|
|
||||||||
Institute of Medical Microbiology and Immunology, University of Ulm, Ulm, Germany
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Hepatitis B surface Ag (HBsAg)4 secreted by HBV-infected hepatocytes and present in the plasma of infected individuals is a complex macromolecule composed of proteins and lipids (1, 2). The 22-nm coreless HBsAg lipoprotein particles contain three natural variants of HBsAg designated large (LS), middle (MS), and small (S) surface proteins. The major HBsAg species is the small, secreted S protein present as nonglycosylated p24 and glycosylated gp27. The MS protein contains an additional N-terminal preS2 domain and is expressed as nonglycosylated p33 and glycosylated gp36. The intracellular LS protein with additional preS1 and preS2 domains N-terminal to the S region is expressed as nonglycosylated p39 and glycosylated gp42 (3). All three HBsAg species form particulate structures when expressed individually (2, 3, 4). The MS and S Ags are efficiently secreted from transfected cells, whereas the LS Ag is exclusively found intracellularly (3). All three natural HBsAg variants contain the conformational "a" determinant in the S120147 region that is recognized by most human and murine anti-HBsAg Abs (2, 4, 5, 6). The a determinant of the S protein forms a loop between two transmembrane domains, is glycosylated, and is present in envelope proteins of almost all known HBV isolates. We investigated whether a HBsAg-derived sequence encoding the a determinant can be expressed in a DNA vaccine as either an intracellular, chimeric Ag (mimicking LS), or a secreted Ag (mimicking S), and can induce conformation-specific, biologically active Ab responses.
We used an expression system in which N-terminal, papovavirus (SV40)-derived sequences facilitate expression of protein fragments fused C-terminally to it (7). The N-terminal residues 160, 177, or 1272 from SV40 T-Ag support expression of the a determinant-containing HBsAg fragment (residue 80180) fused C-terminally to it. By varying the length of the N-terminal T-Ag-derived sequence, we changed the expression pattern of the chimeric protein with the a epitope of HBsAg resembling either the intracellular LS expression (stably associated with the hsp73 chaperone) or the secreted S expression (not associated with hsp). Expression was intracellular and hsp-associated when the N-terminal T-Ag sequence contained residue 177 with the intact, hsp-binding J domain (8, 9). Expression of a secreted product was obtained when the N-terminal T-Ag sequence contained T-Ag residue 160 with a disrupted, hsp-binding J domain.
A critical question is whether the Ab response to the HBsAg a epitope elicited by the novel vaccine constructs is biological functional. HBV neutralization assays are not feasible in mice. We therefore tested whether the elicited Abs can suppress antigenemia (in mice expressing transgene-encoded HBsAg in the liver) after adoptive transfer of either serum or immune cells. This system allowed us to evaluate the potential for neutralization that the elicited Ab response can convey.
The efficient expression of the conformational B cell epitope, the testing of its immunogenicity in mice in vivo by DNA vaccination, and the evaluation of its potential neutralizing activity in transgenic mice indicated that the approach supports construction of polyepitopes DNA vaccines encoding chimeric Ags. We further used this system to express a more complex polyepitope vaccine containing B and T cell-stimulating epitopes. In this pCI/T77-SII-Ld vaccine, the MHC class I (Ld)-binding epitope of HBsAg was fused C-terminally to the chimeric T77-SII Ag. This generated a vaccine that efficiently primed CTL and showed enhanced immunogenicity of the conformational B cell epitope. These data indicate that polyepitope DNA vaccines can efficiently coprime different compartments of the immune system and thus are a feasible option for the construction of complex, multivalent vaccines.
| Materials and Methods |
|---|
|
|
|---|
BALB/cJBom (H-2d) mice and C57BL/6JBom (B6, H-2b) mice were bred and kept under standard pathogen-free conditions in the animal colony of Ulm University (Ulm, Germany). C57BL/6J-TgN(Alb1HBV)44Bri transgenic (HBs-tg) mice were obtained from The Jackson Laboratory (Bar Harbor, ME). Mice were used at 1016 wk of age. Male and female mice were used at 1216 wk of age.
Cells
The H-2d mastocytoma cell line P815 (TIB64) and the Chinese hamster ovary (CHO) cell line (CRL-1772) were obtained from the American Type Culture Collection (Manassas,VA). The chicken hepatoma cell line LMH was obtained from Dr. H.-J. Schlicht (University of Ulm, Institute for Virology, Ulm, Germany).
Vector constructs
Construction of the pCI vectors containing cT272, S, and LS has been described (10, 11, 12). pCI/SII: The SII (S80180) fragment was amplified from a HBsAg-encoding sequence by using a forward primer encoding a methionine start codon and a SalI site (AAAGTCGACATGATCATCTTCCTCTTCATCCTGCTG) and a reverse primer encoding a stop signal and a NotI site (GGAAAAAAGCGGCCGCTTAAACAAATGGCACTAGTAAACT). The amplified sequence cloned into the pCI vector (catalog no. E1731; Promega, Madison, WI) was used for DNA immunization. pCI/cT272-SI: The HBV sequence, encoding the HBV-S amino acid sequence1100 was fused in-frame to the N-terminal, hsp73-binding cT-Ag272 fragment. The CCCAAGCTTATGGAGAACATCACATCAGGA(+)and GGAAAAAAGCGGCCGCTTAATAGTCCAGAAGAACCAACAA(-) primers were used to amplify the SI DNA sequence and cloned into the pBluescript II SK+ vector (catalog no.212205; Stratagene, La Jolla, CA). The cT-Ag272-containing HindIII fragment (7) was cloned N-terminal to the S1100 (SI) sequence, and the cT272-SI fusion construct was cloned into the pCI vector. pCI/cT272-SII: The HBV sequence, encoding the sequence S80180 (SII) of HBsAg, was fused-in-frame to the hsp73-binding cT-Ag272 fragment using the CCCAAGCTTATCATCTTCCTCTTCATCCTGCTG(+) and GGAAAAAAGCGGCCGCTTAAACAAATGGCACTAGTAAACT(-) primers. pCI/T77-SII: The T77 fragment (containing the T-Ag177 fragment) was amplified from the cT272-encoding vector using AAACTCGAGATGGATAAAGTTTTAAACAGAGAGG(+) and AAAAAGCTTGAAGCCTCC AAAGTCAGGTTG(-) primers. This amplified fragment was fused N-terminally to the SII fragment. pCI/T60-SII: The T60 fragment (containing T-Ag160) was amplified from a cT272encoding vector using the AAACTCGAGATGGATAAAGTTTTAAACAGAGAGG(+) and AAAAAGCTTCTTGTACAGAGTATTCATTTTCTTC(-) primers. This fragment was cloned in-frame in front of the SII fragment. pCI/T77-SII-Ld: The stop codon of the T77-SII fragment was deleted by AAACTCGAGATGGATAAAGTTTTAAACAGAGAGG(+) and AAATCTAGAAACAAATGGCACTAGTAAACTGAG(-) primers. The amplified T77-SII (-stop) fragment was subcloned into pCI. The S2050 fragment with the Ld-binding HBsAg epitope was amplified using the AAAGTCGACTTGTTGACAAGAATCCTCACAAT(+) and AAAGCGGCCGCTTAGCCAAGACACACGGTAGTTC(-) primers. The amplified Ld fragment was subcloned in-frame behind the T77-SII (-stop) fragment. The resulting T77-SII-Ld fusion construct was cloned into the pCI vector. A very similar cloning strategy was used to generate a T60-SII-Ld fusion construct. We used the BMGneo vector system for the generation of stable transfectants in which genes are expressed under methallothionin promoter control (13) as described previously (14).
DNA vaccination
Two aliquots of plasmid DNA were injected into the two contralateral tibialis anterior muscles. For i.m. nucleic acid immunization, we injected 50 µl PBS containing 1 µg/µl plasmid DNA as described elsewhere (7, 11).
Transient and stable expression of fusion proteins
For transient expression, LMH cells were transfected with recombinant pCI-based plasmids using the Ca2PO4 method. About 5 x 106 cells were harvested 36 h after transfection, metabolically labeled for 12 h with 100 µCi [35S]methionine (catalog no. SJ1015; Amersham, Braunschweig, Germany), and extracted with 1 ml lysis buffer (100 mM NaCl, 1% aprotinin (Trasylol; Bayer, Leverkusen, Germany), leupeptin, 0.5% Nonidet P-40, and 100 mM Tris-HCl (pH 8.0)) for 30 min at 4°C. Extracts were cleared by centrifugation (30 min, 14,000 rpm) and immunoprecipitated for T-Ag using 10 µl of mAb PAb108 (10 mg/ml stock) directed against the extreme N terminus of the T-Ag (15) and 200 µl of protein A-Sepharose. Immune complexes bound to protein A-Sepharose were purified five times with wash buffer (300 mM LiCl, 0.5% Nonidet P-40, and 100 mM Tris-HCl (pH 8.5)), followed by two washes with PBS and one wash with 0.1x PBS. Immune complexes were recovered from protein A-Sepharose with 300 µl of elution buffer (1.5% SDS, 5% 2-ME, and 7 mM Tris-HCl (pH 6.8)). Samples were lyophilized and dissolved in 30 µl of sample buffer (H2O, 5% 2-ME, and 2% bromphenol blue in glycerol), boiled for 5 min, and 10-µl aliquots were analyzed by SDS-PAGE and fluorography.
