suggesting posttranslational regulation. Splenic
dendritic cells expressed type I CIITA but little type III or IV; CpG
DNA induced their maturation and decreased types I and III CIITA,
consistent with decreased MHC-II protein synthesis. CIITA types differ
in regulation in various APCs under different stimuli, and the
predominant type of CIITA varies at different stages of APC
activation. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
MHC-II expression in professional APCs is tightly regulated. In the
presence of inflammatory cytokines such as IFN-, macrophages
increase MHC-II expression, and their ability to process Ags to
CD4+ T cells is markedly improved. B cell
maturation into plasma cells is accompanied by a decrease in MHC-II
molecule expression as the focus of the cell shifts from Ag capture and
presentation to Ab production (1). Upon maturation,
dendritic cell expression of MHC-II molecules increases, but MHC-II
mRNA decreases (2, 3); increased MHC-II expression is due
to increased half-life of peptide:MHC-II molecules (2, 4, 5).
MHC-II Ag processing requires expression of MHC-II, invariant chain,
and H2-DM, which are all controlled by the class II transactivator
(CIITA) (6, 7, 8). CIITA-/- mice have
virtually no MHC-II molecules and thus low numbers of
CD4+ T cells, indicating that CIITA is the master
regulator of MHC-II expression (9, 10). CIITA does not
directly bind to the promoter region of the genes it regulates; rather,
it coordinates the action of numerous transcription factors such as
members of the regulatory factor X (RFX) family, NF-Y and CREB
(11, 12, 13, 14). Transcriptional activation of the
CIITA gene occurs through the action of three promoters in
mice (pI, pIII, and pIV) (15). Immediately downstream of
each promoter exists a unique exon 1 that is spliced with the remaining
shared exons to form three different types of CIITA (I, III, and IV)
(Fig. 1
). Translation of CIITA mRNA can
begin in exon 2; however, types I and III CIITA mRNA both contain
translational start sites in exon 1 (giving rise to CIITA molecules
with different N-terminal protein sequences) (16).
|
-treated
macrophages (15). Recently it has become clear that the
restriction of these promoters to different cell types is not so simple
(Fig. 1
). Type III CIITA has been found in human dendritic cells and
monocytes (17), and can be induced by IFN-
(18, 19, 20, 21, 22). In addition, a recent study showed that type I
CIITA is critical in regulating MHC-II transcription in murine
macrophages (23). In this study, we systematically
analyzed expression of different types of CIITA in professional APCs
(macrophages, B cells, and dendritic cells) under conditions that
induce maturation or activation. The primary goal was to solve
uncertainties about the relative roles of different types of CIITA at
different stages of macrophage activation, but we also tested the roles
of different types of CIITA during activation or maturation of B cells
and dendritic cells. Because MHC-II expression is modulated by multiple
stimuli that vary with different APCs, different types of CIITA may
play distinct roles in different stages of response to particular
stimuli. A greater understanding of the relative roles of different
CIITA types will contribute to our understanding of the control of
MHC-II expression under various pathophysiologic conditions. |
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Murine IFN-, IL-4, and GM-CSF were purchased from R&D Systems
(Minneapolis, MN). Phosphorothioate-modified CpG oligodeoxynucleotide
(ODN) 1826 (TCCATGACGTTCCTGACGTT); CpG motifs
are underlined) was provided by Coley Pharmaceutical Group (Wellesley,
MA) and was dissolved in TE buffer (10 mM Tris, 1 mM EDTA).
Cell culture
Unless otherwise specified, all experiments were performed at 37°C in 5% CO2 atmosphere using cells derived from C3H/HeJ (H-2k) female retired breeders (The Jackson Laboratory, Bar Harbor, ME) housed under specific pathogen-free conditions. Macrophages and B cells were cultured in standard medium composed of DMEM (Life Technologies, Rockville, MD) supplemented with 10% heat-inactivated FCS (HyClone Laboratories, Logan, UT), 50 µM 2-ME, 1 mM sodium pyruvate, 10 mM HEPES buffer, and antibiotics. Dendritic cells were cultured in RPMI 1640 (Life Technologies) supplemented with 5% FCS, 50 µM 2-ME, 25 mM HEPES, L-glutamine, 20 µg/ml gentamicin, and 4 ng/ml GM-CSF.
Generation and treatment of bone marrow-derived macrophages (BMM) and thioglycollate-elicited peritoneal macrophages
BMM were derived from bone marrow precursors that were harvested
from femur marrow and differentiated in bacterial grade dishes for 7
days in standard medium supplemented with 20% LADMAC cell conditioned
medium (24). The resultant cells were used during the
following week. The cells were adherent with macrophage-like
morphology, and >98% of the cells were CD11b-positive by flow
cytometry. BMM were removed from Petri dishes with trypsin plus 0.02%
EDTA (Life Technologies). For flow cytometry, BMM were plated at
2–3 x 106 cells/60 mm Petri dish and
cultured with or without 2 ng/ml of IFN- for the indicated time
period. BMM were removed with trypsin plus 0.02% EDTA, counted, and
stained for I-Ak expression. For RT-PCR analysis,
BMM were plated at 4 x 106 cells/60 mm
Petri dish and allowed to rest overnight. The following day BMM were
stimulated with or without the indicated concentrations of IFN- and
removed from the plate with trypsin plus 0.02% EDTA. RNA was isolated,
and RT-PCR analysis was performed. Thioglycollate-elicited peritoneal
exudate cells were harvested 5 days after injection of 1 ml of sterile
3% thioglycollate. Peritoneal exudate cells were plated in bacterial
grade Petri dishes overnight, and nonadherent cells were washed away.
