The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pelanda, R.
Right arrow Articles by Reth, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pelanda, R.
Right arrow Articles by Reth, M.
The Journal of Immunology, 2002, 169: 865-872.
Copyright © 2002 by The American Association of Immunologists

B Cell Progenitors Are Arrested in Maturation but Have Intact VDJ Recombination in the Absence of Ig-{alpha} and Ig-{beta}1

Roberta Pelanda2,*,{dagger}, Uschi Braun*, Elias Hobeika*, Michel C. Nussenzweig{ddagger} and Michael Reth*

* Biologie III, University of Freiburg and Max-Planck-Institute for Immunobiology, Freiburg, Germany; {dagger} Department of Immunology, National Jewish Medical and Research Center, Denver, CO 80206; {ddagger} Howard Hughes Medical Institute, Rockefeller University, New York, NY 10021


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ig-{alpha} and Ig-{beta} mediate surface expression and signaling of diverse B cell receptor complexes on precursor, immature, and mature B cells. Their expression begins before that of the Ig chains in early progenitor B cells. In this study, we describe the generation of Ig-{alpha}-deficient mice and their comparative analysis to mice deficient for Ig-{beta}, the membrane-IgM, and recombination-activating gene 2 to determine the requirement of Ig-{alpha} and Ig-{beta} in survival and differentiation of pro-B cells. We find that in the absence of Ig-{alpha}, B cell development does not progress beyond the progenitor stage, similar to what is observed in humans lacking this molecule. However, neither in Ig-{alpha}- nor in Ig-{beta}-deficient mice are pro-B cells impaired in V(D)J recombination, in the expression of intracellular Ig µ-chains, or in surviving in the bone marrow microenvironment. Finally, Ig-{alpha} and Ig-{beta} are not redundant in their putative function, as pro-B cells from Ig-{alpha} and Ig-{beta} double-deficient mice are similar to those from single-deficient animals in every aspect analyzed.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Immunoglobulin-{alpha} (CD79a) and Ig-{beta} (CD79b) are transmembrane glycoproteins belonging to the Ig superfamily and encoded by the mb-1 and B29 genes, respectively. Both proteins are restricted to B lymphocytes, although B29 transcripts have also been detected in early thymocytes (1). Both gene transcripts and their proteins have been detected at every B cell developmental stage except that of the plasma cell, which express only Ig-{beta} (2, 3, 4, 5). Ig-{alpha} and Ig-{beta} form a disulfide-linked heterodimer that associates with membrane-bound Ig (mIg)3 molecules of every Ig class to form the B cell Ag receptor (BCR) complex. The variable region of the H and L (IgH and IgL) chains of the mIg molecules constitute the Ag-binding portion of the BCR, whereas the Ig-{alpha}/Ig-{beta} heterodimer is its signaling component (6, 7, 8).

The BCR is first expressed on immature B cells where it signals for IgH and IgL allelic and isotypic exclusion. Interaction of the BCR with an Ag at this stage of B cell development results in negative selection and consequent elimination of the receptor and/or the cell. On the surface of mature B cells, the BCR seem to give a ligand-independent signal that is required for the survival of B cells in the periphery (9). Stimulation of the BCR by Ag induces phosphorylation of Ig-{alpha}/Ig-{beta} cytoplasmic tyrosine residues, thus increasing their affinity for intracellular signaling proteins. This initiates a signaling cascade that can result in proliferation, differentiation, or death of the mature B cells (10, 11, 12, 13).

Progression through early stages of B cell development is also determined by Ig-{alpha}/Ig-{beta}-mediated signaling. Before expression of conventional IgL ({kappa} or {lambda}) chains, the Ig-{alpha}/Ig-{beta} heterodimer is part of the pre-BCR complex, which also includes the membrane IgM (mµ) H chain and the surrogate L chain components {lambda}5 and VpreB (14). Natural and experimental mutations in the mb-1 and B29 genes of mice and/or humans have demonstrated the importance of Ig-{alpha} and Ig-{beta} during B cell development. In the absence of either molecule, no pre-BCR can be expressed on the cell surface, and B cell development is blocked at the progenitor- (pro) B cell stage (15, 16). Mice bearing mutations in or deletions of the cytoplasmic portion of both Ig-{alpha} and Ig-{beta} also show complete block at the pro-B cell stage of B cell development (17, 18). However, the same mutations in either Ig-{alpha} or Ig-{beta} cause a partial block at the pre-B cell stage and a more severe arrest at the immature B cell stage, demonstrating that Ig-{alpha} and Ig-{beta} have redundant signaling functions, at least during pre-BCR signaling (17, 18, 19).

Although the role of Ig-{alpha}/Ig-{beta} in pre-B and B cell development has been progressively defined, it is still unclear whether these molecules are also required at the pro-B cell developmental stage. Pro-B cells are the most immature cells of the B lineage so far identified. They are characterized by the expression of the pan-B cell marker B220 and the capacity to differentiate into cells of later B cell developmental stages in vitro and in vivo. Cells defined as pro-B have been shown to be heterogeneous in the expression of surface markers like CD19, heat-stable Ag (HSA), BP-1, CD43, and the rearrangement status of the IgH locus (20, 21). Based on these differences, the pro-B cell population has been divided into fractions (A, B, and C) that are developmentally related (20).

To survive and proliferate, pro-B cells must be able to interact with intramarrow stromal cells and to react to soluble and membrane factors that these cells produce (22, 23). Moreover, to differentiate into pre-B cells, pro-B cells must initiate and successfully complete the V(D)J recombination program at the IgH locus (24, 25, 26), and to express an IgH chain capable of pairing with the surrogate L chains in a functional pre-BCR (27, 28). Signals driving the gradual commitment of pluripotent hematopietic stem cells to the B cell lineage, the final generation of pro-B cells, and the initiation of the Ig V(D)J gene recombination are not well defined. Based on the observation that the surrogate L chains also assemble on the surface of IgH chain-negative pro-B cells, it was proposed that membrane protein complexes analogous to pre-BCR and BCR may regulate some of the survival and differentiation processes in early pro-B cells (29, 30). However, the signaling capacity and function of these latter surrogate L chains containing protein complexes is still unclear. More recently, Ig-{alpha} and Ig-{beta} have also been found on the surface of IgH chain-negative pro-B cells in protein complexes that do not contain surrogate L chains, but four other proteins, one of which has been identified as calnexin (30, 31). The Ig-{alpha}/Ig-{beta}-containing protein complexes of early pro-B cells appear to have some signaling capacity when engaged with anti-Ig-{beta} Abs, resulting in tyrosine phosphorylation of several substrates, including extracellular signal-regulated kinase (30). The function of these signaling complexes in pro-B cells has not been established so far.