Western blot
Western blot analyses were performed as described previously (16). SV40 T-Ag was detected with polyclonal rabbit anti SV40 T-Ag or monoclonal PAb108 (a generous gift from Dr. W. Deppert, Heinrich-Pette Institute, Hamburg, Germany). HBsAg was detected with a polyclonal rabbit antiserum (a generous gift from Dr. U. Kanngieser, Behring, Marburg, Germany). hsp was detected with the hsp73-specific Abs SPA-815 and SPA-816 or with the grp78- and grp94-specific Abs SPA-826 and SPA-851 (StressGen Biotechnologies, Victoria, Canada).
ATP treatment of immunoprecipitated T-hsp73 complexes
The T-hsp73 complexes were immunoprecipitated with the anti-T-Ag mAb PAb108 and protein A-Sepharose. Immune complexes were extensively washed as described above and treated for 15 min with 10 mM ATP or ADP (catalogue nos. A-2383 and A-2754, respectively; Sigma-Aldrich, Deisenhofen, Germany) in PBS containing 10 mM MgCl2. After washing steps with PBS and 0.1 PBS, the proteins were recovered from protein A-Sepharose and processed for SDS-PAGE.
Endoglycosidase (Endo H) treatment
Endo H (catalog no. 1643053; Roche, Mannheim, Germany)
digestion was performed on immunoprecipitated samples as described
elsewhere (17). Protein A-Sepharose beads carrying
0.5
µg mAb108-bound cT-SII Ags were resuspended in 60 mM sodium citrate
(pH 5.5), 0.2% SDS, 50 µg BSA, 1% aprotinin, and leupeptin. After
addition of 125 mU Endo H, the samples were incubated for 18 h at
37°C. After washing steps with 1x and 0.1x PBS, the proteins were
recovered from protein A-Sepharose and processed for SDS-PAGE.
Cytotoxic assays
Single-cell suspensions were prepared from spleens of mice in
-MEM tissue culture medium supplemented with 10 mM HEPES buffer,
5 x 10-5 M 2-ME, antibiotics, and 10% v/v
FCS (PAA Laboratories; Linz, Austria). A selected batch of Con
A-stimulated rat spleen cell supernatant (2% v/v) was added to the
culture medium. Three x 107 responder cells
were cocultured with 1 x 106 irradiated,
syngeneic HBsAg-expressing transfectants. Coculture was performed in 10
ml medium in upright 25-cm2 tissue culture flasks
in a humidified atmosphere of 5% CO2 at 37°C.
After 5 days of culture, CTL were harvested, washed, and assayed for
specific cytolytic reactivity. Serial dilutions of effector cells were
cultured with 2 x 103 51Cr-labeled targets
in 200-µl round-bottom wells. Specific cytolytic activity of cells
was tested in 51Cr release assays against
transfected, HBsAg-expressing P815/S targets or control P815 targets.
After a 4-h incubation at 37°C, 50 µl of supernatant was collected
for gamma radiation counting. The percentage of specific release was
calculated as ((experimental release - spontaneous
release)/(total release - spontaneous release)] x 100. Total
counts were measured by resuspending target cells. Spontaneously
released counts were always <15% of the total counts. Data shown are
the mean of triplicate cultures. The SEM of triplicate data was always
<20% of the mean.
Determination of HBsAg-specific serum Ab levels and serum HBsAg
Serum samples were repeatedly obtained from individual immunized or control mice by tail bleedings at different time points postinjection. Abs against HBsAg were detected in mouse sera using the commercial IMxAUSAB test (catalog no. 7A39-20; Abbott Laboratories, Wiesbaden, Germany) that detects exclusively the conformational a determinant. Ab levels were quantified using six standard sera. The tested sera were diluted so that the measured OD values were between standard serum one and six. Values presented in this paper are calculated by multiplying the serum dilution with the measured Ab level (mIU/ml). Serum samples were tested for HBsAg content using the commercial AXSYM HBsAg (V2) kit (catalogue no. 7A40-22; Abbott Laboratories).
HBsAg-specific IgG1 and IgG2a serum Abs were determined by end point dilution ELISA. Briefly, microELISA plates (Nunc Maxisorp; Nunc, Wiesbaden, Germany) were coated with 150 ng rHBsAg/well in 50 µl 0.1 M sodium carbonate buffer (pH 9.5) at 4°C. Serial dilutions of the sera in loading buffer (PBS supplemented with 3% BSA, BSA, and 2% Tween 20) were added to the Ag-coated wells. Serum Abs were incubated for 2 h at 37°C followed by four washes with PBS supplemented with 0.05% Tween 20. Bound serum Abs were detected using HRP-conjugated rat anti-mouse IgG, IgG1, or IgG2a Abs (BD PharMingen, Hamburg, Germany) at a dilution of 1/2000 followed by incubation with o-phenylenediamine x 2 HCl (catalog no. 6172-24; Abbott Laboratories) in PBS (pH 6.0). The reaction was stopped by 1 M H2SO4 and the extinction was determined at 492 nm. End point titers were defined as the highest serum dilution that resulted in an absorbance value three times greater than that of negative control sera (derived from nonimmunized BALB/c mice).
| Results |
|---|
|
|
|---|
We cloned HBsAg sequences encoding either the LS protein or the
226-residue small S protein into the pCI vector (Fig. 1
A). We furthermore cloned
HBsAg fragments encoding Ab- and/or CTL-defined epitopes into
expression vectors (Fig. 1
B). Residues 120147 of the S
protein form the group-specific, glycosylated, immunodominant a
determinant (2) that forms a loop between two
transmembrane domains (18). This determinant and the two
transmembrane flanking regions are encoded by the
S80180 fragment (SII) of the S protein (Fig. 1
B). The Ld-binding, antigenic
S2839 peptide of HBsAg (19) is
located in the N-terminal S1100 fragment (SI)
of the S protein (Fig. 1
B).
|
|
The SI or SII fragments of HBsAg were fused in-frame behind the
hsp73-binding, N-terminal 272-residue fragment of the SV40 T-Ag from
which the NLS (residue 110152) was deleted (Fig. 1
B)
(14). This generated vectors encoding either the
cT272-SI (pCI/cT-SI; it contains the
Ld-restricted S2839 CTL
epitope, but not the Ab-defined a determinant of HBsAg) or the
cT272-SII fusion proteins (pCI/cT-SII; it
contains the a determinant of HBsAg, but not the
Ld-restricted S2839 CTL
epitope) (Fig. 1
B). Products of the expected size were
immunoprecipitated with the anti-T-Ag mAb PAb108 from lysates of
radiolabeled, transiently transfected chicken hepatoma LMH cells (Fig. 2
C). A 38-kDa fusion protein was expressed by plasmid
pCI/cT-SI, and two fusion products of 38 (cT-SII) and 40 (gp cT-SII)
kDa were expressed by plasmid pCI/cT-SII. Both cT-SI and cT-SII
proteins were expressed at comparable levels and coprecipitated large
amounts of hsp73 (Fig. 2
C). We cloned the sequences encoding
the cT-SI and cT-SII fusion proteins into the episomal BMGneo vector
(13). With these BMG/cT-SI and BMG/cT-SII vectors, we
generated stable CHO transfectants. From lysates of stable CHO/cT-SI or
CHO/cT-SII transfectants, we precipitated cT-SI and cT-SII fusion
proteins and coprecipitated hsp73 with anti-T-Ag mAb PAb108 that
were readily detected in Coomassie blue-stained gels (Fig. 2
D). Thus, high levels of fusion protein-hsp73 complexes
accumulated in transfected cell lines. Western blot analyses of
CHO/cT-SII immunoprecipitates with polyclonal anti-T or
anti-HBsAg rabbit sera confirmed that the two cT-SII bands
contained T-Ag- and HBsAg-derived sequences (Fig. 2
E). The
coprecipitated 70-kDa protein was identified as hsp73 by a polyclonal
rabbit anti-hsp73 Ab (Figs. 2
E and
3B), confirming our published
data (20). Binding of hsp73 to the cT-SI and cT-SII fusion
proteins was ATP sensitive as hsp73 was removed from the complexes in
the presence of ATP (Fig. 3
A). We have thus constructed two
vectors that express as hsp73-binding fusion proteins the major,
immunodominant determinants of HBsAg: the CTL-stimulating,
Ld-binding epitope (cT-SI) and the B
cell-stimulating a determinant (cT-SII).
|
The conformational HBsAg a determinant is a loop between the
second and third transmembrane domain of this viral envelope protein
and contains a glycosylation site at Asn146 (2). Similar
to the a loop in native HBsAg, the a loop in the cT-SII
(S80180) fusion protein is glycosylated.
Treatment of the cT-SII fusion protein with the Endo H strikingly
reduces the 40-kDa band at the expense of the 38-kDa band (Fig. 3
D). The cT-SII fusion protein thus seems to be anchored
into the membranes of the endoplasmic reticulum (ER) or a
cis-Golgi compartment by its transmembrane domains and
remains stably associated within the cells that produce it (Fig. 3
C). The cT-SII fusion protein is thus apparently expressed
as a membrane protein in the ER containing a glycosylated, native a
determinant. We found that glycosylated 40-kDa cT-SII protein
accumulated preferentially in stable transfectants (Figs. 2
D
and 3A). hsp73 that efficiently binds the cT-SII fusion
protein is expected to be located at the cytoplasmic side (Fig. 3
F). We found no evidence that hsp proteins resident in the
ER (i.e., the grp78 Bip protein or hsp proteins of the hsp90 family)
bind to the cT-SII fusion protein (Fig. 3
B).
Secretion of cT-SII is inhibited by hsp73 binding to the T-Ag-derived N terminus
Similar to native LS (2), the cT-SII protein is not
released into the supernatant (Figs. 2
B and 3C).
Binding of hsp73 to cT272 depends on the (DnaJ
homologous) J domain in the N-terminal 77 residues of the T-Ag
(21, 22). We designed two constructs in which the
S80180 (SII) fragment was fused either to the
hsp73-binding 77-residue T77 N terminus or to the
non-hsp-binding 60-residue T60 N terminus (Fig. 1
B). The loop-forming J domain is disrupted in the
T60 fragment (21, 22) and stable
hsp73 binding is lost (Fig. 3
E). Both fusion proteins were
expressed by LMH cells transiently transfected with
pCI/T77-SII or pCI/T60-SII
vector DNA (Fig. 3
E). In contrast to the
T77-SII protein, T60-SII
protein was not associated with hsp73 and was released into the
supernatant by transfectants (Fig. 3
E). This allowed us to
compare the immunogenicity of hsp73-associated, intracellular to
non-hsp-associated, secreted variant of a viral, Ab-binding envelope
protein domain.
Stimulating HBsAg-specific Ab responses by DNA vaccines encoding variants of the SII domain
We compared Ab responses induced in mice by DNA vaccines encoding
either native (secreted) small S, or (nonsecreted) large LS, or the a
determinant-containing SII fragment of HBsAg fused to either the
hsp73-associated T77 or the non-hsp73-associated
T60 domain (Fig. 4
A). As a control, mice were
immunized with 1 µg commercial HBvax vaccine (containing rHBsAg
adsorbed to aluminum hydroxide). The commercial ELISA (IMxAUSAB System;
Abbott Laboratories) used detects only serum Abs recognizing the
conformational a determinant of native HBsAg. The
pCI/T60-SII DNA vaccine encoding the secreted,
non-hsp-binding S80180 Ag (group 2) was as
efficient as the pCI/S DNA vaccine encoding native HBsAg (group 4) in
stimulating a HBsAg-specific serum Ab response after i.m. inoculation
of plasmid DNA. In contrast, the pCI/T77-SII DNA
vaccine encoding nonsecreted, hsp73-associated
S80180 (group 3) and the pCI/LS DNA vaccine
encoding a nonsecreted, natural variant of HBsAg (group 5) were two
orders of magnitude less potent in stimulating an HBsAg-specific Ab
response. The pCI/SII vector DNA encoding the
S80180 fragment of HBsAg (Fig. 1
B)
did not express detectable amounts of the protein and did not prime a
humoral anti-HBsAg response (group 1). The secreted
T60-SII fusion Ag delivered by a DNA vaccine can
thus prime an Ab response to a conformational HBsAg determinant as
efficiently as a DNA vaccine encoding native HBsAg.
|
upon restimulation with HBsAg (data not shown; Ref.
24), indicating that Th1-biased immune responses were
induced. In contrast, injection of rHBsAg mixed with aluminum hydroxide
induced high titers of HBsAg-specific serum Abs that were predominantly
of the IgG1 subclass (IgG1:IgG2a ratio, >60; Fig. 4
In sera from mice immunized with the pCI/T77-SII,
pCI/T60-SII, or pCI/S DNA vaccine, we searched in
Western blot analyses for Abs binding linear HBsAg determinants using
denatured rHBsAg as the detection Ag. In contrast to the efficient
priming of Ab responses to the conformational a determinant of HBsAg by
some of the HBsAg-encoding DNA vaccines tested (Fig. 4
B),
Abs binding linear HBsAg determinants were very low or undetectable
(Fig. 4
B). Sera from mice immunized with commercial HBvax
(HBsAg/alum) developed significant levels of Abs against linear HBsAg
epitopes (Fig. 4
B). Abs binding T-Ag were readily apparent
in Western blot analyses using sera from pCI/cT-immunized mice and the
hsp73-associated cT272-preS fusion protein as
detection Ag (Fig. 4
B), confirming our previous report
(7). No T-Ag-binding Abs were primed by DNA vaccines
encoding the T60- and
T77-containing fusion constructs (Fig. 4
B). Furthermore, we did not detect serum Abs binding the
hsp73 autoantigen (Fig. 4
B; Ref. 7). The
expression of the S80180 fragment as a fusion
protein by the pCI/T60-SII and
pCI/T77-SII DNA vaccines thus selectively
presents the conformational a determinant of HBsAg to the immune system
but does not elicit Ab responses to the T-Ag-derived carrier or the hsp
autoantigen.
Abs elicited by pCI/T60-SII or pCI/T77-SII DNA vaccines suppress the HBsAg antigenemia of HBs-tg mice
HBs-tg mice express high levels of liver-derived HBsAg particles
in the serum (23, 24). Adoptive transfer of HBsAg-specific
serum Abs into HBs-tg hosts transiently suppresses HBsAg antigenemia
(24, 25). To directly compare suppression of HBsAg
antigenemia in HBs-tg mice, we transferred similar serum Ab amounts
from T60-SII- or
T77-SII-vaccinated B6 mice, i.e., a single
injection of antiserum containing 100 mIU from
T77-SII-immune mice, or 100 mIU from
T60-SII-immune mice were injected into HBs-tg
mice. The antigenemia of the transgenic host was transiently suppressed
by antisera derived from mice immunized with the
pCI/T60-SII or pCI/T77-SII
(but not pCI/SII) DNA vaccine (Fig. 5
A). The Abs primed by the
S80180 fragment of HBsAg can thus clear native
HBsAg particles produced in a mouse. Suppression of HBsAg antigenemia
was similar with the pCI/T60-SII- or
pCI/T77-SII-induced serum Abs, suggesting that
the Abs generated by the two different constructs exhibit very similar
affinities. Using 50- to 200-mIU Ab titers for passive therapy, serum
HBsAg reappeared between 2 and 4 days (Fig. 5
A). Similar
results were observed when different IgG, IgG1, or IgG2a Abs specific
for HBsAg were injected into HBs-tg mice (24, 25).
|
Copriming humoral and CTL immunity to HBsAg using DNA vaccines that encode immunodominant, Ab- and CTL-defined determinants
We stimulated Ab- (Fig. 4
A) but not CTL-mediated
immunity to HBsAg by the T77-SII DNA vaccine
(Fig. 6
B). To add an
immunodominant, Ld-binding CTL epitope
(S2939) of HBsAg to the
pCI/T77-SII DNA vaccine, we fused the
S2050 sequence to the C terminus of the
pCI/T77-SII plasmid to generate the
pCI/T77-SII-Ld construct
(Fig. 1
B). Similar to the T77-SII
construct, two (glycosylated and nonglycosylated)
T77-SII-Ld fusion proteins
of the expected size were expressed by cells transfected with DNA of
this construct (Fig. 6
A). The
T77-SII-Ld was associated
with the hsp73 (Fig. 6
A). The presence of the CTL-defined
HBsAg epitope was confirmed in BALB/c mice injected with the
pCI/T77-SII-Ld DNA (Fig. 6
B). HBsAg-specific CTL reactivity was efficiently primed in
mice injected with either the HBsAg-encoding pCI/S plasmid or the
pCI/cT272-SI plasmid encoding the N-terminal
HBsAg 1100 fragment, or the
pCI/T77-SII-Ld plasmid
(i.e., vector constructs that contained the HBsAg-specific CTL
epitope(s) (see Fig. 1
B). In the latter construct, the
Ld-restricted CTL epitope of HBsAg is expressed
in an artificial position (see Fig. 1
B). No HBsAg-specific
CTL reactivity was primed by injecting pCI/SII or
pCI/T77-SII DNA vaccines (Fig. 6
B).
|
We also constructed the vector pCI/T60-SII-Ld. The data obtained with this construct are difficult to interpret. The T60-SII-Ld Ag is not associated with hsp73 and is glycosylated. Immunization of BALB/c mice with this construct induces HBsAg2839-specific, Ld-restricted CTL responses, but no HBsAg-specific serum Ab response. The C-terminal S2050 sequence of the T60-SII-Ld fusion Ag might inhibit priming of humoral immunity by interfering, for example, with the proper folding of the conformational loop structure or the membrane anchoring of the S80180 (SII) fragment.
| Discussion |
|---|
|
|
|---|
In DNA-based vaccination, plasmid DNA-containing Ag-encoding sequences and appropriate promoter/enhancer control sequences are injected into muscle or skin. This leads to expression of the Ag and its immunogenic presentation by in vivo-transfected cells. The "vaccine" in nucleic acid immunization is usually plasmid DNA, although successful vaccination with Ag-encoding mRNA has been reported (26, 27). Many aspects of DNA-based vaccination have been expertly reviewed (28, 29). The introduction of DNA vaccines has opened new dimensions for expressing and testing recombinant Ags produced in a large variety of novel systems. Some systems support the construction of large polyepitope vaccines, the incorporation of "intrinsic adjuvant activity" into vaccines, and/or the targeting of vaccines to distinct tissues or cells.
Mice immunized into the tibialis anterior muscles with 100 µg of the
small HBsAg-encoding pCI/S plasmid DNA developed high Ab titers
specific for HBsAg (Fig. 4
A). Abs appeared in the third week
postvaccination, reached plateau levels at 1620 wk postvaccination,
and persisted at high levels for >9 mo (30). Similar data
have been described using different HBsAg expression plasmids
(31, 32, 33, 34). Intrinsic properties of the Ag might have a
decisive influence on the type of specific immunity that is primed by
DNA vaccination. It has been reported that the nature of the
(intracellular or secreted) Ag expressed by a DNA vaccine can affect
the levels of induced Abs (35, 36). It is unclear how DNA
vaccines prime Ab responses to intracellular protein Ags as it is
usually assumed that B cells require exogenous Ag to be stimulated. As
the pCI/S vector expressed secreted HBsAg, exogenous Ag can directly
prime Ab responses in this system. We showed that mice immunized with
pCI/LS DNA encoding the nonsecreted (intracellular) LS variant of HBsAg
developed low HBsAg- specific Ab titers (Fig. 4
B; (30, 37). It is not clear how B cells are primed by intracellular
Ags. It is generally assumed that small amounts of intracellular Ags
are released from the cells that synthesize the Ag. This process might
be supported by cell death induced by Ag-specific CTL
(29).
We developed an intracellular expression system based on the
observation of an unexpected accumulation of large amounts of mutant
SV40 T-Ag with a long half-life in transfectants and a tight
ATP-dependent binding of hsp73 to mutant but not wild-type T-Ag
(12, 20). We designed fusion constructs with an
N-terminal, hsp73-binding domain of T-Ag and unrelated C-terminal
sequences (encoding Ag fragments) that showed strikingly enhanced and
stable expression (7). This expression system was also
used in these studies to efficiently and selectively express B and T
cell epitopes of HBsAg. Some aspects of the biology of the system have
been elucidated. The N terminus of the T-Ag of papovaviruses contains
the highly conserved J domain (i.e., sequences homologous to the
Escherichia coli DnaJ molecule) with a conserved HPD loop
that recruits cellular chaperones, e.g., the cytosolic hsp73 chaperone
(8, 21, 22). J domains contain four
helices with helix
II and III forming a finger-like loop structure that exposes the
conserved HPD motif at the tip. Mutations in the J domain disrupt its
helical structure and prevent its association with hsp73
(21). We confirmed that an intact N terminus of T-Ag
containing the J domain is required for hsp73 association as the
T77 fragment, but not the
T60 (with a disrupted DnaJ homologous structure)
binds to hsp73. By constructing fusion Ags containing the same
C-terminal antigenic determinant fused to hsp-binding
(T77) or hsp-nonbinding
(T60) N terminus, we could test the pattern of
expression and compare the immunogenicity of the recombinant Ags. The
secreted T60-SII construct was not associated
with hsp. The T77-SII construct was
hsp-associated and expressed intracellularly. Both fusion Ags were
expressed as nonglycosylated and glycosylated species, suggesting
correct transmembrane incorporation of the a loop containing the
S80180 fragment (Fig. 3
F) (18, 38). The secretion-defective, hsp73-associated
T77-SII protein preferentially accumulates in
transfected cells in its glycosylated form (Figs. 2
Dand
3A). The glycosylated T77-SII protein
was sensitive to treatment with Endo H (Fig. 3
D), suggesting
that this protein accumulates in the ER or cis-Golgi
structures and was not transported to the medial cisternae of the Golgi
apparatus where carbohydrate chains acquire resistance to this enzyme
(17). In contrast, significantly reduced levels of the
T60-SII protein (not associated with hsp73) were
expressed and secreted by transfected cell lines (Fig. 3
E).
The glycosylated T60-SII form was barely
detectable (Fig. 3
E) and the
T60-SII protein did not accumulate to detectable
steady-state levels in stable transfected cell lines (data not shown).
Secretion of the S80180-encoding
T60-SII protein was unexpected as similar HBsAg
fragments with deletions in the first hydrophilic region of HBsAg
(e.g., the S75226) remain intracellular
(17, 39, 40).
The pCI/SII vector DNA encoding the 80- to 180-residue fragment of HBsAg with a synthetic ATG at its N terminus did not express detectable amounts of the protein, and did not prime a humoral anti-HBsAg response. In contrast, the SII fragment was expressed when fused to the 60-residue T-Ag (T60-SII protein). We tested alternative ways to express this fragment. The SII (S80180) fragment of HBsAg was fused in-frame behind the N-terminal 5- or 45-residue fragment of the T-Ag or in-frame to an ATG containing pcDNA4/HisMax-C (Invitrogen, Karlsruhe, Germany) and was expressed to similar levels and molecular characteristics (secreted and glycosylated) as the T60-SII protein (data not shown). As expected for secreted Ags, comparable HBsAg-specific serum Ab responses were stimulated after inoculation of the pCI/T5-SII, pCI/T45-SII, pcDNA4/HisMax-SII, and pCI/T60-SII DNA vaccines (data not shown). These findings suggested that the S-II fragment itself was efficiently expressed with selected ATG start codons.
The T60-SII fusion Ag primed a specific serum Ab
response to the native a determinant of HBsAg when expressed from a DNA
vaccine. The HBsAg-specific Ab titers induced by this secreted Ag
reached comparable titers as the secreted wild-type S (Fig. 4
A). As expected, the secreted T60-SII
variant of the Ag was more efficient in stimulating an Ab response then
the intracellular T77-SII variant of the Ag (Fig. 4
A). The "innate adjuvant effect" of hsp73 molecules
that facilitates CTL priming (41) does apparently not
operate for priming B cells to the a determinant of HBsAg. However, it
does facilitate priming of Ab responses to the preS domain of HBsAg
(7) or to HBV precore/core Ag domains (R. Schirmbeck,
unpublished data). Hence, we conclude that expression of the a
determinant is sufficient to induce efficient immune responses. The low
Ab response elicited by intracellular T77-SII Ag
was biologically active because it strikingly reduced the HBsAg
antigenemia in HBs-tg mice. This observation is central to our
postulate that biologically functional Abs (cross-)reactive to a
conformational determinant of the native viral Ag are generated in the
system. It is accepted that a conformationally intact a determinant of
HBsAg is required for neutralization. The glycosylated HBsAg particles
produced in the liver of HBs-tg mice contain LS, MS, and S and elicit
a-specific Ab responses when injected into naive hosts
(42). The transient suppression of antigenemia after serum
transfer and the stable suppression of antigenemia after immune cell
transfers suggest that potentially neutralizing Ab responses were
elicited by the vaccine.
Fusing a CTL-defined epitope to the recombinant Ag enhanced the Ab response. This may help to open up Ag-bearing cells in vivo and thereby facilitate recognition of intracellular Ag by B cells. Copriming B cell and CTL immunity can be suppressive or provide help. CTL can selectively kill specific B cells (43, 44) or B cells can tolerize CTL (45, 46, 47). B cells can present Ag to CTL (48, 49, 50) but may preferentially activate Ag-experienced rather than naive T cells (51). Our data provide no evidence for inhibition in copriming B cell and CTL immunity to HBsAg, although both determinants are expected to be presented by the same APC. This is encouraging for the prospects of a polyepitope vaccine containing Ab- and T cell-stimulating determinants.
We have demonstrated the feasibility to 1) selectively express a conformational, Ab-stimulating epitope in a DNA vaccine; 2) model the system in a way that resembles the expression and immunogenicity of two natural variants of the Ag of interest (i.e., the secreted S particle and the intracellular LS protein); and 3) integrate B cell- and CTL-stimulating epitopes into a single polyepitope construct. The system revealed some features that may help in the design of new generations of polyvalent, DNA- or protein-based vaccines.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 P.R. and S.E.K. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Dr. Reinhold Schirmbeck, Institute for Medical Microbiology and Immunology, University of Ulm, Albert Einstein Allee 11, D-89081 Ulm, Germany. E-mail address: reinhold.schirmbeck{at}medizin.uni-ulm.de ![]()
4 Abbreviations used in this paper: HBsAg, hepatitis B surface Ag; HBV, hepatitis B virus; S, small HBsAg; MS, middle (preS2-S) HBsAg; LS, large (preS1-preS2-S) HBsAg; CHO, Chinese hamster ovary; Endo H, endoglycosidase H; ER, endoplasmic reticulum. ![]()
Received for publication January 18, 2002. Accepted for publication June 3, 2002.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. Wahl, W. Muller, F. Leithauser, G. Adler, F. Oswald, J. Reimann, R. Schirmbeck, A. Seier, J. M. Weiss, B. Prochnow, et al. IL-20 Receptor 2 Signaling Down-Regulates Antigen-Specific T Cell Responses J. Immunol., January 15, 2009; 182(2): 802 - 810. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Moldenhauer, S. W. Popov, B. Wotschke, S. Bruderlein, P. Riedl, N. Fissolo, R. Schirmbeck, O. Ritz, P. Moller, and F. Leithauser AID expression identifies interfollicular large B cells as putative precursors of mature B-cell malignancies Blood, March 15, 2006; 107(6): 2470 - 2473. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Hutchings, S. C. Gilbert, A. V. S. Hill, and A. C. Moore Novel Protein and Poxvirus-Based Vaccine Combinations for Simultaneous Induction of Humoral and Cell-Mediated Immunity J. Immunol., July 1, 2005; 175(1): 599 - 606. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Schirmbeck, N. Fissolo, P. Chaplin, and J. Reimann Enhanced Priming of Multispecific, Murine CD8+ T Cell Responses by DNA Vaccines Expressing Stress Protein-Binding Polytope Peptides J. Immunol., August 1, 2003; 171(3): 1240 - 1246. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |