| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
and Ig-
1
* Biologie III, University of Freiburg and Max-Planck-Institute for Immunobiology, Freiburg, Germany;
Department of Immunology, National Jewish Medical and Research Center, Denver, CO 80206;
Howard Hughes Medical Institute, Rockefeller University, New York, NY 10021
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and Ig-
mediate surface expression and signaling of
diverse B cell receptor complexes on precursor, immature, and mature B
cells. Their expression begins before that of the Ig chains in early
progenitor B cells. In this study, we describe the generation of
Ig--deficient mice and their comparative analysis to mice deficient
for Ig-, the membrane-IgM, and recombination-activating gene
2 to determine the requirement of Ig- and Ig- in survival
and differentiation of pro-B cells. We find that in the absence of
Ig-, B cell development does not progress beyond the progenitor
stage, similar to what is observed in humans lacking this molecule.
However, neither in Ig-- nor in Ig--deficient mice are pro-B
cells impaired in V(D)J recombination, in the expression of
intracellular Ig µ-chains, or in surviving in the bone marrow
microenvironment. Finally, Ig- and Ig- are not redundant in their
putative function, as pro-B cells from Ig- and Ig-
double-deficient mice are similar to those from single-deficient
animals in every aspect analyzed. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(CD79a) and Ig- (CD79b) are transmembrane glycoproteins belonging to
the Ig superfamily and encoded by the mb-1 and
B29 genes, respectively. Both proteins are restricted to B
lymphocytes, although B29 transcripts have also been
detected in early thymocytes (1). Both gene transcripts
and their proteins have been detected at every B cell developmental
stage except that of the plasma cell, which express only Ig-
(2, 3, 4, 5). Ig- and Ig- form a disulfide-linked
heterodimer that associates with membrane-bound Ig
(mIg)3 molecules of
every Ig class to form the B cell Ag receptor (BCR) complex. The
variable region of the H and L (IgH and IgL) chains of the mIg
molecules constitute the Ag-binding portion of the BCR, whereas the
Ig-/Ig- heterodimer is its signaling component
(6, 7, 8).
The BCR is first expressed on immature B cells where it signals for IgH
and IgL allelic and isotypic exclusion. Interaction of the BCR with an
Ag at this stage of B cell development results in negative selection
and consequent elimination of the receptor and/or the cell. On the
surface of mature B cells, the BCR seem to give a ligand-independent
signal that is required for the survival of B cells in the periphery
(9). Stimulation of the BCR by Ag induces phosphorylation
of Ig-/Ig- cytoplasmic tyrosine residues, thus increasing their
affinity for intracellular signaling proteins. This initiates a
signaling cascade that can result in proliferation, differentiation, or
death of the mature B cells (10, 11, 12, 13).
Progression through early stages of B cell development is also
determined by Ig-/Ig--mediated signaling. Before expression of
conventional IgL (
or 
) chains, the Ig-/Ig- heterodimer is
part of the pre-BCR complex, which also includes the membrane IgM
(mµ) H chain and the surrogate L chain components 5 and VpreB
(14). Natural and experimental mutations in the
mb-1 and B29 genes of mice and/or humans have
demonstrated the importance of Ig- and Ig- during B cell
development. In the absence of either molecule, no pre-BCR can be
expressed on the cell surface, and B cell development is blocked at the
progenitor- (pro) B cell stage (15, 16). Mice bearing
mutations in or deletions of the cytoplasmic portion of both Ig- and
Ig- also show complete block at the pro-B cell stage of B cell
development (17, 18). However, the same mutations in
either Ig- or Ig- cause a partial block at the pre-B
cell stage and a more severe arrest at the immature B cell stage,
demonstrating that Ig- and Ig- have redundant signaling
functions, at least during pre-BCR signaling (17, 18, 19).
Although the role of Ig-/Ig- in pre-B and B cell development has
been progressively defined, it is still unclear whether these molecules
are also required at the pro-B cell developmental stage. Pro-B cells
are the most immature cells of the B lineage so far identified. They
are characterized by the expression of the pan-B cell marker B220 and
the capacity to differentiate into cells of later B cell developmental
stages in vitro and in vivo. Cells defined as pro-B have been shown to
be heterogeneous in the expression of surface markers like CD19,
heat-stable Ag (HSA), BP-1, CD43, and the rearrangement status
of the IgH locus (20, 21). Based on these differences, the
pro-B cell population has been divided into fractions (A, B, and C)
that are developmentally related (20).
To survive and proliferate, pro-B cells must be able to interact with
intramarrow stromal cells and to react to soluble and membrane factors
that these cells produce (22, 23). Moreover, to
differentiate into pre-B cells, pro-B cells must initiate and
successfully complete the V(D)J recombination program at the IgH locus
(24, 25, 26), and to express an IgH chain capable of pairing
with the surrogate L chains in a functional pre-BCR (27, 28). Signals driving the gradual commitment of pluripotent
hematopietic stem cells to the B cell lineage, the final generation of
pro-B cells, and the initiation of the Ig V(D)J gene recombination are
not well defined. Based on the observation that the surrogate L chains
also assemble on the surface of IgH chain-negative pro-B cells, it was
proposed that membrane protein complexes analogous to pre-BCR and BCR
may regulate some of the survival and differentiation processes in
early pro-B cells (29, 30). However, the signaling
capacity and function of these latter surrogate L chains containing
protein complexes is still unclear. More recently, Ig- and Ig-
have also been found on the surface of IgH chain-negative pro-B cells
in protein complexes that do not contain surrogate L chains, but four
other proteins, one of which has been identified as calnexin (30, 31). The Ig-/Ig--containing protein complexes of early
pro-B cells appear to have some signaling capacity when engaged with
anti-Ig- Abs, resulting in tyrosine phosphorylation of several
substrates, including extracellular signal-regulated kinase
(30). The function of these signaling complexes in pro-B
cells has not been established so far.
To analyze whether Ig- and Ig- are required for pro-B cell
development, we generated mice lacking the expression of the Ig-
molecule and compared pro-B cells of these mice to those of Ig--,
mµ- (µMT) and recombination-activating gene (RAG)2-deficient
mice (15, 32, 33). We find that the IgH chain gene
recombination is not affected in pro-B cells lacking Ig-, Ig-, or
both molecules. Furthermore, the size and phenotype of the pro-B cell
population in these mice is also not affected in vivo.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-/- mice
Two genomic library clones, kindly provided by Dr. N. Sakaguchi
(Kumomoto, Japan), and containing the complete mouse
mb-1 locus from the BALB/c strain (34), were
used for the generation of the targeting vector. The targeting
construct consisted of two mb-1 homologous DNA regions
framing a heterologous fragment. These mb-1 regions were a
3.8-kb DNA fragment 5' of exon II, and a 9.6-kb EcoRI
fragment starting within intron III. A short heterologous sequence (80
bp) containing a loxP site was cloned into the
NheI restriction site of intron I, within the 3.8-kb
mb-1 fragment. A 4.8-kb heterologous DNA fragment
containing, in the following order, EGFP, mb-1
exons V-II cDNA cassette, and loxP-flanked
neor was cloned between the two homologous
mb-1 regions. The targeting vector was initially constructed
to generate at the same time a knockout and a Cre recombinase-dependent
conditional allele of mb-1 capable of expressing either EGFP
or Ig- depending on the orientation of the loxP-flanked
DNA fragment. However, the EGFP and mb-1 DNA
cassettes were found not to be expressed in either cell lines or in
mice, presumably due to the lack of a functional 3' polyA site
(35). Manipulation of BALB/c-derived embryonic stem cells
(36) was performed as described (37). The
Ig--/- mutant mice were bred and maintained
in a barrier mouse facility at the Max Planck Institute for
Immunobiology (Freiburg, Germany).
Mice
RAG2-/- (C57BL/6) (33),
Ig--/- (C57BL/6) (15), and
µMT (C57BL/6) (32) mice were maintained in the specific
pathogen-free facility of the Max Planck Institute. All animal studies
were approved by the German Animal Rights Office.
Southern and Northern analyses
A 271-bp KpnI genomic fragment spanning the end of intron I and two-thirds of exon II was used as a probe to discriminate between wild type (12 kb) and targeted allele (7.6 kb) when hybridized to SphI-digested genomic DNA. For Northern blot analysis, total RNA was purified by TRIzol (Life Technologies, Rockville, MD) from CD19+-sorted bone marrow cells. The 0.4-kb PvuII cDNA fragment spanning exon II to exon V of mb-1 and an actin 0.7-kb genomic fragment were used as probes.
Flow cytometry
Proteins expressed on the surface or intracellularly of isolated
bone marrow and spleen cells were stained as previously described
(38). The Abs for B220, CD19, CD2, CD22, BP-1, CD43, CD25,
CD4, CD8, IL7R, and IL-7R
were purchased from BD PharMingen (San
Diego, CA). FLUOS-conjugated (Boehringer Mannheim, Bergish Gladbach,
Germany) anti-IgM Abs (39) were a kind gift of
Dr. R. Torres and K. Hafen (Basel Institute for Immunology, Basel,
Switzerland). FITC-conjugated polyclonal goat anti-mouse IgM
(Southern Biotechnology Associates, Birmingham, AL) and monoclonal
anti-Ig (39) and anti-IgM (M41; Ref.
40) were used for the intracellular staining. The
streptavidin-RED670 (Life Technologies) and streptavidin-Tri-color
(Caltag Laboratories, Burlingame, CA) reagents were used for the
detection of biotinylated Abs. Stained cells were analyzed on either
FACS or FACSCalibur (BD Biosciences, Mountain View, CA) flow
cytometers.
Semiquantitative PCR
Bone marrow cells were isolated from two mice for each strain. The cells were labeled with anti-CD19-beads (Miltenyi Biotec, Bergish Gladbach, Germany) and the CD19+ cells were purified from the total bone marrow population by MACS (Miltenyi Biotec). Purity was between 75 and 93% in the different samples. In the case of wild-type mice, CD43+CD19+ cells were sorted to 89% purity using a MoFlo high speed sorter (Cytomation, Fort Collins, CO). Genomic DNA from the purified cell populations was quantified by GeneQuantII (Pharmacia Biotech, Uppsala, Sweden) or by Biophotometer (Brinkmann Instruments, Westbury, NJ) and then equilibrated between samples. Five-fold serial dilutions were prepared from each DNA sample. Primers for the PCR analysis of VHDJH joints containing VHJ558 and VH7183 elements were as described (21, 41). The 738-bp actin fragment was amplified by a one-round PCR of 25 cycles using the GGTGTCATGGTAGGTATGGGT and CGCACAATCTCACGTTCAG oligonucleotides. VHDJH joints belonging to the VHJ558 family were amplified in a one round of 25–30 cycles. The VH7183 containing VHDJH rearrangements were amplified by nested PCR in two rounds of 25 and 23 cycles, respectively. The PCR products were hybridized to probes amplified by similar PCR and labeled with 32P-dCTP by Megaprime DNA Labeling System (Amersham, Arlington Heights, IL). The amount of radioactivity of each band was quantified by Bio-Imaging Analyzer (FUJIX, Tokyo, Japan).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-deficient mice
The 34-kDa Ig- protein is encoded by the mb-1 gene
on chromosome 7 in the mouse. The mb-1 locus
(34) is composed of five coding exons distributed over 5
kb of DNA sequence (Fig. 1
a).
Exons I, II, and III encode the leader peptide, extracellular, and
transmembrane domains, respectively. Exons IV and V encode the
intracellular domain (cytoplasmic tail), which contains the
immunoreceptor tyrosine-based activation motif (42).
|
a) carries the endogenous
promoter, but is devoid of exons II and III. Transcription and splicing
of the remaining exons would result in a frame shift that introduces a
stop codon 15 bp after exon I and that directs the synthesis of just
the Ig- leader peptide. Therefore, it was predicted that the
targeted mb-1 allele would be unable to produce a functional
Ig- protein.
Germline transmission of the mb-1 mutation in mice was
detected by PCR (data not shown) and confirmed by Southern blot
analysis of tail genomic DNA (Fig. 1b). The
mb-1-targeted mice were generated and maintained on a BALB/c
genetic background and intercrossed to generate homozygous mutants
(Ig--/-). Northern analysis demonstrates
that CD19+ B cells from
Ig--/- mice do not express mb-1
transcripts (Fig. 1c), possibly due to either RNA
instability caused by the neor cassette or
to nonsense-mediated RNA decay resulting from a premature stop codon
(43). Therefore, we conclude that our targeting strategy
was successful in preventing the expression of any Ig- protein.
Ig- expression is absolutely required for B cell maturation
The generation of B cell was examined in
Ig--/- mice in comparison to that of
wild-type mice. To distinguish the different B cell
developmental stages, bone marrow cells were analyzed by flow cytometry
for the expression of B220, CD19, IgM, and CD2. IgM-expressing immature
and mature B cells were absent in the bone marrow of
Ig--/- mice (Fig. 2a). However, expression of
the pan-B cell markers B220 and CD19 was observed, on average, in 14
and 8.5% of the total cells, respectively (Table I). While B220 is also expressed by cell
progenitors of other lineages, CD19 expression is restricted to B cells
and therefore indicates the presence of cells committed to the B cell
lineage (44, 45). The CD19+ cells of
Ig--/- bone marrows are phenotypically
progenitor B cells as they express the CD43 Ag while they lack the
expression of CD2 and CD25 (Fig. 2b, Table I, and data not
shown) (20, 46, 47, 48). In addition, >80% of these cells
express HSA and 
30% express BP-1 (data not shown); and therefore,
belong to fractions B
(HSA+/BP-1-) and C
(HSA+/BP-1+) using Hardy’s
nomenclature (20). A population of
B220high cells is observed in the marrow of
Ig--/- mice (Fig. 2a). This
population, which is also found in other pro-B cell-blocked mutant
animals such as RAG2-/-, µMT, and
Ig--/- (data not shown), does not express
CD19 or intracellular Ig µ-chains (data not shown), and is likely
composed of non-B lineage cells.
|
|
-/-
pro-B cells are unable to develop into mature B cells. Mature splenic B
cells, which express the CD22 and CD19 Ags, were not observed (Fig. 2c and data not shown). Nevertheless, 10% of
Ig--/- cells in the spleen were found to
express low levels of B220 (data not shown). These latter cells are
probably pro-B and/or non-B cells as they are also found in the spleen
of RAG-deficient mice (33). The frequency of
CD4+ and CD8+ T cells in
the spleen of Ig--/- mice was increased
relative to wild-type controls (Fig. 2c). However, given the
fact that the total number of cells in the spleen of
Ig--/- mice is only one-third of control
animals (data not shown), the absolute number of T cells is actually
reduced by >50% in the absence of Ig- (absolute number of T cells
in spleen is 11.1 ± 6.1 x 106;
n = 4 for Ig--/- and
26.5 ± 5.0 x 106; n =
3 for wild type). This result probably relates to the defect in T cell
expansion and response described in µMT animals
(49).
Thus, the results of the flow cytometric analyses fully support those
from the Northern analysis and demonstrate that the targeted
mb-1 allele is not capable to direct the expression of a
functional Ig- protein. Commitment of hematopoietic stem cells to
the B cell lineage does occur in the absence of Ig-, but this
molecule is absolutely required for further development to the pre-B,
immature, and mature B cell stages. A similar phenotype has been
observed in humans bearing a mutation that prevents Ig- expression
(16). Thus, Ig- is similarly required for both human
and mouse B cell development.
Ig gene rearrangement and expression is not altered in the absence
of either Ig- or Ig-
VHDJH-rearranged IgH
chain genes are first found in pro-B cells of fractions B
(50). However, the signal, if any, that induces the
initiation of the VHDJH
recombination process in these cells has not yet been identified. It
has been speculated that Ig-/Ig--containing protein complexes on
pro-B cells might signal for
VHDJH recombination and/or
for the survival of cells that have undergone this process (51, 52).
To analyze whether Ig- and Ig- affect development and/or survival
of pro-B cells that carry
VHDJH rearrangements, we
analyzed the frequency of rearranged IgH genes in cells derived from
the bone marrow of Ig-- and Ig--deficient mice, in comparison to
those derived from other mutant strains.
RAG2-/- mice were used as a negative control,
because they cannot undergo V(D)J recombination (33). The
µMT mice, which carry a disruption of one of the membrane exons of
the µ-chain gene, were used as a positive control. The B cell
progenitors of these mice rearrange normally the IgH locus, but cannot
express a µ-chain on the cell surface and are consequently blocked in
development due to the inability to express a pre-BCR (32, 53). Nevertheless, the frequency of
VHDJH rearrangements found
in µMT pro-B cells is equivalent, if not higher, of that found in
wild-type pro-B cells (50). The
CD19+CD43+ bone marrow
fraction from wild-type mice, which comprises the pro-B cell
population, was also used as a positive control in one analysis.
However, 30% of this population is composed of large, cycling pre-B
cells that have developed based upon productive IgH chain gene
rearrangements; and therefore, is expected to contain a higher
frequency of VHDJH products
(50).
The frequency of VHDJH
joints using either VH elements of the
JH-distal J558 or the
JH-proximal 7183 VH
families was assessed by semiquantitative PCR on genomic DNA isolated
from purified CD19+(CD43+)
bone marrow cells (Fig. 3). In this
analysis, four products of different size are dominantly amplified and
these represent VHDJH
joints using one of four different JH gene
segments (21, 41). To normalize for the amount of template
DNA in each sample, we used primers designed to specifically amplify a
portion of the actin gene (Fig. 3, b and c). By
comparing the degree of amplification of the V(D)J fragments between
samples normalized for actin levels, we found that the frequency of
VHDJH joints in Ig-- and
Ig--deficient pro-B cells was similar to that found in µMT and
wild-type pro-B cells. Thus, these data demonstrate that neither Ig-
nor Ig- is required for V(D)J recombination at the IgH locus.
|
-deficient mice express µ
or Dµ-chains intracellularly (Fig. 4
and Table I). In line with the PCR results, the flow cytometric
analysis shows that the frequencies of µ-expressing pro-B cells in
Ig-- and Ig--deficient mice are similar to those found in µMT
and wild-type mice (Fig. 4 and Table I). In this analysis, we also
observed that many of the mutant pro-B cells express lower levels of
µ compared with wild type (notice the shoulder in the histogram of
mutants vs the discrete population in that of the wild type in Fig. 4),
probably reflecting the lower stability of µ-chains in the absence of
one of the interacting protein partners (Ig-, Ig-, or both for
soluble µ) in the mutant animals. In contrast to pro-B cells, the
frequency of µ+ cells in the wild-type pre-B
cell population is 5-fold higher than that of the pro-B cell
populations (Fig. 4). This difference is due to the fact that only
µ-expressing cells can differentiate into pre-B cells and only when
the µ-chains form a functional pre-BCR with Ig- and Ig-. A
small number of the pro-B cells (1–3%) from the different mutant mice
(except RAG2) express L chains (Table I).
|
and Ig- might be necessary for this developmental step. Bone
marrow B220+CD19- and
B220+CD19+ cell populations
of Ig-- and Ig--deficient mice were found in similar numbers to
those of µMT and RAG-deficient mice (Table I and data not shown). In
addition, similar frequencies of cells appeared to be in cycle,
as judged by flow cytometric analysis of DNA stained by propidium
iodide (data not shown). Finally, similar frequencies were also found
to express IL-7R ( and ) on the cell surface (data not shown), a
molecule necessary for pro-B cell survival and proliferation in the
bone marrow stroma microenvironment.
Thus, Ig- and Ig- have no apparent influence on either the onset
of VH to DJH recombination,
or on the survival and proliferation of cells that carry
VHDJH rearrangements.
Nevertheless, these molecules are essential for the development and,
most likely, the expansion of pre-B cells that carry productively
rearranged IgH genes.
Ig- and Ig- have no redundant function in pro-B cell
differentiation
Studies in cell lines have shown that Ig- molecules can also be
expressed on the cell surface in the absence of Ig-, suggesting that
Ig- and Ig- may function independently of each other in pro-B
cells (31). To exclude the possibility that Ig- and
Ig- have a redundant signaling function in the initiation and/or
completion of the VHDJH
recombination process, Ig-- and Ig--double-deficient mice
(Ig-/-;Ig-/-)
were generated. In these latter animals, we analyzed the frequency of
VHJ558L to DJH
rearrangements and intracellular Igµ expression in cells belonging to
the pro-B cell population.
We found that pro-B cells from
Ig-/-;Ig-/- mice
have a similar frequency of
VHDJH rearrangements to
those isolated from Ig--only-deficient mice (Fig. 5a). Moreover, the frequency
of pro-B cells that carry productive
VHDJH rearrangements and
express µ-chains in the cytoplasm is also similar between mice that
lack either Ig- or Ig- or both of these molecules (Fig. 5b and Table I). Bone marrow cells of
Ig-/-;Ig-/- mice
were stained for B220 and CD19 to determine the frequency and absolute
number of pro-B cells. We found that in the absence of both Ig- and
Ig- molecules, the absolute number of
B220+CD19- and
B220+CD19+ bone marrow
cells is not significantly different from that observed in
single-deficient animals (data not shown and Table I). However, these
results would need to be confirmed with mutant animals on the same
genetic backgrounds.
|
and Ig-
molecules. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
/Ig- heterodimer plays a role in the transport of the mIg
molecules onto the cell surface and mediates pre-BCR and BCR signaling
(13). Several in vivo studies have shown that expression
and signaling of the pre-BCR and BCR are prerequisite to complete the
development of B lymphocytes (15, 16, 18, 19, 32, 33, 57, 58, 59, 60). We find that Ig--deficient mice have a block in B
cell development that is similar to mice lacking Ig- or mµ
expression. In the absence of Ig-, B cell development is arrested at
the pro-B cell stage, as these cells are unable to express a
pre-BCR.
The complete absence of pre-B, immature B, and mature B cells in
Ig--deficient mice demonstrates that, in vivo, Ig- alone is not
able to promote B cell development. In mice expressing chimeric
IgM/Ig- fusion proteins and in mice lacking two-thirds of the
cytoplasmic tail of Ig- including the immunoreceptor tyrosine-based
activation motif, Ig- reaches the cell surface and the signals
transduced by the Ig- molecule alone in this context are sufficient
for the transition of pro-B to pre-B and the generation of immature B
cells (19, 61, 62). Therefore, our data suggest that the
absence of any further differentiation in Ig--deficient pro-B cells
could be strictly related to the inability of the Ig- molecules to
be stably expressed on the cell surface in absence of Ig-. This
hypothesis would need to be tested biochemically, as the level of
Ig- on the surface of pro-B cells is too low to be detected by flow
cytometric analysis (Ref. 51 and data not shown). A human
patient carrying a mutation that prevents Ig- expression was shown
to lack pre-B, immature, and mature B cells as well (16).
Thus, development of B cells is absolutely dependent on Ig-
expression in both mice and humans.
Ig-- and Ig--deficient mice allow us to investigate the
requirement of these proteins at early stages of B cell development. A
surface protein complex (pro-BCR) has been speculated to exist and to
signal in pro-B cells the initiation and completion of
VHDJH recombination
(29, 30, 51, 52). This putative pro-BCR, in analogy to the
pre-BCR, would also be envisioned to use Ig- and Ig- as signal
transducers. Both proteins are indeed expressed on the surface of
murine pro-B cells in signaling competent protein complexes that do not
contain Ig chains (31, 51).
In this study, we have assessed the function of Ig- and Ig- in
VHDJH recombination by
comparing the frequency of
VHDJH joints using elements
of the VHJ558 and VH7183
families. In addition, pro-B cells of the mutant animals were tested
for µ-chain production. These analyses indicate that
VHDJH recombination is
independent of Ig- or Ig- expression. Indeed, a similar frequency
of VHDJH joints and of
intracellular µ-chain-expressing cells was observed in
Ig--deficient, Ig--deficient, µMT, and wild-type pro-B cell
populations. These data agree with those obtained from pro-B cells of a
human Ig--deficient patient that also showed to have normal
frequency of V(D)J recombination at the IgH locus (16). A
previous analysis indicated that Ig--/-
pro-B cells had decreased levels of V(D)J joints compared with
wild-type pro-B cells and a block at the null pre-B or pre-BI stage of
development (15). These earlier results had been
interpreted to suggest that Ig--derived signals might be involved in
the onset of VH to DJH
recombination or selection of successfully recombined IgH genes
(15, 51, 52, 63). This early analysis was performed on the
B220+CD43+ population that
contains a large amount of V(D)J-selected pre-B cells in wild-type mice
and, in proportion, a large amount of
B220+CD19- non-pro-B cell
progenitors in the Ig--/- mice, while the
current analysis has been conducted on the
CD19+CD43+ cell population
and compared with µMT as well as wild type. The difference in cell
sorting procedures used in this work might explain why our results
appear contradictory to those previously published. However, in a
follow-up analysis, the frequency of intracellular µ-chain-positive
pro-B cells of Ig--/- mice was found
comparable to that of wild type, when pre-B cell contaminants were
excluded from the pro-B cell population analyzed by sorting
B220+CD43+CD25-
cells (17). Thus, in summary these data demonstrate that
Ig- and Ig- are not necessary for the initiation and completion
of V(D)J recombination at the IgH locus, but they are for the selection
and expansion of cells that express the product of a productively
rearranged VHDJH
gene.
Positive selection and expansion of cells that carry productively
rearranged IgH loci, an event that marks the pro-B to pre-B cell
transition, is only observed in mice that express all the components of
the pre-BCR complex. In lymphoid hematopoietic stem cells committed to
the B cell lineage, the transcription of the Rag1,
Rag2, TdT, 5, VpreB,
B29, and mb-1 genes is up-regulated before
rearrangement and expression of the Ig genes (64). Thus,
expression of the proteins encoded by these genes, together with the
accessibility of the germline IgH locus identified by its early
transcription, may be sufficient for the initiation of D to
JH and, subsequently, VH to
DJH recombination, without the need of a specific
signaling event.
We have also examined whether the Ig-/Ig- heterodimer influences
the capacity of pro-B cells to proliferate, survive, and differentiate
within the bone marrow environment and to express a functional IL-7R,
which is necessary for these functions (65, 66). During
the early stages of B cell development, B220+
pro-B cells differentiate from CD19- (fraction
A) to CD19+ (fraction B). This differentiation is
accompanied by an increased expression of the transcription factors
E12, E47, and Pax5, and the up-regulation of Rag1,
Rag2, 5, mb-1, and B29
gene transcription (45, 56). This differentiation also
marks the final commitment of oligopotent stem cells to the B lineage
(67). We have found that the absolute number of fraction A
and fraction B bone marrow pro-B cells does not significantly differ in
mice deficient for either Ig- or Ig- relative to that of µMT
and RAG2-deficient animals. In addition, we found that lack of Ig-
or Ig- expression does not influence entry into the cell cycle or
expression of IL-7R and IL-7R (data not shown). Thus, these data
indicate that progressive differentiation of pro-B cells and their
survival in the bone marrow environment do not require expression of
Ig- or Ig-.
Finally, we have evaluated the possibility that Ig- and Ig- might
be redundant in their signaling role in the context of pro-B cell
development and differentiation, given that Ig- has been found on
the surface of these cells, even in the absence of Ig-. We have
found that pro-B cells lacking in the expression of both molecules
(Ig- and Ig-) are still able to undergo
VHDJH recombination and
produce intracellular µ-chain at frequencies similar to those
observed for single-deficient pro-B cells. Moreover, double-deficient
pro-B cells are also capable to differentiate into fraction B, judging
by the coexpression of the CD19 and B220 surface markers.
In conclusion, our data demonstrate that commitment to the B cell
lineage and survival of pro-B cells in the bone marrow
microenvironment, as well initiation and completion of V(D)J
recombination at the IgH locus, do not require expression of Ig-,
Ig-, or both molecules.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Roberta Pelanda, Department of Immunology, National Jewish Medical and Research Center, 1400 Jackson Street, Denver, CO 80206. E-mail address: pelandar{at}njc.org
3 Abbreviations used in this paper: mIg, membrane-bound Ig; BCR, B cell Ag receptor; mµ, membrane IgM; HSA, heat-stable Ag; pro, progenitor.
Received for publication February 15, 2002. Accepted for publication May 9, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(B29) in thymocytes: positive and negative gene regulation to establish T cell identity. Proc. Natl. Acad. Sci. USA 95:6831. and Ig- components of the IgM antigen receptor complex by amino-terminal sequencing. Eur. J. Immunol. 20:2795.[Medline]
. Science 272:411.[Abstract]
(CD79a) result in a complete block in B-cell development. J. Clin. Invest. 104:1115.[Medline]
. J. Exp. Med. 193:13. immunoreceptor tyrosine-based activation motif (ITAM) phosphorylation modulates or blocks B cell development, depending on the availability of an Ig cytoplasmic tail. J. Exp. Med. 194:455.5 is expressed on the surface of mouse pre-B cell lines and can function as a signal transducing molecule. Int. Immunol. 3:1129.5 surrogate light chain on the surface of µ heavy chain-negative early precursor B cell lines. J. Exp. Med. 178:469./CD79 heterodimers are expressed on pro-B cell surfaces without associated µ heavy chain. Int. Immunol. 9:1767. transgene, but not VJ gene segment targeted into the Ig locus, can rescue B cell development in 5-deficient mice. Immunity 5:229.[Medline]
chain (CD25, TAC) expression defines a crucial stage in pre-B cell development. Int. Immunol. 6:1257./Ig heterodimer on µ-negative proB cells is competent for transducing signals to induce early B cell differentiation. Immunity 7:559.[Medline]
5 protein in B cell development. Cell 69:823.[Medline]
-Ig. J. Exp. Med. 184:2079. and Ig can independently induce the precursor B cell transition and allelic exclusion. J. Exp. Med. 182:1389. and Ig cytoplasmic domains are independently sufficient to signal B cell maturation and activation in transgenic mice. J. Exp. Med. 185:1753.This article has been cited by other articles:
|
|
 |
|
  X. Zou, M. J. Osborn, D. J. Bolland, J. A. Smith, D. Corcos, M. Hamon, D. Oxley, A. Hutchings, G. Morgan, F. Santos, et al. Heavy chain only antibodies are spontaneously produced in light chain deficient mice J. Exp. Med., December 24, 2007; 204(13): 3271 - 3283. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. K. Dobbs, T. Yang, D. Farmer, L. Kager, O. Parolini, and M. E. Conley Cutting Edge: A Hypomorphic Mutation in Igbeta (CD79b) in a Patient with Immunodeficiency and a Leaky Defect in B Cell Development J. Immunol., August 15, 2007; 179(4): 2055 - 2059. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ma, A. Turetsky, L. Trinh, and R. Lu IFN Regulatory Factor 4 and 8 Promote Ig Light Chain {kappa} Locus Activation in Pre-B Cell Development J. Immunol., December 1, 2006; 177(11): 7898 - 7904. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Hobeika, S. Thiemann, B. Storch, H. Jumaa, P. J. Nielsen, R. Pelanda, and M. Reth Testing gene function early in the B cell lineage in mb1-cre mice PNAS, September 12, 2006; 103(37): 13789 - 13794. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. R. Hardy B-1 B cell development. J. Immunol., September 1, 2006; 177(5): 2749 - 2754. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Borsutzky, K. Kretschmer, P. D. Becker, P. F. Muhlradt, C. J. Kirschning, S. Weiss, and C. A. Guzman The Mucosal Adjuvant Macrophage-Activating Lipopeptide-2 Directly Stimulates B Lymphocytes via the TLR2 without the Need of Accessory Cells J. Immunol., May 15, 2005; 174(10): 6308 - 6313. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Rangel, M. R. McKeller, J. C. Sims-Mourtada, C. Kashi, K. Cain, E. D. Wieder, J. J. Molldrem, L. V. Pham, R. J. Ford, P. Yotnda, et al. Assembly of the {kappa} PreB Receptor Requires a V{kappa}-like Protein Encoded by a Germline Transcript J. Biol. Chem., May 6, 2005; 280(18): 17807 - 17814. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. R. Galler, C. Mundt, M. Parker, R. Pelanda, I.-L. Martensson, and T. H. Winkler Surface {micro} Heavy Chain Signals Down-Regulation of the V(D)J-Recombinase Machinery in the Absence of Surrogate Light Chain Components J. Exp. Med., June 7, 2004; 199(11): 1523 - 1532. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Pike, S. Iacampo, J. E. Friedmann, and M. J. H. Ratcliffe The Cytoplasmic Domain of Ig{alpha} Is Necessary and Sufficient to Support Efficient Early B Cell Development J. Immunol., February 15, 2004; 172(4): 2210 - 2218. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-w. Su, A. Flemming, T. Wossning, E. Hobeika, M. Reth, and H. Jumaa Identification of a Pre-BCR Lacking Surrogate Light Chain J. Exp. Med., December 1, 2003; 198(11): 1699 - 1706. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Schuh, S. Meister, E. Roth, and H.-M. Jack Cutting Edge: Signaling and Cell Surface Expression of a {micro}H Chain in the Absence of {lambda}5: A Paradigm Revisited J. Immunol., October 1, 2003; 171(7): 3343 - 3347. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Mielenz, A. Ruschel, C. Vettermann, and H.-M. Jack Immunoglobulin {micro} Heavy Chains Do Not Mediate Tyrosine Phosphorylation of Ig{alpha} from the ER-cis-Golgi J. Immunol., September 15, 2003; 171(6): 3091 - 3101. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Bradl, J. Wittmann, D. Milius, C. Vettermann, and H.-M. Jack Interaction of Murine Precursor B Cell Receptor with Stroma Cells Is Controlled by the Unique Tail of {lambda}5 and Stroma Cell-Associated Heparan Sulfate J. Immunol., September 1, 2003; 171(5): 2338 - 2348. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