Adherent macrophages were harvested, stimulated, and analyzed as
described above. For mRNA stability studies, BMM were stimulated with
IFN- for 6 h. After 6 h of stimulation, 50 µM
5,6-dichloro-1-
-D-ribosylfuranosylbenzamidazole (DRB)
(Sigma-Aldrich, St. Louis, MO) was added to stop de novo mRNA
synthesis. RNA was isolated at 3, 6, 9, and 12 h after DRB
addition.
Isolation and stimulation of splenic B cells
Naive splenic B cells were purified from whole splenocytes by
negative selection with anti-CD43 microbeads (Miltenyi Biotec,
Auburn, CA). Briefly, spleens were pressed trough a 70-µm cell
strainer (BD Labware, Franklin Lakes, NJ) using the plunger of a 5-ml
syringe. The cell strainer was washed with DMEM and splenocytes were
pelleted at 300 x g. To lyse RBCs, the pellet was
resuspended in 5 ml of ACK lysis buffer (0.15 M
NH4Cl, 10 mM KHCO3, 0.1 mM
Na2EDTA, pH 7.2) per spleen and incubated for 5
min at room temperature. Standard medium was added, and the cells were
pelleted. Resultant splenocytes were treated with anti-CD43
magnetic microbeads, and CD43-negative cells (naive B cells) were
collected according to the manufacturer’s protocol. Flow cytometry
showed that CD43-negative cells expressed little or no TCR -chain or
Mac-1, but >95% of the cells expressed the B cell marker, B220. For
analysis of I-Ak expression, 4 x
106 B cells were plated in a 60-mm Petri dish and
incubated with or without 10 ng/ml IL-4 for 24 h. Cells were
harvested by gentle scraping and stained for
I-Ak. For RT-PCR analysis, freshly purified B
cells were plated at 1 x 107 cells/100-mm
Petri dish, stimulated with IL-4 for 12 h, harvested as above, and
used to isolate RNA.
Isolation and stimulation of dendritic cells
Dispersed splenocytes were generated by digesting spleen fragments with 150 U/ml collagenase (Worthington Biochemical, Lakewood, NJ) and 30 U/ml DNase (Sigma-Aldrich) for 1 h at 37°C and passing the digest through a 70-µm cell strainer (BD Labware). RBC were lysed with ACK lysis buffer (as above). Cells were layered over Ficoll-Paque (Amersham Pharmacia, Piscataway, NJ) and centrifuged to isolate viable cells. CD11c+ cells were then purified using anti-CD11c microbeads (Miltenyi Biotec) according to the manufacturer’s protocol. Flow cytometry showed that >80% of the resulting cells expressed high levels of CD11c. Immediately after purification, some splenic dendritic cells were harvested for RNA preparation. Other dendritic cells were incubated for 18 h in 100-mm Petri dishes (9 x 106 cells/dish) with 4 ng/ml GM-CSF (R&D Systems) with or without 1 µg/ml of CpG ODN 1826. Cells were collected by gentle scraping, and RNA was isolated. Bone marrow-derived dendritic cells were prepared as described (2), except that cells were harvested after 5 days of culture with GM-CSF (4 ng/ml) and dendritic cells were then purified by positive selection with anti-CD11c magnetic beads, as described above for splenic dendritic cells. Greater than 90% of the purified dendritic cells expressed high levels of CD11c by flow cytometry.
Detection of I-Ak by flow cytometry
Cells (2 x 105) were incubated with 10 µg/ml FcBlock (anti-CD16/CD32; BD PharMingen, San Diego, CA) in PBS containing 1% FBS and 10% normal mouse serum. Cells were then stained with biotinylated 10.3.6-2 anti-I-Ak or biotinylated IgG2a isotype control Ab (BD PharMingen) at 5 µg/ml. Cells were washed, incubated with streptavidin-CyChrome (1:100; BD PharMingen), washed, and resuspended in 2% paraformaldehyde. Stained cells were analyzed with a FACScan flow cytometer (BD Immunocytometry Systems, San Jose, CA).
RNA purification, cDNA synthesis, and real-time quantitative PCR
Cells were lysed with a QiaShredder (Qiagen, Valencia, CA), and
total cellular RNA was purified from lysates using the RNeasy kit
(Qiagen) according to the manufacturer’s instructions. Residual
genomic DNA was removed during the purification process by incubation
with RNase-free DNase (Qiagen). RNA was stored in RNase free water
(Qiagen) at -80°C. RNA (1 µg) was converted to cDNA using the
SuperScript preamplification system (Life Technologies) for
first-strand cDNA synthesis. The cDNA mixture was diluted 1/5 with PCR
grade water. Ten percent (10 µl) of the cDNA product was used per
reaction for real-time quantitative PCR using a high-speed thermal
cycler (LightCycler; Roche Diagnostics, Indianapolis, IN), and the
product was detected by FastStart Master SYBR Green I (Roche Molecular
Biochemicals, Indianapolis, IN) according to the manufacturer’s
instructions. The amplification cycle was 95°C for 15 s, 50°C
for 5 s (57°C for GAPDH primers), and 72°C for 20 s. The
CIITA and MHC-II primers were designed using OLIGO v6.4 (Molecular
Biology Insights, Cascade, CO). The GAPDH primer sequences were as
published (25). The sequences for the primers are as
follows. GAPDH: sense 5'-AACGACCCCTTCATTGAC-3' and antisense
5'-TCCACGACATACTCAGCAC-3' (predicted size = 191 bp). MHC-II
(I-Ak -chain): sense 5'-GCGACGTGGGCGAGTACC-3'
and antisense 5'-CATTCCGGAACCAGCGCA-3' (predicted size = 276
bp). Total CIITA mRNA: sense 5'-ACGCTTTCTGGCTGGATTAGT-3' and antisense
5'-TCAACGCCAGTCTGACGAAGG-3' (predicted size = 342 bp).
Antisense primer for types I, III, and IV CIITA:
5'-GGTCGGCATCACTGTTAAGGA-3'. Sense primer type I CIITA:
5'-AAGAGCTGCTCTCACGGGAAT-3' (predicted size = 264 bp). Sense
primer type III CIITA: 5'-TCTTACCTGCCGGAGTT-3' (predicted size
= 100 bp). Sense primer type IV CIITA: 5'-GAGACTGCATGCAGGCAGCA-3'
(predicted size = 129 bp). All ODN were purchased from Life
Technologies. Specific cDNA was quantified with a standard curve based
on known amounts of product. Standards were generated by purification
of amplified cDNA product from an agarose gel using a QiaQuick gel
extraction kit (Qiagen). Melting curve analysis confirmed that only one
product was amplified. Further confirmation of specificity was
conducted by amplification of cDNA from whole splenocytes using the
primers listed above, centrifugation of capillaries to obtain PCR
products, electrophoresis of products through a 1.5% agarose gel, and
staining with ethidium bromide. In all cases, there was only one
product observed with each primer set, and the observed product had an
amplicon size that matched the size predicted from published cDNA
sequences.
Calculations
Normalized copy number = (copy number of mRNA of interest/copy number of GAPDH) x 1000. Fold induction = (normalized copy number of treated cells)/(normalized copy number of untreated cells). The half-lives of types I and IV CIITA were calculated using linear least squares to determine the best-fit line of log2 (normalized CIITA copy number) plotted vs time after DRB addition. The slope (m) was used to calculate the half-life of types I and IV CIITA mRNA expression after addition of DRB (t1/2 = -log2(2)/m = -1/m).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
induces expression of MHC-II and CIITA in BMM
MHC-II expression by macrophages is not constitutive and depends
on activating stimuli, e.g. IFN-. Because macrophage activation is
complex and affected by multiple factors or stimuli, the relative roles
of different CIITA types in MHC-II induction may vary with different
stimuli or stages of activation. To assess these issues, BMM were
stimulated with IFN-, and I-Ak expression was
determined by flow cytometry. Unstimulated BMM expressed little MHC-II
protein, but after IFN- treatment for 24 h, cell surface
expression of MHC-II increased dramatically (Fig. 2A). MHC-II expression was
monitored over time in IFN--treated cells; MHC-II expression was
near maximum by 48 h (Fig. 2B). The induction of mRNA
for MHC-II and CIITA in BMM treated with IFN- was analyzed by
real-time quantitative RT-PCR (Fig. 2C). Induction of CIITA
(any measurement of CIITA refers to mRNA levels as CIITA protein was
not analyzed) was consistently observed after 6 h of IFN-
treatment and remained relatively constant for 24 h. As expected,
kinetic studies showed that induction of CIITA preceded induction of
MHC-II mRNA. Induction of MHC-II mRNA was evident at 12 h, and
levels increased during the next 12 h.
|
, but types I
and IV are the most abundant
Different type-specific primer pairs were used to detect types I,
III, and IV CIITA by real-time RT-PCR. A common antisense primer
located in exon 2 was used in conjunction with type-specific sense
primers located in different first exons of types I, III, and IV CIITA
(Fig. 3A). To confirm the
specificity and sensitivity of this approach, types I, III, and IV
CIITA were amplified from splenocyte cDNA; in all cases, the size of
the amplicon corresponded to the size predicted from the mRNA sequence
(Fig. 3B).
|
(Fig. 4). All three types of
CIITA were induced by IFN-, but type IV CIITA showed the greatest
relative enhancement (Fig. 4A). Type IV CIITA was
consistently induced 60- to 80-fold with 2 ng/ml IFN-, whereas types
I and III CIITA were induced only 6- to 8-fold. Although type IV was
increased by a greater factor than type I CIITA by 6 h of IFN-
treatment, the absolute levels of the two types were similar at 2–10
ng/ml IFN-, due to the higher baseline level of type I CIITA
(without IFN-, the absolute level of type I CIITA was nine times
greater than type IV; Fig. 4B). Even though type III CIITA
was induced by IFN-, it was present in such low amounts that it did
not contribute substantially to total CIITA expression (Fig. 4, A and B; the absolute levels of type III CIITA
were so low that the bars are not visible above the x-axis
in Fig. 4B). In summary, unstimulated BMM expressed low
levels of type I CIITA and almost undetectable levels of type IV CIITA,
but stimulation with IFN- for 6 h increased both types I and IV
CIITA to high levels.
|
(Fig. 4C). After 6 h of IFN- treatment the
amounts of types I and IV CIITA were similar. From 6 to 24 h, type
I CIITA remained constant or continued to increase over time, whereas
type IV CIITA declined slightly. We conclude that types I and IV
CIITA were both increased in BMM by IFN-. The suggestion that
type I CIITA was expressed more stably was pursued in additional
kinetic experiments. Kinetic differences in expression of types I and IV CIITA
Waldburger et al. (23) demonstrated that
thioglycollate-elicited macrophages from pIV-/-
and pIV+/- mice had equivalent surface
expression of MHC-II after 72 h of IFN- treatment.
Additionally, they showed that after 72 h of IFN- treatment,
both pIV-/- and pIV+/-
macrophages expressed mostly type I CIITA; even
pIV+/- macrophages expressed little type IV
CIITA. The results obtained by Waldburger et al. (23)
differ from our observation that types I and IV CIITA are both induced
by IFN-, but their experiments examined different cells (peritoneal
macrophages) at a different time point (72 h). To resolve this
difference, we examined responses of both BMM and
thioglycollate-elicited peritoneal macrophages to IFN- at 6–72 h.
Expression of MHC-II protein was induced similarly in both BMM and
peritoneal macrophages by treatment with IFN- for 24 h (Fig. 5, A and B). RT-PCR
analysis showed differences in the kinetics of type I vs type IV CIITA
expression induced by IFN-. At 6 h, IFN- induced similar
levels of types I and IV CIITA in both BMM and peritoneal macrophages
(Fig. 5C). However, after 72 h of exposure to IFN-,
type IV CIITA declined in both cell populations while type I CIITA
remained constant (Fig. 5C). We conclude that IFN-
induces prolonged expression of type I CIITA but only transient
expression of type IV CIITA.
|
A difference in mRNA stability could explain the persistence of
mRNA for type I CIITA and the disappearance of type IV CIITA over a
72-h period (i.e., mRNA for type I CIITA could have a longer half-life
than mRNA for type IV CIITA). To address this hypothesis, BMM were
stimulated with IFN- for 6 h, at which time mRNA synthesis was
inhibited by the addition of 50 µM DRB. The stability of existing
mRNA for types I and IV CIITA was determined by real-time RT-PCR of
samples taken at various time points after addition of DRB (Fig. 6). Type I CIITA
(t1/2 = 3.5 h) actually
had a shorter half-life than type IV CIITA
(t1/2 = 7.8 h), contrary
to the above hypothesis. Thus, the high amount of type I CIITA mRNA
observed after treatment with IFN- for 72 h cannot be explained
by a long half-life, suggesting that continued transcription of mRNA
for type I CIITA contributes to its sustained expression.
|
In contrast to macrophages, B cells constitutively express MHC-II
even without stimulation, but the level of MHC-II protein expressed by
B cells can be modulated by certain stimuli. IL-4 increases expression
of MHC-II protein on B cells, but the mechanism by which this occurs is
unclear (26, 27). We purified B cells from whole
splenocytes by negative selection with anti-CD43 magnetic
microbeads. Greater than 95% of CD43-negative cells expressed B220, a
marker for B cells, and there was little or no staining for CD11b
(Mac-1) and TCR -chain. B cells were incubated with or without IL-4
for 24 h, and I-Ak expression was measured
by flow cytometry. B cells expressed MHC-II protein in the absence of
any stimulation, but treatment with IL-4 led to a 4-fold increase in
MHC-II protein expression (Fig. 7A). We tested whether IL-4
increased MHC-II expression by increasing CIITA mRNA levels in B cells.
Purified B cells were treated with or without IL 4, and quantitative
real-time RT-PCR was used to measure mRNA for MHC-II, total CIITA, and
types I, III, and IV CIITA. B cells constitutively expressed large
quantities of type III CIITA, a small amount of type IV and very little
type I. Treatment of B cells with IL-4 for 12 h did not affect
levels of mRNA for MHC-II, total CIITA, or type I, III, or IV CIITA
(Fig. 7, B and C). Additional studies examined
CIITA and MHC-II expression at other time points; CIITA and MHC-II mRNA
levels remained unchanged after stimulation with IL-4 for 6, 12, or
24 h (data not shown). Thus, increased MHC-II protein expression
in response to IL-4 was not due to increased CIITA or MHC-II mRNA
levels. These results suggest that posttranslational mechanisms
contribute to the increase in MHC-II expression induced by
IL-4.
|
Recently it was shown that dendritic cells rapidly silence CIITA
transcription upon maturation (17). We analyzed expression
of the various forms of CIITA by dendritic cells immediately after
isolation from spleens or after incubation for 18 h with or
without CpG ODN 1826 (which induces dendritic cell maturation (2, 28, 29)). Freshly isolated splenic dendritic cells expressed
mostly type I CIITA, but little type III or IV CIITA (Fig. 8). After culture in standard medium
containing GM-CSF, levels of total CIITA and types I and III CIITA
decreased, indicating that some maturation occurred spontaneously with
culture of dendritic cells in standard medium (Fig. 8). However, total
CIITA and types I and III CIITA were decreased to a greater degree
after culture of dendritic cells with CpG DNA (Fig. 8). Similar results
were obtained using a 19-kDa lipoprotein from Mycobacterium
tuberculosis (30) to promote maturation of dendritic
cells (data not shown). Bone marrow-derived dendritic cells behaved
similarly to splenic dendritic cells (data not shown). Expression of
type IV CIITA did not change upon treatment with CpG, and type IV CIITA
was the only form detected in significant amounts in mature DC (Fig. 8), but it was expressed at a very low level.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). In this study, we analyzed the relative expression of types
I, III, and IV CIITA in professional APCs after stimulation with
cytokines or bacterial products that modulate the expression of MHC-II
molecules. The primary aim was to address uncertainties about the
relative expression of different types of CIITA during different stages
of macrophage activation, but expression patterns of different CIITA
types also were assessed in B cells and dendritic cells.
Several studies have analyzed the use of different CIITA promoters in
various cell types and the effect of IFN- on CIITA transcription
(15, 18, 19, 22, 37, 38, 39, 40, 41). Ribonuclease protection assays
showed that THP-1 cells (a human macrophage cell line) treated with
IFN- express high amounts of type IV CIITA (15). Using
reporter constructs in which CIITA promoter sequences were linked to a
luciferase gene, it was shown that both types IV and III CIITA could be
induced by IFN- (induction of type I CIITA was not analyzed)
(18, 19). Recently, pIV-/- mice
were generated and found to have loss of MHC-II expression on
nonhemopoietic cells, but preserved MHC-II expression on professional
APCs (23). This finding indicates that type IV CIITA
is essential for IFN- induction of MHC-II on nonhemopoietic cells,
but not on macrophages. Macrophages in pIV-/-
mice were found to express type I CIITA in response stimulation with
IFN- for 72 h.
In our studies, BMM treated with IFN- for a short period, 6 h,
expressed high levels of both types I and IV CIITA. Type IV CIITA was
induced rapidly, but its mRNA levels declined over time. Type I CIITA
also was induced rapidly, and high levels were maintained over a 72-h
period. These experiments establish that IFN- induces both types I
and IV CIITA in macrophages, but the two types are maintained with
different kinetics. After stimulation with IFN-, both types I and IV
CIITA are expressed at early time points and may both contribute to
early induction of MHC-II by IFN-. At late time points, however,
type IV CIITA declines and CIITA expression is dominated by type I
CIITA, which remains elevated for long periods of time and may
contribute to maintenance of MHC-II expression on macrophages for
longer periods.
Our studies provide new information that helps to reconcile differences
between previous reports regarding the regulation of CIITA
expression in macrophages by IFN-. When the existence of different
CIITA promoters was discovered, type IV CIITA was reported to control
MHC-II expression in macrophages (15), and subsequent
studies addressed the mechanism by which IFN- regulates expression
of type IV CIITA (22, 37, 40, 41). In contrast, the study
of Waldburger et al. (23) reported that type I CIITA was
induced by 72 h of IFN- stimulation, and type IV CIITA was not
expressed to a substantial degree at that time point. Waldburger et al.
concluded that type IV CIITA is not absolutely required for MHC-II
expression in macrophages. Our data do not conflict with those of
Waldburger et al., because we also found that type I CIITA was the
predominant form expressed in macrophages after 72 h of
stimulation with IFN-. However, our results also suggest that type
IV CIITA may contribute substantially to the synthesis of MHC-II
shortly after the initiation of IFN- stimulation (e.g. within
24 h), consistent with other reports (15, 18, 19, 22, 37, 40, 41). Thus, our studies reconcile the different results of
previous reports and demonstrate that both type I and type IV CIITA are
responsive to IFN- and may both contribute to MHC-II expression at
different stages of macrophage activation.
The transcriptional machinery necessary for induction of type IV CIITA
has been analyzed in detail and involves three cis-acting
sequences, a -activated site, an IFN regulatory factor
(IRF) binding site, and an E box (40). Stimulation of the
IFN- receptor leads to occupation of the -activated site and IRF
sites by activated STAT1 and IRF-1 respectively. The E box is bound by
the constitutively expressed transcription factor upstream stimulator
factor-1 (40). The transcription factors that
govern expression of type I CIITA are less clear, and no known
IFN--responsive elements have been found upstream of pI
(15). Types I and IV CIITA were expressed with different
kinetics following stimulation of BMM with IFN- (Fig. 5), and this
difference was not explained by differing mRNA half-lives (Fig. 6).
This finding suggests differences in transcriptional control of types I
and IV CIITA, e.g. the hypothesis that different transcription factors
may be involved in the induction of types I and IV CIITA by
IFN-.
Different studies have reported varying results regarding the induction
of type III CIITA by IFN-. Type III CIITA is expressed
constitutively by B cells (15) and human melanoma cells
(20), and it is induced by IFN- in some human tumor
cells (e.g. fibrosarcoma and malignant glioma cells) (19, 21). Nikcevich et al. (22) found that IFN-
induced expression of a luciferase reporter construct driven by human
CIITA pIII in transfected murine RAW264.7 cells. In contrast, we
observed that IFN- induced only extremely low levels of type III
CIITA in murine macrophages (Fig. 4, A and B),
and the amount of type III CIITA present after IFN- stimulation was
insignificant when compared with types I and IV CIITA (Fig. 4B). Thus, type III CIITA appears to play little or no
significant role in IFN- induction of MHC-II in the primary murine
macrophage systems that we have studied. To reconcile these various
findings, it is important to note that the studies illustrating
induction of type III CIITA by IFN- were performed in transformed
human or murine cells that were transfected with human type III CIITA
promoter constructs, whereas our studies were performed with primary
murine macrophages. Thus, the variation in results and lack of
substantial IFN--induced type III CIITA expression in our studies
may reflect differences between transformed and primary cells or
different properties of murine and human type III CIITA promoters.
Unlike macrophages, dendritic cells, and B cells constitutively express
MHC-II and CIITA. In B cell populations, MHC-II expression is under
strict developmental control. Early pro-B cells do not express MHC-II,
expression in pre-B cells is low, mature B cells constitutively express
MHC-II, and expression of MHC-II is lost in plasma cells
(42). Very little is known about regulation of MHC-II
expression in B cells. Recently, expression of MHC-II on mature B cells
was linked to constitutive expression of type III CIITA. A relatively
small region (600 bp) upstream of pIII is required for constitutive
expression, but the transcription factors responsible for pIII
induction are not known (18). Reduction in MHC-II
expression as B cells mature into plasma cells is due to
transcriptional silencing of type III CIITA by B lymphocyte-induced
maturation protein-1 (43). However, little
additional information is available about the regulation of type III
CIITA, and the potential regulation of type III CIITA by IL-4 has not
been examined before our current studies. In our studies, primary B
cells expressed MHC-II protein, and IL-4 increased cell surface
expression of MHC-II protein 
4-fold over 24 h. Surprisingly,
IL-4 did not increase mRNA for CIITA (types I, III, and IV) or MHC-II.
In other studies, treatment of splenic B cells with IL-4 increased
MHC-II mRNA 2-fold or less, whereas MHC-II protein expression was
increased 10- to 15-fold (27). Together, these results
suggest that posttranscriptional events contribute to the IL-4-induced
increase in expression of MHC-II protein on B cells.
It is interesting that IL-4 increased MHC-II protein expression on B cells in the absence of increased levels of CIITA mRNA. We can only speculate as to the exact mechanism by which IL-4 increased expression of MHC-II molecules, but it would appear to be posttranscriptional and probably posttranslational. It is possible that IL-4 increases the stability and half-life of MHC-II molecules on B cells, perhaps by decreasing their endocytosis and degradation, increasing the steady state expression of MHC-II. Alternatively, MHC-II molecules could be mobilized from some intracellular compartment to the cell surface upon IL-4 activation. Although MHC-II molecules are known to reside in intracellular vesicular compartments, there is no precedent for intracellular stores of MHC-II of magnitude sufficient to explain the amount of increase in MHC-II expression that we observed. We are currently in the process of testing these hypotheses.
Immature dendritic cells express low levels of MHC-II and costimulatory
molecules. Ligation of Toll-like receptors (TLRs) on dendritic cells
leads to their maturation (44), enhancing their ability to
present antigenic peptides to naive T cells. Dendritic cell maturation
increases expression of MHC-II (2, 45) even though mRNA
for MHC-II is decreased (2, 46). Consistent with a recent
report (17), we observed that decreased MHC-II mRNA in
response to TLR agonists reflects decreased expression of types I and
III CIITA. In contrast, type IV CIITA was unaffected by TLR activation
(Fig. 8) and was the only form of CIITA expressed at significant levels
in splenic dendritic cells after exposure to CpG ODN (>95% of CIITA
was type IV), but was expressed at low levels. This is consistent with
a previous report identifying a 121-kDa form of CIITA present in mature
dendritic cells (17). Thus, type IV CIITA most likely
mediates the residual expression of MHC-II mRNA in mature dendritic
cells, but the role and significance of this residual expression is not
known.
Reduction of CIITA synthesis upon maturation of dendritic cells has important implications. MHC-II synthesis is dramatically reduced, but the stability of peptide:MHC-II complexes on the cell surface is increased (2, 4, 5). In effect, TLR ligation "freezes" the cohort of peptide:MHC-II complexes present on the cell surface; a hypothesis we refer to as the "freeze frame model" (2). Thus, peptide complexes generated in the period near initiation of TLR signaling will be presented preferentially.
Regulation of MHC-II and CIITA expression differs considerably among
different types of professional APCs in response to activation or
maturation stimuli. IFN--inducible expression of MHC-II on
macrophages is due to the presence of both types I and IV CIITA. Our
results indicate that type I CIITA is expressed for a longer period
than type IV CIITA via a mechanism independent of the relative
stabilities of the two mRNA species, suggesting that continued
transcription of type I CIITA may contribute to prolonged expression of
MHC-II molecules by macrophages. Constitutive expression of MHC-II on B
cells correlates with expression of type III CIITA. Although IL-4
increases expression of MHC-II molecules, our studies indicate that
IL-4 does not affect expression of mRNA for CIITA or MHC-II, suggesting
the existence of posttranscriptional regulatory mechanisms for MHC-II.
Splenic dendritic cells primarily express type I CIITA and, upon
maturation, silence expression of types I and III CIITA, although a
small amount of type IV CIITA is still expressed. An
understanding of the roles of different types of CIITA will help
clarify how MHC-II expression is regulated under different
pathophysiologic conditions.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Clifford V. Harding, Department of Pathology, Case Western Reserve University, Biomedical Research Building 925, 10900 Euclid Avenue, Cleveland, OH 44106-4943. E-mail address: cvh3{at}po.cwru.edu
3 Abbreviations used in this paper: MHC-II, class II MHC; CIITA, class II transactivator; ODN, oligodeoxynucleotide; BMM, bone marrow-derived macrophage; DRB, 5,6-dichloro-1--D-ribosylfuranosylbenzamidazole; IRF, IFN regulatory factor; TLR, Toll-like receptor.
Received for publication February 8, 2002. Accepted for publication May 29, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
mediated by the transactivator gene CIITA. Science 265:106.-induced MHC class II expression in mice lacking class II transactivator due to targeted deletion of the GTP-binding domain. J. Immunol. 163:2425., STAT1, and TGF--regulated expression of the class II transactivator gene. J. Immunol. 160:233. interferon-inducible promoters of the major histocompatibility complex class II transactivator gene are differentially regulated by STAT1, interferon regulatory factor 1, and transforming growth factor . Mol. Cell. Biol. 19:431.-inducible CIITA expression and can function as nonprofessional antigen presenting cells in endocytic processing and CD4+ T-cell activation. Glia 36:391.[Medline]
and IRF-1 in astrocytes and macrophages: CIITA promoter activation is not affected by TNF-
. J. Neuroimmunol. 99:195.[Medline]
suppresses IFN--induced MHC class II expression in HT1080 cells by destabilizing class II trans-activator mRNA. J. Immunol. 163:1435., IL-4, IL-13 and IL-10. Eur. J. Immunol. 29:1275.[Medline]
inhibits IFN--induced class II MHC expression by suppressing transcription of the class II transactivator gene. J. Immunol. 162:886. regulation of the type IV class II transactivator promoter in astrocytes. J. Immunol. 162:4731. signaling pathway. J. Immunol. 166:1041. requires cooperative interaction between Stat1 and USF-1. Immunity 8:157.[Medline]
regulation of class II transactivator promoter IV in macrophages and microglia: involvement of the suppressors of cytokine signaling-1 protein. J. Immunol. 166:2260.This article has been cited by other articles:
|
|
 |
|
  M. E. Pennini, Y. Liu, J. Yang, C. M. Croniger, W. H. Boom, and C. V. Harding CCAAT/Enhancer-Binding Protein beta and {delta} Binding to CIITA Promoters Is Associated with the Inhibition of CIITA Expression in Response to Mycobacterium tuberculosis 19-kDa Lipoprotein J. Immunol., November 15, 2007; 179(10): 6910 - 6918. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. L. Herrmann, R. S. Agrawal, S. F. Connolly, R. L. McCaffrey, J. Schlomann, and D. J. Kusner MHC Class II levels and intracellular localization in human dendritic cells are regulated by calmodulin kinase II J. Leukoc. Biol., September 1, 2007; 82(3): 686 - 699. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. T. Thieu, E. T. Nguyen, B. P. McCarthy, H. A. Bruns, R. Kapur, C.-H. Chang, and M. H. Kaplan IL-4-stimulated NF-{kappa}B activity is required for Stat6 DNA binding J. Leukoc. Biol., August 1, 2007; 82(2): 370 - 379. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Romieu-Mourez, M. Francois, M.-N. Boivin, J. Stagg, and J. Galipeau Regulation of MHC Class II Expression and Antigen Processing in Murine and Human Mesenchymal Stromal Cells by IFN-{gamma}, TGF-beta, and Cell Density J. Immunol., August 1, 2007; 179(3): 1549 - 1558. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wang, G. Roderiquez, T. Jones, P. McPhie, and M. A. Norcross Control of In Vitro Immune Responses by Regulatory Oligodeoxynucleotides through Inhibition of pIII Promoter Directed Expression of MHC Class II Transactivator in Human Primary Monocytes J. Immunol., July 1, 2007; 179(1): 45 - 52. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Zhao, E. N. Cha, C. Lee, C. Y. Park, and C. Schindler Stat2-Dependent Regulation of MHC Class II Expression J. Immunol., July 1, 2007; 179(1): 463 - 471. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Casals, M. Barrachina, M. Serra, J. Lloberas, and A. Celada Lipopolysaccharide Up-Regulates MHC Class II Expression on Dendritic Cells through an AP-1 Enhancer without Affecting the Levels of CIITA J. Immunol., May 15, 2007; 178(10): 6307 - 6315. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. T. Hastings, R. L. Lackman, and P. Cresswell Functional Requirements for the Lysosomal Thiol Reductase GILT in MHC Class II-Restricted Antigen Processing J. Immunol., December 15, 2006; 177(12): 8569 - 8577. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. R. Green, H. Yoon, and J. M. Boss Epigenetic Regulation during B Cell Differentiation Controls CIITA Promoter Accessibility J. Immunol., September 15, 2006; 177(6): 3865 - 3873. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Yao, Q. Xu, M.-J. Kwon, R. Matta, Y. Liu, S.-C. Hong, and C.-H. Chang ERK and p38 MAPK Signaling Pathways Negatively Regulate CIITA Gene Expression in Dendritic Cells and Macrophages J. Immunol., July 1, 2006; 177(1): 70 - 76. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. E. Pennini, R. K. Pai, D. C. Schultz, W. H. Boom, and C. V. Harding Mycobacterium tuberculosis 19-kDa Lipoprotein Inhibits IFN-{gamma}-Induced Chromatin Remodeling of MHC2TA by TLR2 and MAPK Signaling J. Immunol., April 1, 2006; 176(7): 4323 - 4330. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Shang and T. B. Tomasi The Heat Shock Protein 90-CDC37 Chaperone Complex Is Required for Signaling by Types I and II Interferons J. Biol. Chem., January 27, 2006; 281(4): 1876 - 1884. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-D. Chou, A. N. H. Khan, W. J. Magner, and T. B. Tomasi Histone acetylation regulates the cell type specific CIITA promoters, MHC class II expression and antigen presentation in tumor cells Int. Immunol., November 1, 2005; 17(11): 1483 - 1494. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Kuchtey, P. J. Chefalo, R. C. Gray, L. Ramachandra, and C. V. Harding Enhancement of Dendritic Cell Antigen Cross-Presentation by CpG DNA Involves Type I IFN and Stabilization of Class I MHC mRNA J. Immunol., August 15, 2005; 175(4): 2244 - 2251. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. T. Chang, J. J. Linderman, and D. E. Kirschner Multiple mechanisms allow Mycobacterium tuberculosis to continuously inhibit MHC class II-mediated antigen presentation by macrophages PNAS, March 22, 2005; 102(12): 4530 - 4535. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. K. Yee, Y. Yao, Q. Xu, B. McCarthy, D. Sun-Lin, M. Tone, H. Waldmann, and C.-H. Chang Enhanced Production of IL-10 by Dendritic Cells Deficient in CIITA J. Immunol., February 1, 2005; 174(3): 1222 - 1229. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. van der Stoep, E. Quinten, M. M. Rezende, and P. J. van den Elsen E47, IRF-4, and PU.1 synergize to induce B-cell-specific activation of the class II transactivator promoter III (CIITA-PIII) Blood, November 1, 2004; 104(9): 2849 - 2857. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. L. Popkin, M. A. Watson, E. Karaskov, G. P. Dunn, R. Bremner, and H. W. Virgin IV Murine cytomegalovirus paralyzes macrophages by blocking IFN{gamma}-induced promoter assembly PNAS, November 25, 2003; 100(24): 14309 - 14314. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Nagabhushanam, A. Solache, L.-M. Ting, C. J. Escaron, J. Y. Zhang, and J. D. Ernst Innate Inhibition of Adaptive Immunity: Mycobacterium tuberculosis-Induced IL-6 Inhibits Macrophage Responses to IFN-{gamma} J. Immunol., November 1, 2003; 171(9): 4750 - 4757. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Giroux, M. Schmidt, and A. Descoteaux IFN-{gamma}-Induced MHC Class II Expression: Transactivation of Class II Transactivator Promoter IV by IFN Regulatory Factor-1 is Regulated by Protein Kinase C-{alpha} J. Immunol., October 15, 2003; 171(8): 4187 - 4194. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Kuchtey, M. Pennini, R. K. Pai, and C. V. Harding CpG DNA Induces a Class II Transactivator-Independent Increase in Class II MHC by Stabilizing Class II MHC mRNA in B Lymphocytes J. Immunol., September 1, 2003; 171(5): 2320 - 2325. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. M. C. Hornell, G. W. Beresford, A. Bushey, J. M. Boss, and E. D. Mellins Regulation of the Class II MHC Pathway in Primary Human Monocytes by Granulocyte-Macrophage Colony-Stimulating Factor J. Immunol., September 1, 2003; 171(5): 2374 - 2383. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. K. Pai, M. Convery, T. A. Hamilton, W. H. Boom, and C. V. Harding Inhibition of IFN-{gamma}-Induced Class II Transactivator Expression by a 19-kDa Lipoprotein from Mycobacterium tuberculosis: A Potential Mechanism for Immune Evasion J. Immunol., July 1, 2003; 171(1): 175 - 184. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