To analyze whether Ig-{alpha} and Ig-{beta} are required for pro-B cell development, we generated mice lacking the expression of the Ig-{alpha} molecule and compared pro-B cells of these mice to those of Ig-{beta}-, mµ- (µMT) and recombination-activating gene (RAG)2-deficient mice (15, 32, 33). We find that the IgH chain gene recombination is not affected in pro-B cells lacking Ig-{alpha}, Ig-{beta}, or both molecules. Furthermore, the size and phenotype of the pro-B cell population in these mice is also not affected in vivo.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of Ig-{alpha}-/- mice

Two genomic library clones, kindly provided by Dr. N. Sakaguchi (Kumomoto, Japan), and containing the complete mouse mb-1 locus from the BALB/c strain (34), were used for the generation of the targeting vector. The targeting construct consisted of two mb-1 homologous DNA regions framing a heterologous fragment. These mb-1 regions were a 3.8-kb DNA fragment 5' of exon II, and a 9.6-kb EcoRI fragment starting within intron III. A short heterologous sequence (80 bp) containing a loxP site was cloned into the NheI restriction site of intron I, within the 3.8-kb mb-1 fragment. A 4.8-kb heterologous DNA fragment containing, in the following order, EGFP, mb-1 exons V-II cDNA cassette, and loxP-flanked neor was cloned between the two homologous mb-1 regions. The targeting vector was initially constructed to generate at the same time a knockout and a Cre recombinase-dependent conditional allele of mb-1 capable of expressing either EGFP or Ig-{alpha} depending on the orientation of the loxP-flanked DNA fragment. However, the EGFP and mb-1 DNA cassettes were found not to be expressed in either cell lines or in mice, presumably due to the lack of a functional 3' polyA site (35). Manipulation of BALB/c-derived embryonic stem cells (36) was performed as described (37). The Ig-{alpha}-/- mutant mice were bred and maintained in a barrier mouse facility at the Max Planck Institute for Immunobiology (Freiburg, Germany).

Mice

RAG2-/- (C57BL/6) (33), Ig-{beta}-/- (C57BL/6) (15), and µMT (C57BL/6) (32) mice were maintained in the specific pathogen-free facility of the Max Planck Institute. All animal studies were approved by the German Animal Rights Office.

Southern and Northern analyses

A 271-bp KpnI genomic fragment spanning the end of intron I and two-thirds of exon II was used as a probe to discriminate between wild type (12 kb) and targeted allele (7.6 kb) when hybridized to SphI-digested genomic DNA. For Northern blot analysis, total RNA was purified by TRIzol (Life Technologies, Rockville, MD) from CD19+-sorted bone marrow cells. The 0.4-kb PvuII cDNA fragment spanning exon II to exon V of mb-1 and an actin 0.7-kb genomic fragment were used as probes.

Flow cytometry

Proteins expressed on the surface or intracellularly of isolated bone marrow and spleen cells were stained as previously described (38). The Abs for B220, CD19, CD2, CD22, BP-1, CD43, CD25, CD4, CD8, IL7R{alpha}, and IL-7R{gamma} were purchased from BD PharMingen (San Diego, CA). FLUOS-conjugated (Boehringer Mannheim, Bergish Gladbach, Germany) anti-IgM Abs (39) were a kind gift of Dr. R. Torres and K. Hafen (Basel Institute for Immunology, Basel, Switzerland). FITC-conjugated polyclonal goat anti-mouse IgM (Southern Biotechnology Associates, Birmingham, AL) and monoclonal anti-Ig{kappa} (39) and anti-IgM (M41; Ref. 40) were used for the intracellular staining. The streptavidin-RED670 (Life Technologies) and streptavidin-Tri-color (Caltag Laboratories, Burlingame, CA) reagents were used for the detection of biotinylated Abs. Stained cells were analyzed on either FACS or FACSCalibur (BD Biosciences, Mountain View, CA) flow cytometers.

Semiquantitative PCR

Bone marrow cells were isolated from two mice for each strain. The cells were labeled with anti-CD19-beads (Miltenyi Biotec, Bergish Gladbach, Germany) and the CD19+ cells were purified from the total bone marrow population by MACS (Miltenyi Biotec). Purity was between 75 and 93% in the different samples. In the case of wild-type mice, CD43+CD19+ cells were sorted to 89% purity using a MoFlo high speed sorter (Cytomation, Fort Collins, CO). Genomic DNA from the purified cell populations was quantified by GeneQuantII (Pharmacia Biotech, Uppsala, Sweden) or by Biophotometer (Brinkmann Instruments, Westbury, NJ) and then equilibrated between samples. Five-fold serial dilutions were prepared from each DNA sample. Primers for the PCR analysis of VHDJH joints containing VHJ558 and VH7183 elements were as described (21, 41). The 738-bp actin fragment was amplified by a one-round PCR of 25 cycles using the GGTGTCATGGTAGGTATGGGT and CGCACAATCTCACGTTCAG oligonucleotides. VHDJH joints belonging to the VHJ558 family were amplified in a one round of 25–30 cycles. The VH7183 containing VHDJH rearrangements were amplified by nested PCR in two rounds of 25 and 23 cycles, respectively. The PCR products were hybridized to probes amplified by similar PCR and labeled with 32P-dCTP by Megaprime DNA Labeling System (Amersham, Arlington Heights, IL). The amount of radioactivity of each band was quantified by Bio-Imaging Analyzer (FUJIX, Tokyo, Japan).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of Ig-{alpha}-deficient mice

The 34-kDa Ig-{alpha} protein is encoded by the mb-1 gene on chromosome 7 in the mouse. The mb-1 locus (34) is composed of five coding exons distributed over 5 kb of DNA sequence (Fig. 1Goa). Exons I, II, and III encode the leader peptide, extracellular, and transmembrane domains, respectively. Exons IV and V encode the intracellular domain (cytoplasmic tail), which contains the immunoreceptor tyrosine-based activation motif (42).



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 1. Strategy for the generation of Ig-{alpha}-deficient mice. a, Representation (not to scale) of wild-type and targeted mb-1 alleles. The targeting vector was constructed to generate both a knockout and a Cre recombinase-dependent conditional allele of mb-1 capable to express either EGFP or Ig-{alpha} depending on the orientation of the loxP-flanked DNA fragment. However, the EGFP and mb-1 DNA cassettes were not expressed and the targeted mb-1 allele carries the endogenous promoter, but is devoid of the endogenous mb-1 exons II and III. The gray circles represent the mb-1 promoter. The gray boxes represent the mb-1 exons and the black box adjoined to exon V indicates the 3' untranslated region that terminates with the mb-1 polyA sequence. The triangles represent loxP sites, the rectangle with diagonal stripes corresponds to the EGFP gene cassette, and the rectangle following the EGFP represents mb-1 exons V-II coding regions (these two gene cassette were not expressed, data not shown). An empty box flanked by two loxP sites represents the neor DNA cassette. Arrows indicate direction of transcription. The SphI fragments relative to the wild type and the targeted alleles are indicated. b, Southern blot analysis of tail genomic DNA of littermate mice derived from the breeding of heterozygous mutant animals. The DNA was digested by SphI and hybridized by a probe corresponding to the KpnI 271 bp genomic DNA fragment spanning the end of intron I and two-thirds of exon II. The expected wild-type (12-kb) and targeted (7.6-kb) fragments are indicated by arrows. Mice carrying wild-type, heterozygous, and homozygous mutant alleles are represented by +/+, +/-, and -/-, respectively. The band running above the wild type in the sixth lane resulted from incomplete DNA digestion. c, Northern blot analysis of mb-1 transcripts. Total RNA from RAG2-/- and Ig-{alpha}-/- bone marrow CD19+ cells was hybridized with a cDNA probe spanning exons II to V of mb-1. The same blot was stripped and rehybridized with an actin-specific probe for a loading control.

 
Mice harboring a null mb-1 allele were generated by genetic manipulation of BALB/c-derived embyronic stem cells following standard procedures (37). Specifically, the targeted mb-1 allele (Fig. 1Goa) carries the endogenous promoter, but is devoid of exons II and III. Transcription and splicing of the remaining exons would result in a frame shift that introduces a stop codon 15 bp after exon I and that directs the synthesis of just the Ig-{alpha} leader peptide. Therefore, it was predicted that the targeted mb-1 allele would be unable to produce a functional Ig-{alpha} protein.

Germline transmission of the mb-1 mutation in mice was detected by PCR (data not shown) and confirmed by Southern blot analysis of tail genomic DNA (Fig. 1Gob). The mb-1-targeted mice were generated and maintained on a BALB/c genetic background and intercrossed to generate homozygous mutants (Ig-{alpha}-/-). Northern analysis demonstrates that CD19+ B cells from Ig-{alpha}-/- mice do not express mb-1 transcripts (Fig. 1Goc), possibly due to either RNA instability caused by the neor cassette or to nonsense-mediated RNA decay resulting from a premature stop codon (43). Therefore, we conclude that our targeting strategy was successful in preventing the expression of any Ig-{alpha} protein.

Ig-{alpha} expression is absolutely required for B cell maturation

The generation of B cell was examined in Ig-{alpha}-/- mice in comparison to that of wild-type mice. To distinguish the different B cell developmental stages, bone marrow cells were analyzed by flow cytometry for the expression of B220, CD19, IgM, and CD2. IgM-expressing immature and mature B cells were absent in the bone marrow of Ig-{alpha}-/- mice (Fig. 2Goa). However, expression of the pan-B cell markers B220 and CD19 was observed, on average, in 14 and 8.5% of the total cells, respectively (Table IGo). While B220 is also expressed by cell progenitors of other lineages, CD19 expression is restricted to B cells and therefore indicates the presence of cells committed to the B cell lineage (44, 45). The CD19+ cells of Ig-{alpha}-/- bone marrows are phenotypically progenitor B cells as they express the CD43 Ag while they lack the expression of CD2 and CD25 (Fig. 2Gob, Table IGo, and data not shown) (20, 46, 47, 48). In addition, >80% of these cells express HSA and ~30% express BP-1 (data not shown); and therefore, belong to fractions B (HSA+/BP-1-) and C (HSA+/BP-1+) using Hardy’s nomenclature (20). A population of B220high cells is observed in the marrow of Ig-{alpha}-/- mice (Fig. 2Goa). This population, which is also found in other pro-B cell-blocked mutant animals such as RAG2-/-, µMT, and Ig-{beta}-/- (data not shown), does not express CD19 or intracellular Ig µ-chains (data not shown), and is likely composed of non-B lineage cells.



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 2. Ig-{alpha}-deficient B cells do not express surface Ig molecules and are blocked in development. Bone marrow and spleen cells of wild-type and Ig-{alpha}-/- mice were analyzed by flow cytometry for the expression of surface markers. Cells falling in the lymphocyte gate are shown. a, Analysis of B220 and IgM expression on cells in the bone marrow. b, Analysis of CD19 and CD2 expression on cells in the bone marrow. c, Analysis of CD22, CD4, and CD8 expression on lymphocytes in the spleen. Numbers refer to the frequency of cells expressing the B cell marker CD22 or the T cell marker CD4 and CD8.

 

View this table:
[in this window]
[in a new window]
 
Table I. Frequency of bone marrow B cells in wild-type and mutant mice

 
Analysis of the spleen confirmed that Ig-{alpha}-/- pro-B cells are unable to develop into mature B cells. Mature splenic B cells, which express the CD22 and CD19 Ags, were not observed (Fig. 2Goc and data not shown). Nevertheless, ~10% of Ig-{alpha}-/- cells in the spleen were found to express low levels of B220 (data not shown). These latter cells are probably pro-B and/or non-B cells as they are also found in the spleen of RAG-deficient mice (33). The frequency of CD4+ and CD8+ T cells in the spleen of Ig-{alpha}-/- mice was increased relative to wild-type controls (Fig. 2Goc). However, given the fact that the total number of cells in the spleen of Ig-{alpha}-/- mice is only one-third of control animals (data not shown), the absolute number of T cells is actually reduced by >50% in the absence of Ig-{alpha} (absolute number of T cells in spleen is 11.1 ± 6.1 x 106; n = 4 for Ig-{alpha}-/- and 26.5 ± 5.0 x 106; n = 3 for wild type). This result probably relates to the defect in T cell expansion and response described in µMT animals (49).

Thus, the results of the flow cytometric analyses fully support those from the Northern analysis and demonstrate that the targeted mb-1 allele is not capable to direct the expression of a functional Ig-{alpha} protein. Commitment of hematopoietic stem cells to the B cell lineage does occur in the absence of Ig-{alpha}, but this molecule is absolutely required for further development to the pre-B, immature, and mature B cell stages. A similar phenotype has been observed in humans bearing a mutation that prevents Ig-{alpha} expression (16). Thus, Ig-{alpha} is similarly required for both human and mouse B cell development.

Ig gene rearrangement and expression is not altered in the absence of either Ig-{alpha} or Ig-{beta}

VHDJH-rearranged IgH chain genes are first found in pro-B cells of fractions B (50). However, the signal, if any, that induces the initiation of the VHDJH recombination process in these cells has not yet been identified. It has been speculated that Ig-{alpha}/Ig-{beta}-containing protein complexes on pro-B cells might signal for VHDJH recombination and/or for the survival of cells that have undergone this process (51, 52).

To analyze whether Ig-{alpha} and Ig-{beta} affect development and/or survival of pro-B cells that carry VHDJH rearrangements, we analyzed the frequency of rearranged IgH genes in cells derived from the bone marrow of Ig-{alpha}- and Ig-{beta}-deficient mice, in comparison to those derived from other mutant strains. RAG2-/- mice were used as a negative control, because they cannot undergo V(D)J recombination (33). The µMT mice, which carry a disruption of one of the membrane exons of the µ-chain gene, were used as a positive control. The B cell progenitors of these mice rearrange normally the IgH locus, but cannot express a µ-chain on the cell surface and are consequently blocked in development due to the inability to express a pre-BCR (32, 53). Nevertheless, the frequency of VHDJH rearrangements found in µMT pro-B cells is equivalent, if not higher, of that found in wild-type pro-B cells (50). The CD19+CD43+ bone marrow fraction from wild-type mice, which comprises the pro-B cell population, was also used as a positive control in one analysis. However, ~30% of this population is composed of large, cycling pre-B cells that have developed based upon productive IgH chain gene rearrangements; and therefore, is expected to contain a higher frequency of VHDJH products (50).

The frequency of VHDJH joints using either VH elements of the JH-distal J558 or the JH-proximal 7183 VH families was assessed by semiquantitative PCR on genomic DNA isolated from purified CD19+(CD43+) bone marrow cells (Fig. 3Go). In this analysis, four products of different size are dominantly amplified and these represent VHDJH joints using one of four different JH gene segments (21, 41). To normalize for the amount of template DNA in each sample, we used primers designed to specifically amplify a portion of the actin gene (Fig. 3Go, b and c). By comparing the degree of amplification of the V(D)J fragments between samples normalized for actin levels, we found that the frequency of VHDJH joints in Ig-{alpha}- and Ig-{beta}-deficient pro-B cells was similar to that found in µMT and wild-type pro-B cells. Thus, these data demonstrate that neither Ig-{alpha} nor Ig-{beta} is required for V(D)J recombination at the IgH locus.



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 3. Ig V(D)J recombination is not impaired in the absence of either Ig-{alpha} or Ig-{beta}. VHDJH rearrangements in pro-B cells of the indicated mutant and wild-type mice were analyzed by semiquantitative PCR. Genomic DNA was extracted from either CD19+ mutant or CD19+CD43+ wild-type bone marrow pro-B cells. a, Example of CD19+ cell purification for the indicated mice. Cells were purified from bone marrow by magnetic sorting (as described in Materials and Methods) and restained for either CD19 or B220 (B220 is expressed on all CD19+ cells) to assess purity. Numbers over histograms indicate percentage of positive cells in the total population. Wild-type CD19+CD43+ pro-B cells were purified by the MoFlo cell sorter to 89% purity (data not shown). Five-fold serial dilutions of genomic DNA from CD19+(CD43+) bone marrow cells was subjected to PCR amplification specific for V(D)J rearrangements of the J558 (b) and 7183 (c) VH families. For relative quantification, amplification of a genomic fragment of the actin gene was performed in parallel with the same DNA. Arrows indicate the expected bands for VHDJH rearrangements and the actin gene.

 
The expression of productively rearranged IgH alleles was examined by flow cytometric analysis. Bone marrow cells were stained intracellularly with anti-mouse µ H chain Abs to detect the production of µ H chains. This analysis is also likely to detect Dµ-chains that are the products of DJH rearrangements in the D reading frame 2 (54, 55). We found that an average of 15.2% (11.7% if we subtract the background staining obtained in RAG2-deficient cells) of the B220+ cells in Ig-{alpha}-deficient mice express µ or Dµ-chains intracellularly (Fig. 4Go and Table IGo). In line with the PCR results, the flow cytometric analysis shows that the frequencies of µ-expressing pro-B cells in Ig-{alpha}- and Ig-{beta}-deficient mice are similar to those found in µMT and wild-type mice (Fig. 4Go and Table IGo). In this analysis, we also observed that many of the mutant pro-B cells express lower levels of µ compared with wild type (notice the shoulder in the histogram of mutants vs the discrete population in that of the wild type in Fig. 4Go), probably reflecting the lower stability of µ-chains in the absence of one of the interacting protein partners (Ig-{alpha}, Ig-{beta}, or both for soluble µ) in the mutant animals. In contrast to pro-B cells, the frequency of µ+ cells in the wild-type pre-B cell population is 5-fold higher than that of the pro-B cell populations (Fig. 4Go). This difference is due to the fact that only µ-expressing cells can differentiate into pre-B cells and only when the µ-chains form a functional pre-BCR with Ig-{alpha} and Ig-{beta}. A small number of the pro-B cells (1–3%) from the different mutant mice (except RAG2) express {kappa} L chains (Table IGo).



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 4. Intracellular expression of µ H chains is not altered in the absence of either Ig-{alpha} or Ig-{beta} molecules. Bone marrow cells from RAG2-/-, Ig-{alpha}-/-, Ig-{beta}-/-, and µMT mutant mice were stained for surface B220 (data not shown) and intracellular and surface µ H chains, and analyzed by flow cytometry. The histograms represent cells gated for B220 expression. Numbers in the histograms refer to the frequency of µ+ cells in the B220+ population. Bone marrow cells from wild-type mice were stained for surface B220, IgM, and CD25 and for intracellular µ H chain. The intracellular staining of µ H chains in the B220+IgM-CD25- (pro-B) and B220+IgM-CD25+ (pre-B) cell populations is shown. The numbers refer to the frequency of µ+ cells in these two populations.

 
In the bone marrow, early B cell progenitors can be divided into two fractions based on surface expression of the B220 and CD19 markers (44, 45, 56). It was shown that the development of pro-B cells progresses from the B220+CD19- to the B220+CD19+ stage (56). The absolute number of cells belonging to these two populations was determined in the mutant mice to establish whether Ig-{alpha} and Ig-{beta} might be necessary for this developmental step. Bone marrow B220+CD19- and B220+CD19+ cell populations of Ig-{alpha}- and Ig-{beta}-deficient mice were found in similar numbers to those of µMT and RAG-deficient mice (Table IGo and data not shown). In addition, similar frequencies of cells appeared to be in cycle, as judged by flow cytometric analysis of DNA stained by propidium iodide (data not shown). Finally, similar frequencies were also found to express IL-7R ({alpha} and {gamma}) on the cell surface (data not shown), a molecule necessary for pro-B cell survival and proliferation in the bone marrow stroma microenvironment.

Thus, Ig-{alpha} and Ig-{beta} have no apparent influence on either the onset of VH to DJH recombination, or on the survival and proliferation of cells that carry VHDJH rearrangements. Nevertheless, these molecules are essential for the development and, most likely, the expansion of pre-B cells that carry productively rearranged IgH genes.

Ig-{alpha} and Ig-{beta} have no redundant function in pro-B cell differentiation

Studies in cell lines have shown that Ig-{beta} molecules can also be expressed on the cell surface in the absence of Ig-{alpha}, suggesting that Ig-{alpha} and Ig-{beta} may function independently of each other in pro-B cells (31). To exclude the possibility that Ig-{alpha} and Ig-{beta} have a redundant signaling function in the initiation and/or completion of the VHDJH recombination process, Ig-{alpha}- and Ig-{beta}-double-deficient mice (Ig{alpha}-/-;Ig{beta}-/-) were generated. In these latter animals, we analyzed the frequency of VHJ558L to DJH rearrangements and intracellular Igµ expression in cells belonging to the pro-B cell population.

We found that pro-B cells from Ig{alpha}-/-;Ig{beta}-/- mice have a similar frequency of VHDJH rearrangements to those isolated from Ig-{alpha}-only-deficient mice (Fig. 5Goa). Moreover, the frequency of pro-B cells that carry productive VHDJH rearrangements and express µ-chains in the cytoplasm is also similar between mice that lack either Ig-{alpha} or Ig-{beta} or both of these molecules (Fig. 5Gob and Table IGo). Bone marrow cells of Ig{alpha}-/-;Ig{beta}-/- mice were stained for B220 and CD19 to determine the frequency and absolute number of pro-B cells. We found that in the absence of both Ig-{alpha} and Ig-{beta} molecules, the absolute number of B220+CD19- and B220+CD19+ bone marrow cells is not significantly different from that observed in single-deficient animals (data not shown and Table IGo). However, these results would need to be confirmed with mutant animals on the same genetic backgrounds.



View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 5. V(D)J recombination and intracellular µ-chain expression are not impaired in pro-B cells double-deficient for both Ig-{alpha} and Ig-{beta}. a, VHDJH rearrangements in sorted pro-B cells of Ig-{alpha} and Ig-{beta} double-deficient mice (Ig-{alpha}-/-;Ig-{beta}-/-) were compared with those from Ig-{alpha}-/- and RAG2-/- animals by semiquantitative PCR. Five-fold serial dilutions of genomic DNA from CD19+ bone marrow cells was subjected to PCR amplification specific for V(D)J rearrangements of the J558 VH family. Amplification of an actin-specific genomic fragment was performed in parallel for relative quantification. Arrows indicate bands of the sizes expected for the different VHDJH rearrangements and for the actin fragment. b, Cells isolated from the bone marrow of two different Ig-{alpha}-/-;Ig-{beta}-/- double-mutant mice. Flow cytometry analysis of intracellular µ H chain expression in B220+ gated cells. Numbers in the histograms refer to the frequency of µ+ cells in the B220+ population.

 
In summary, we can conclude that the VHDJH recombination process at the IgH locus and the survival of pro-B cells that carry these rearrangements do not depend on the expression of Ig-{alpha} and Ig-{beta} molecules.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Extensive studies in cell lines have demonstrated that the Ig-{alpha}/Ig-{beta} heterodimer plays a role in the transport of the mIg molecules onto the cell surface and mediates pre-BCR and BCR signaling (13). Several in vivo studies have shown that expression and signaling of the pre-BCR and BCR are prerequisite to complete the development of B lymphocytes (15, 16, 18, 19, 32, 33, 57, 58, 59, 60). We find that Ig-{alpha}-deficient mice have a block in B cell development that is similar to mice lacking Ig-{beta} or mµ expression. In the absence of Ig-{alpha}, B cell development is arrested at the pro-B cell stage, as these cells are unable to express a pre-BCR.

The complete absence of pre-B, immature B, and mature B cells in Ig-{alpha}-deficient mice demonstrates that, in vivo, Ig-{beta} alone is not able to promote B cell development. In mice expressing chimeric IgM/Ig-{beta} fusion proteins and in mice lacking two-thirds of the cytoplasmic tail of Ig-{alpha} including the immunoreceptor tyrosine-based activation motif, Ig-{beta} reaches the cell surface and the signals transduced by the Ig-{beta} molecule alone in this context are sufficient for the transition of pro-B to pre-B and the generation of immature B cells (19, 61, 62). Therefore, our data suggest that the absence of any further differentiation in Ig-{alpha}-deficient pro-B cells could be strictly related to the inability of the Ig-{beta} molecules to be stably expressed on the cell surface in absence of Ig-{alpha}. This hypothesis would need to be tested biochemically, as the level of Ig-{beta} on the surface of pro-B cells is too low to be detected by flow cytometric analysis (Ref. 51 and data not shown). A human patient carrying a mutation that prevents Ig-{alpha} expression was shown to lack pre-B, immature, and mature B cells as well (16). Thus, development of B cells is absolutely dependent on Ig-{alpha} expression in both mice and humans.

Ig-{alpha}- and Ig-{beta}-deficient mice allow us to investigate the requirement of these proteins at early stages of B cell development. A surface protein complex (pro-BCR) has been speculated to exist and to signal in pro-B cells the initiation and completion of VHDJH recombination (29, 30, 51, 52). This putative pro-BCR, in analogy to the pre-BCR, would also be envisioned to use Ig-{alpha} and Ig-{beta} as signal transducers. Both proteins are indeed expressed on the surface of murine pro-B cells in signaling competent protein complexes that do not contain Ig chains (31, 51).

In this study, we have assessed the function of Ig-{alpha} and Ig-{beta} in VHDJH recombination by comparing the frequency of VHDJH joints using elements of the VHJ558 and VH7183 families. In addition, pro-B cells of the mutant animals were tested for µ-chain production. These analyses indicate that VHDJH recombination is independent of Ig-{alpha} or Ig-{beta} expression. Indeed, a similar frequency of VHDJH joints and of intracellular µ-chain-expressing cells was observed in Ig-{alpha}-deficient, Ig-{beta}-deficient, µMT, and wild-type pro-B cell populations. These data agree with those obtained from pro-B cells of a human Ig-{alpha}-deficient patient that also showed to have normal frequency of V(D)J recombination at the IgH locus (16). A previous analysis indicated that Ig-{beta}-/- pro-B cells had decreased levels of V(D)J joints compared with wild-type pro-B cells and a block at the null pre-B or pre-BI stage of development (15). These earlier results had been interpreted to suggest that Ig-{beta}-derived signals might be involved in the onset of VH to DJH recombination or selection of successfully recombined IgH genes (15, 51, 52, 63). This early analysis was performed on the B220+CD43+ population that contains a large amount of V(D)J-selected pre-B cells in wild-type mice and, in proportion, a large amount of B220+CD19- non-pro-B cell progenitors in the Ig-{beta}-/- mice, while the current analysis has been conducted on the CD19+CD43+ cell population and compared with µMT as well as wild type. The difference in cell sorting procedures used in this work might explain why our results appear contradictory to those previously published. However, in a follow-up analysis, the frequency of intracellular µ-chain-positive pro-B cells of Ig-{beta}-/- mice was found comparable to that of wild type, when pre-B cell contaminants were excluded from the pro-B cell population analyzed by sorting B220+CD43+CD25- cells (17). Thus, in summary these data demonstrate that Ig-{beta} and Ig-{alpha} are not necessary for the initiation and completion of V(D)J recombination at the IgH locus, but they are for the selection and expansion of cells that express the product of a productively rearranged VHDJH gene.

Positive selection and expansion of cells that carry productively rearranged IgH loci, an event that marks the pro-B to pre-B cell transition, is only observed in mice that express all the components of the pre-BCR complex. In lymphoid hematopoietic stem cells committed to the B cell lineage, the transcription of the Rag1, Rag2, TdT, {lambda}5, VpreB, B29, and mb-1 genes is up-regulated before rearrangement and expression of the Ig genes (64). Thus, expression of the proteins encoded by these genes, together with the accessibility of the germline IgH locus identified by its early transcription, may be sufficient for the initiation of D to JH and, subsequently, VH to DJH recombination, without the need of a specific signaling event.

We have also examined whether the Ig-{alpha}/Ig-{beta} heterodimer influences the capacity of pro-B cells to proliferate, survive, and differentiate within the bone marrow environment and to express a functional IL-7R, which is necessary for these functions (65, 66). During the early stages of B cell development, B220+ pro-B cells differentiate from CD19- (fraction A) to CD19+ (fraction B). This differentiation is accompanied by an increased expression of the transcription factors E12, E47, and Pax5, and the up-regulation of Rag1, Rag2, {lambda}5, mb-1, and B29 gene transcription (45, 56). This differentiation also marks the final commitment of oligopotent stem cells to the B lineage (67). We have found that the absolute number of fraction A and fraction B bone marrow pro-B cells does not significantly differ in mice deficient for either Ig-{alpha} or Ig-{beta} relative to that of µMT and RAG2-deficient animals. In addition, we found that lack of Ig-{alpha} or Ig-{beta} expression does not influence entry into the cell cycle or expression of IL-7R{alpha} and IL-7R{gamma} (data not shown). Thus, these data indicate that progressive differentiation of pro-B cells and their survival in the bone marrow environment do not require expression of Ig-{alpha} or Ig-{beta}.

Finally, we have evaluated the possibility that Ig-{alpha} and Ig-{beta} might be redundant in their signaling role in the context of pro-B cell development and differentiation, given that Ig-{beta} has been found on the surface of these cells, even in the absence of Ig-{alpha}. We have found that pro-B cells lacking in the expression of both molecules (Ig-{alpha} and Ig-{beta}) are still able to undergo VHDJH recombination and produce intracellular µ-chain at frequencies similar to those observed for single-deficient pro-B cells. Moreover, double-deficient pro-B cells are also capable to differentiate into fraction B, judging by the coexpression of the CD19 and B220 surface markers.

In conclusion, our data demonstrate that commitment to the B cell lineage and survival of pro-B cells in the bone marrow microenvironment, as well initiation and completion of V(D)J recombination at the IgH locus, do not require expression of Ig-{alpha}, Ig-{beta}, or both molecules.


    Acknowledgments
 
We thank Dr. N. Sakaguchi for the gift of plasmids, Dr. R. Torres and K. Hafen for the gift of Abs, and Regina Halverson for the superb technical assistance. We are extremely grateful to Dr. R. Torres, P. Nielsen, V. Rolli, H. Jumaa, and L. Leclercq for critical reading of the manuscript.


    Footnotes
 
1 This study was supported by the Deutsche Forschungsgemeinschaft through Grant SFB-364, the Leibniz Prize (to M.R.), and the National Jewish Medical and Research Center Institutional Grant (to R.P.). Back

2 Address correspondence and reprint requests to Dr. Roberta Pelanda, Department of Immunology, National Jewish Medical and Research Center, 1400 Jackson Street, Denver, CO 80206. E-mail address: pelandar{at}njc.org Back

3 Abbreviations used in this paper: mIg, membrane-bound Ig; BCR, B cell Ag receptor; mµ, membrane IgM; HSA, heat-stable Ag; pro, progenitor. Back

Received for publication February 15, 2002. Accepted for publication May 9, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Wang, H., R. A. Diamond, E. V. Rothenberg. 1998. Cross-lineage expression of Ig-{beta} (B29) in thymocytes: positive and negative gene regulation to establish T cell identity. Proc. Natl. Acad. Sci. USA 95:6831.[Abstract/Free Full Text]
  2. Sakaguchi, N., S. Kashiwamura, M. Kimoto, P. Thalmann, F. Melchers. 1988. B lymphocyte lineage-restricted expression of mb-1, a gene with CD3- like structural properties. EMBO J. 7:3457.[Medline]
  3. Hombach, J., T. Tsubata, L. Leclercq, H. Stappert, M. Reth. 1990. Molecular components of the B-cell antigen receptor complex of the IgM class. Nature 343:760.[Medline]
  4. Hombach, J., F. Lottspeich, M. Reth. 1990. Identification of the genes encoding the IgM-{alpha} and Ig-{beta} components of the IgM antigen receptor complex by amino-terminal sequencing. Eur. J. Immunol. 20:2795.[Medline]
  5. Ha, H. J., H. Kubagawa, P. D. Burrows. 1992. Molecular cloning and expression pattern of a human gene homologous to the murine mb-1 gene. J. Immunol. 148:1526.[Abstract]
  6. Venkitaraman, A. R., G. T. Williams, P. Dariavach, M. S. Neuberger. 1991. The B-cell antigen receptor of the five immunoglobulin classes. Nature 352:777.[Medline]
  7. Campbell, K. S., E. J. Hager, R. J. Friedrich, J. C. Cambier. 1991. IgM antigen receptor complex contains phosphoprotein products of B29 and mb-1 genes. Proc. Natl. Acad. Sci. USA 88:3982.[Abstract/Free Full Text]
  8. Kim, K. M., G. Alber, P. Weiser, M. Reth. 1993. Signalling function of the B-cell antigen receptors. Immunol. Rev. 132:125.[Medline]
  9. Lam, K. P., R. Kuhn, K. Rajewsky. 1997. In vivo ablation of surface immunoglobulin on mature B cells by inducible gene targeting results in rapid cell death. Cell 90:1073.[Medline]
  10. Law, C. L., A. Craxton, K. L. Otipoby, S. P. Sidorenko, S. J. Klaus, E. C. Clark. 1996. Regulation of signalling through B-lymphocyte antigen receptors by cell-cell interaction molecules. Immunol. Rev. 153:123.[Medline]
  11. Monroe, J. G.. 2000. B-cell antigen receptor signaling in immature-stage B cells: integrating intrinsic and extrinsic signals. Curr. Top. Microbiol. Immunol. 245:1.
  12. Gold, M. R.. 2000. Intermediary signaling effectors coupling the B-cell receptor to the nucleus. Curr. Top. Microbiol. Immunol. 245:77.[Medline]
  13. Wienands, J.. 2000. The B-cell antigen receptor: formation of signaling complexes and the function of adaptor proteins. Curr. Top. Microbiol. Immunol. 245:53.[Medline]
  14. Brouns, G. S., E. de Vries, C. J. van Noesel, D. Y. Mason, R. A. van Lier, J. Borst. 1993. The structure of the µ/pseudo light chain complex on human pre-B cells is consistent with a function in signal transduction. Eur. J. Immunol. 23:1088.[Medline]
  15. Gong, S., M. C. Nussenzweig. 1996. Regulation of an early developmental checkpoint in the B cell pathway by Ig{beta}. Science 272:411.[Abstract]
  16. Minegishi, Y., E. Coustan-Smith, L. Rapalus, F. Ersoy, D. Campana, M. E. Conley. 1999. Mutations in Ig{alpha} (CD79a) result in a complete block in B-cell development. J. Clin. Invest. 104:1115.[Medline]
  17. Reichlin, A., Y. Hu, E. Meffre, H. Nagaoka, S. Gong, M. Kraus, K. Rajewsky, M. C. Nussenzweig. 2001. B cell development is arrested at the immature B cell stage in mice carrying a mutation in the cytoplasmic domain of immunoglobulin {beta}. J. Exp. Med. 193:13.[Abstract/Free Full Text]
  18. Kraus, M., L. I. Pao, A. Reichlin, Y. Hu, B. Canono, J. C. Cambier, M. C. Nussenzweig, K. Rajewsky. 2001. Interference with immunoglobulin (Ig){alpha} immunoreceptor tyrosine-based activation motif (ITAM) phosphorylation modulates or blocks B cell development, depending on the availability of an Ig{beta} cytoplasmic tail. J. Exp. Med. 194:455.[Abstract/Free Full Text]
  19. Torres, R. M., H. Flaswinkel, M. Reth, K. Rajewsky. 1996. Aberrant B cell development and immune response in mice with a compromised BCR complex. Science 272:1802.[Abstract]
  20. Hardy, R. R., C. E. Carmack, S. A. Shinton, J. D. Kemp, K. Hayakawa. 1991. Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow. J. Exp. Med. 173:1213.[Abstract/Free Full Text]
  21. Ehlich, A., V. Martin, W. Muller, K. Rajewsky. 1994. Analysis of the B-cell progenitor compartment at the level of single cells. Curr. Biol. 4:573.[Medline]
  22. Dorshkind, K.. 1990. Regulation of hemopoiesis by bone marrow stromal cells and their products. Annu. Rev. Immunol. 8:111.[Medline]
  23. Kincade, P. W.. 1991. Molecular interactions between stromal cells and B lymphocyte precursors. Semin. Immunol. 3:379.[Medline]
  24. Reichman-Fried, M., R. R. Hardy, M. J. Bosma. 1990. Development of B-lineage cells in the bone marrow of scid/scid mice following the introduction of functionally rearranged immunoglobulin transgenes. Proc. Natl. Acad. Sci. USA 87:2730.[Abstract/Free Full Text]
  25. Young, F., B. Ardman, Y. Shinkai, R. Lansford, T. K. Blackwell, M. Mendelsohn, A. Rolink, F. Melchers, and F. W. Alt. 1994. Influence of immunoglobulin heavy- and light-chain expression on B-cell differentiation [published erratum appears in 1995 Genes Dev. 9:3190.] Genes Dev. 8:1043.
  26. Spanopoulou, E., C. A. Roman, L. M. Corcoran, M. S. Schlissel, D. P. Silver, D. Nemazee, M. C. Nussenzweig, S. A. Shinton, R. R. Hardy, D. Baltimore. 1994. Functional immunoglobulin transgenes guide ordered B-cell differentiation in Rag-1-deficient mice. Genes Dev. 8:1030.[Abstract/Free Full Text]
  27. Keyna, U., G. B. Beck-Engeser, J. Jongstra, S. E. Applequist, H. M. Jack. 1995. Surrogate light chain-dependent selection of Ig heavy chain V regions. J. Immunol. 155:5536.[Abstract]
  28. ten Boekel, E., F. Melchers, A. G. Rolink. 1997. Changes in the VH gene repertoire of developing precursor B lymphocytes in mouse bone marrow mediated by the pre-B cell receptor. Immunity 7:357.[Medline]
  29. Misener, V., G. P. Downey, J. Jongstra. 1991. The immunoglobulin light chain related protein {lambda}5 is expressed on the surface of mouse pre-B cell lines and can function as a signal transducing molecule. Int. Immunol. 3:1129.[Abstract/Free Full Text]
  30. Karasuyama, H., A. Rolink, F. Melchers. 1993. A complex of glycoproteins is associated with VpreB/{lambda}5 surrogate light chain on the surface of µ heavy chain-negative early precursor B cell lines. J. Exp. Med. 178:469.[Abstract/Free Full Text]
  31. Koyama, M., K. Ishihara, H. Karasuyama, J. L. Cordell, A. Iwamoto, T. Nakamura. 1997. CD79{alpha}/CD79{beta} heterodimers are expressed on pro-B cell surfaces without associated µ heavy chain. Int. Immunol. 9:1767.[Abstract/Free Full Text]
  32. Kitamura, D., J. Roes, R. Kuhn, K. Rajewsky. 1991. A B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin µ chain gene. Nature 350:423.[Medline]
  33. Shinkai, Y., G. Rathbun, K. P. Lam, E. M. Oltz, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A. M. Stall, et al 1992. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 68:855.[Medline]
  34. Kashiwamura, S., T. Koyama, T. Matsuo, M. Steinmetz, M. Kimoto, N. Sakaguchi. 1990. Structure of the murine mb-1 gene encoding a putative sIgM-associated molecule. J. Immunol. 145:337.[Abstract]
  35. Pelanda, R., E. Hobeika, T. Kurokawa, Y. Zhang, S. Kuppig, M. Reth. 2002. Cre recombinase-controlled expression of the mb-1 allele. Genesis 32:154.[Medline]
  36. Noben-Trauth, N., G. Kohler, K. Burki, B. Ledermann. 1996. Efficient targeting of the IL-4 gene in a BALB/c embryonic stem cell line. Transgenic Res. 5:487.[Medline]
  37. Torres, R. M., R. Kühn. 1997. Laboratory Protocols for Conditional Gene Targeting Oxford University Press, Oxford.
  38. Pelanda, R., S. Schaal, R. M. Torres, K. Rajewsky. 1996. A prematurely expressed Ig{kappa} transgene, but not V{kappa}J{kappa} gene segment targeted into the Ig{kappa} locus, can rescue B cell development in {lambda}5-deficient mice. Immunity 5:229.[Medline]
  39. Grützmann, R.. 1981. Vergleichende idiotypische analyse von rezeptoren mit spezifität für histokompatibilitätsantigene. Institute for Genetics University of Cologne, Cologne.
  40. Leptin, M., M. J. Potash, R. Grutzmann, C. Heusser, M. Shulman, G. Kohler, F. Melchers. 1984. Monoclonal antibodies specific for murine IgM. I. Characterization of antigenic determinants on the four constant domains of the µ heavy chain. Eur. J. Immunol. 14:534.[Medline]
  41. Corcoran, A. E., A. Riddell, D. Krooshoop, A. R. Venkitaraman. 1998. Impaired immunoglobulin gene rearrangement in mice lacking the IL-7 receptor. Nature 391:904.[Medline]
  42. Reth, M.. 1989. Antigen receptor tail clue. Nature 338:383.[Medline]
  43. Maquat, L. E.. 2002. Nonsense-mediated mRNA decay. Curr. Biol. 12:R196.[Medline]
  44. Rolink, A., E. ten Boekel, F. Melchers, D. T. Fearon, I. Krop, J. Andersson. 1996. A subpopulation of B220+ cells in murine bone marrow does not express CD19 and contains natural killer cell progenitors. J. Exp. Med. 183:187.[Abstract/Free Full Text]
  45. Li, Y. S., R. Wasserman, K. Hayakawa, R. R. Hardy. 1996. Identification of the earliest B lineage stage in mouse bone marrow. Immunity 5:527.[Medline]
  46. Yagita, H., T. Nakamura, J. Asakawa, H. Matsuda, S. Tansyo, Y. Iigo, K. Okumura. 1989. CD2 expression in murine B cell lineage. Int. Immunol. 1:94.[Abstract/Free Full Text]
  47. Sen, J., N. Rosenberg, S. J. Burakoff. 1990. Expression and ontogeny of CD2 on murine B cells. J. Immunol. 144:2925.[Abstract]
  48. Rolink, A., U. Grawunder, T. H. Winkler, H. Karasuyama, F. Melchers. 1994. IL-2 receptor {alpha} chain (CD25, TAC) expression defines a crucial stage in pre-B cell development. Int. Immunol. 6:1257.[Abstract/Free Full Text]
  49. Ngo, V. N., R. J. Cornall, J. G. Cyster. 2001. Splenic T zone development is B cell dependent. J. Exp. Med. 194:1649.[Abstract/Free Full Text]
  50. Ehlich, A., S. Schaal, H. Gu, D. Kitamura, W. Muller, K. Rajewsky. 1993. Immunoglobulin heavy and light chain genes rearrange independently at early stages of B cell development. Cell 72:695.[Medline]
  51. Nagata, K., T. Nakamura, F. Kitamura, S. Kuramochi, S. Taki, K. S. Campbell, H. Karasuyama. 1997. The Ig{alpha}/Ig{beta} heterodimer on µ-negative proB cells is competent for transducing signals to induce early B cell differentiation. Immunity 7:559.[Medline]
  52. Papavasiliou, F., M. Jankovic, S. Gong, M. C. Nussenzweig. 1997. Control of immunoglobulin gene rearrangements in developing B cells. Curr. Opin. Immunol. 9:233.[Medline]
  53. Kitamura, D., K. Rajewsky. 1992. Targeted disruption of µ chain membrane exon causes loss of heavy-chain allelic exclusion. Nature 356:154.[Medline]
  54. Reth, M. G., F. W. Alt. 1984. Novel immunoglobulin heavy chains are produced from DJH gene segment rearrangements in lymphoid cells. Nature 312:418.[Medline]
  55. Horne, M. C., P. E. Roth, A. L. DeFranco. 1996. Assembly of the truncated immunoglobulin heavy chain Dµ into antigen receptor-like complexes in pre-B cells but not in B cells. Immunity 4:145.[Medline]
  56. Ogawa, M., E. ten Boekel, F. Melchers. 2000. Identification of CD19-B220+c-kit+Flt3/Flk-2+ cells as early B lymphoid precursors before pre-B-I cells in juvenile mouse bone marrow. Int. Immunol. 12:313.[Abstract/Free Full Text]
  57. Kitamura, D., A. Kudo, S. Schaal, W. Muller, F. Melchers, K. Rajewsky. 1992. A critical role of {lambda}5 protein in B cell development. Cell 69:823.[Medline]
  58. Mombaerts, P., J. Iacomini, R. S. Johnson, K. Herrup, S. Tonegawa, V. E. Papaioannou. 1992. RAG-1-deficient mice have no mature B and T lymphocytes. Cell 68:869.[Medline]
  59. Gong, S., M. Sanchez, M. C. Nussenzweig. 1996. Counterselection against Dµ is mediated through immunoglobulin (Ig){alpha}-Ig{beta}. J. Exp. Med. 184:2079.[Abstract/Free Full Text]
  60. Martensson, A., Y. Argon, F. Melchers, J. L. Dul, I. L. Martensson. 1999. Partial block in B lymphocyte development at the transition into the pre-B cell receptor stage in Vpre-B1-deficient mice. Int. Immunol. 11:453.[Abstract/Free Full Text]
  61. Papavasiliou, F., M. Jankovic, H. Suh, M. C. Nussenzweig. 1995. The cytoplasmic domains of immunoglobulin (Ig){alpha} and Ig{beta} can independently induce the precursor B cell transition and allelic exclusion. J. Exp. Med. 182:1389.[Abstract/Free Full Text]
  62. Teh, Y. M., M. S. Neuberger. 1997. The immunoglobulin (Ig){alpha} and Ig{beta} cytoplasmic domains are independently sufficient to signal B cell maturation and activation in transgenic mice. J. Exp. Med. 185:1753.[Abstract/Free Full Text]
  63. Muljo, S. A., M. S. Schlissel. 2000. Pre-B and pre-T-cell receptors: conservation of strategies in regulating early lymphocyte development. Immunol. Rev. 175:80.[Medline]
  64. O’Riordan, M., R. Grosschedl. 2000. Transcriptional regulation of early B-lymphocyte differentiation. Immunol. Rev. 175:94.[Medline]
  65. Stoddart, A., H. E. Fleming, C. J. Paige. 2000. The role of the preBCR, the interleukin-7 receptor, and homotypic interactions during B-cell development. Immunol. Rev. 175:47.[Medline]
  66. Fleming, H. E., C. J. Paige. 2001. Pre-B cell receptor signaling mediates selective response to IL-7 at the pro-B to pre-B cell transition via an ERK/MAP kinase-dependent pathway. Immunity 15:521.[Medline]
  67. Rolink, A. G., C. Schaniel, M. Busslinger, S. L. Nutt, F. Melchers. 2000. Fidelity and infidelity in commitment to B-lymphocyte lineage development. Immunol. Rev. 175:104.[Medline]



This article has been cited by other articles:


Home page
JEMHome page
X. Zou, M. J. Osborn, D. J. Bolland, J. A. Smith, D. Corcos, M. Hamon, D. Oxley, A. Hutchings, G. Morgan, F. Santos, et al.
Heavy chain only antibodies are spontaneously produced in light chain deficient mice
J. Exp. Med., December 24, 2007; 204(13): 3271 - 3283.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. K. Dobbs, T. Yang, D. Farmer, L. Kager, O. Parolini, and M. E. Conley
Cutting Edge: A Hypomorphic Mutation in Igbeta (CD79b) in a Patient with Immunodeficiency and a Leaky Defect in B Cell Development
J. Immunol., August 15, 2007; 179(4): 2055 - 2059.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Ma, A. Turetsky, L. Trinh, and R. Lu
IFN Regulatory Factor 4 and 8 Promote Ig Light Chain {kappa} Locus Activation in Pre-B Cell Development
J. Immunol., December 1, 2006; 177(11): 7898 - 7904.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. Hobeika, S. Thiemann, B. Storch, H. Jumaa, P. J. Nielsen, R. Pelanda, and M. Reth
Testing gene function early in the B cell lineage in mb1-cre mice
PNAS, September 12, 2006; 103(37): 13789 - 13794.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. R. Hardy
B-1 B cell development.
J. Immunol., September 1, 2006; 177(5): 2749 - 2754.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Borsutzky, K. Kretschmer, P. D. Becker, P. F. Muhlradt, C. J. Kirschning, S. Weiss, and C. A. Guzman
The Mucosal Adjuvant Macrophage-Activating Lipopeptide-2 Directly Stimulates B Lymphocytes via the TLR2 without the Need of Accessory Cells
J. Immunol., May 15, 2005; 174(10): 6308 - 6313.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Rangel, M. R. McKeller, J. C. Sims-Mourtada, C. Kashi, K. Cain, E. D. Wieder, J. J. Molldrem, L. V. Pham, R. J. Ford, P. Yotnda, et al.
Assembly of the {kappa} PreB Receptor Requires a V{kappa}-like Protein Encoded by a Germline Transcript
J. Biol. Chem., May 6, 2005; 280(18): 17807 - 17814.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
G. R. Galler, C. Mundt, M. Parker, R. Pelanda, I.-L. Martensson, and T. H. Winkler
Surface {micro} Heavy Chain Signals Down-Regulation of the V(D)J-Recombinase Machinery in the Absence of Surrogate Light Chain Components
J. Exp. Med., June 7, 2004; 199(11): 1523 - 1532.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. A. Pike, S. Iacampo, J. E. Friedmann, and M. J. H. Ratcliffe
The Cytoplasmic Domain of Ig{alpha} Is Necessary and Sufficient to Support Efficient Early B Cell Development
J. Immunol., February 15, 2004; 172(4): 2210 - 2218.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
Y.-w. Su, A. Flemming, T. Wossning, E. Hobeika, M. Reth, and H. Jumaa
Identification of a Pre-BCR Lacking Surrogate Light Chain
J. Exp. Med., December 1, 2003; 198(11): 1699 - 1706.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W. Schuh, S. Meister, E. Roth, and H.-M. Jack
Cutting Edge: Signaling and Cell Surface Expression of a {micro}H Chain in the Absence of {lambda}5: A Paradigm Revisited
J. Immunol., October 1, 2003; 171(7): 3343 - 3347.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Mielenz, A. Ruschel, C. Vettermann, and H.-M. Jack
Immunoglobulin {micro} Heavy Chains Do Not Mediate Tyrosine Phosphorylation of Ig{alpha} from the ER-cis-Golgi
J. Immunol., September 15, 2003; 171(6): 3091 - 3101.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Bradl, J. Wittmann, D. Milius, C. Vettermann, and H.-M. Jack
Interaction of Murine Precursor B Cell Receptor with Stroma Cells Is Controlled by the Unique Tail of {lambda}5 and Stroma Cell-Associated Heparan Sulfate
J. Immunol., September 1, 2003; 171(5): 2338 - 2348.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pelanda, R.
Right arrow Articles by Reth, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pelanda, R.
Right arrow Articles by Reth, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS