|
|
||||||||





* Department of Biophysics, Graduate School of Science,
Center for Molecular Biology and Genetics, Kyoto University, and
Health Research Foundation, Kyoto, Japan; and
Department of Anatomy, Kumamoto University Medical School, Kumamoto, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
104 lymphoid follicles that can be easily
isolated (2). Each follicle is colonized by a small number
of prebursal stem cells that are committed to a particular Ig gene
rearrangement in the intraembryonic mesenchyme (3, 4). All
chicken Ig L chains are rearranged by the same V and J gene segments
and only one-third of the L chains derived from the bursal B cells up
to day 13 of embryonic development are in-frame (4, 5). No
further V-J rearrangements are ongoing in the embryonic bursa. A major role of the bursa is to provide the necessary microenvironment for the somatic diversification of rearranged V-J genes through a program of segmental gene conversion with a pool of noncoding pseudogenes being used as donors (6, 7, 8) and for the selective amplification of lymphocytes with productive gene rearrangements (5). In posthatching bursal cells, nearly all V-J joints are in-frame.
The bursa is a gut-associated lymphoid tissue and a major trapping site for environmental Ags from the gut (9, 10, 11, 12). Exogenous and gut-derived Ags are actively transported across the bursal epithelium into the lymphoid follicles of the bursa. Therefore, the antigenic microenvironment of B cells in the bursa after hatching differs from that of bursal cells developing in the embryo. Ligation of the bursal duct before hatching blocks the transport of gut-derived Ags into the bursa and results in reduced proliferation of bursal cells after hatching (13). However, it remains unclear whether the B cell repertoire is positively selected in the bursa in situ by environmental Ags trapped from the gut.
To study the effects of antigenic stimulation from the environment, we closed the connection between the bursa and the gut by bursal duct ligation (BDL)4 on day 18 of incubation and injected an artificial Ag, 4-hydroxy-3-nitrophenylacetyl (NP) coupled to BSA into the bursal lumen immediately before the BDL (NP-BDL). We used a PCR to amplify all Ig L chain genes in each single bursal follicle from the 18-day chick embryo and the normal, BDL, and NP-BDL 7-day-old chicken, and determined the nucleotide sequences. Using a computer-adaptable method for definitive assignments of gene conversion (14), we distinguished base modifications brought by templated gene conversion from point mutations. Clonally related genes carrying shared and unique nucleotide changes can be explained by the intraclonal generation of Ab mutants during the expansion of individual B cell clones.
Although the proliferation of abortive cloness, possibly induced by constitutive basal signaling, was observed in the bursa from the embryo and the posthatching normal and BDL chicken bursa, there was a marked difference in the percentage of productively rearranged clones in the bursa between BDL and NP-BDL chicken. However, no significant differences were observed among the normal, BDL, and NP-BDL chickens for the clonal diversity as measured by the average evolutionary distances reflecting the amino acid change from the germline and by the inter- and intraclonal amino acid difference in the complementarity-determining region (CDR) of Ig L chain. These findings provide direct evidence that environmental Ags play a significant role in the selective amplification of B cells with a productive V-J rearrangement but no critical role in the process to create the diversity required in the adult immune repertoire. Thus, the preimmune repertoire in the bursa is generated by the Ag-independent B cell proliferation, but antigenic stimulations to the bursa accelerate expansion of productive bursal cells driven by interactions with Ag.
| Materials and Methods |
|---|
|
|
|---|
White Leghorn HB-15 chickens (15) were sacrificed on day 18 of incubation and day 7 of posthatching, and each single bursal follicle was isolated as described previously (2), with a few modifications. In brief, bursa of Fabricius was cut open and gently minced in HBSS in a 10-cm plastic dish. The fragments were teased with the backside of a curved tweezer. Individual follicles released into the medium were visible under a dissecting microscope. A single follicle was transferred into a microcentrifuge containing 30 µl of 1x LA Taq buffer (Takara, Kyoto, Japan) with 1 mg/ml proteinase K and 0.5% Tween 20. To avoid DNA degradation, the isolated follicles were immediately incubated for 45 min at 56°C for proteinase K-mediated proteolysis, followed by a 10-min incubation at 95°C to inactivate proteinase K. This crude lysate of a single follicle was stored at -20°C before use.
Bursal duct ligation
BDL was performed on day 18 of incubation as described previously (16). To prepare the NP-BDL chicken, 0.3 mg of sterile NP-BSA resuspended in 8 µl saline was administered into the bursal lumen via a vinyl tube immediately before BDL. Each single bursal follicle of BDL and NP-BDL chickens was isolated on day 7 of posthatching and stored as crude lysate prepared as described.
PCR amplification
A frozen lysate of a single bursal follicle was divided into
three portions (10 µl each) and independently subjected to two rounds
of PCR using pairs of nested primers. The primary PCR of 30 cycles was
conducted with the nested L1/L4 primers in a 50-µl volume. The
secondary PCR of 20 cycles was conducted with the L20/L21 primers
internal to those used for primary PCR in separate reaction tubes using
2 µl of the first-round reaction mixture in a 50-µl volume. PCR
were monitored by the PCR product defined as a visible band with an
expected 350-bp length on an ethidium bromide-stained 0.8% agarose
gel. Because the PCR product reached its maximum after 30 cycles of
amplification, PCR-introduced mutations are minimized. The primers were
designed from the registered nucleotide sequence M24403 (European
Molecular Biology Laboratory/GenBank/DNA Data Base in Japan).
Primary PCR primers, L1 5' of V
1 in the leader intron and
L4 3' of J
in the J-C intron, were described previously
(17). The secondary PCR primers, L20
(TCCAAGCTTTCCTCTCCCTCTCCAGG) and L21 (GGCTCTAGATCACGATGGGGGAAGAA) were
flanked by HindIII and XbaI cloning
sites, which facilitate the cloning of PCR products. Neither of the
restriction sites HindIII and XbaI were found in
the region including the
V
, V
1, and J
genes. PCR
amplification was performed with LA Taq polymerase (Takara)
as follows: an initial 4-min incubation at 94°C, 30 or 20 cycles
consisting of 95°C for 30 s, 60°C for 30 s, and 72°C
for 90 s, with a final 5-min elongation step at 72°C.
DNA cloning and sequencing
Amplified DNA of expected length was purified by 0.8% agarose gel electrophoresis. Cloning was performed in pUC119 vector after digestion with HindIII and XbaI. Sequencing was done using the BigDye terminator cycle sequencing ready reaction kit (PE Applied Biosystems, Foster City, CA) and the autosequencer model 373 (PE Applied Biosystems). All sequences were confirmed by sequencing both strands using the universal and reverse oligonucleotide primers specific for M13. GenBank accession numbers for the sequences reported in this paper are AB061547-061652 and AB061654-061667.
PCR-introduced mutations
PCR amplification artifacts were measured by sequencing 14 cloned products of an analogous two rounds of amplification of a known L chain plasmid, p2115 (352 bp), equivalent to 5000 copies. We found only two substitutions in 4928 nucleotides (14 x 352 bp) during in vitro amplification. Therefore, these infrequent PCR artifacts are unlikely to account for the majority of the observed mutations.
Gene conversion search and other statistical comparisons
According to the Conversion Search computer program, as previously described (14), linked base modifications with counterparts in the pseudogene pool were assigned as templated gene conversions. An Ig L chain pseudogene mini-database was constructed from M12437, M1509715099, M1513715156, and AH002536 (European Molecular Biology Laboratory/GenBank/DNA Data Base in Japan). Other all single-base changes were assigned as point mutations. The average number of base modifications, point mutations, and gene conversion events among related sequences in genealogical trees were calculated as shown previously (17). The evolutionary trees were inferred by the neighbor joining (NJ) method (18) and calculations of the evolutionary distance were as described (14).
| Results |
|---|
|
|
|---|
We used a PCR to amplify all V
1-J
fusions of B cells
isolated from individual single follicles of the bursa from the day-18
embryos and from the 7-day-old normal, BDL, and NP-BDL chickens.
Amplified DNAs were cloned into plasmid vectors, and the V region
inserts of individual PCR clones were sequenced. We analyzed a total of
215 L chain rearrangements obtained from 16 single bursal follicles
(Table I
). Despite the extensive sequence
diversity by base modifications, each sequence can be related by
unique V-J joint sequences. Because most follicles are populated by a
very few prebursal stem cells that are committed to a particular Ig
gene rearrangement at the very beginning of the development of the
embryonic bursa (2, 3, 4), sequences related by a unique V-J
joint have likely originated from the same precursor cell. Junctional
diversification is achieved by some P base additions and moderate
exonucleolytic nibbling of the coding ends (5, 6, 7, 8).
|
Selective amplification of B cells with productive gene rearrangements
suggests that the productive V-J coding sequences may be amplified
during extensive bursal clonal diversifications. We examined the
proportion of abortive clones with out-of-frame joints or with the loss
of a productive rearrangement by modifying the reading frame in
all clones analyzed. Neonatal normal chickens stimulated possibly by
the natural environmental Ags after hatching showed a significant
decrease to one-fourth in the proportion of abortive clones (Table I
).
The neonatal NP-BDL chickens stimulated by the NP Ags showed a more
pronounced decrease to less than one-tenth in the proportion of
abortive clones (Table I
).
Clonal diversification of B cells in the bursa during development
To reveal the clonal expansions present during late embryonic life
and on day 7 after hatching, clonally related L chain sequences
obtained from each single bursal follicle were aligned with germline
sequence and their representative related clones from e2 and p2 are
shown in Fig. 1
. Germline precursor
segments are identified in e2 clones (Fig. 1
A). For the
quantitative assignments of gene conversion, a computer program,
Conversion Search, was used forthis study (14).
Clonally related L chain sequences carried shared and unique nucleotide
changes. The mutations in this collection of genes included both
templated gene conversions and point mutations. Single-base changes
were either templated or untemplated in the known pseudogene pool. The
mutational patterns reflect an intraclonal generation of Ab mutants
during the expansion of individual B cell clones. All the Ig L
sequences derived from the single bursal follicles, e2 and p2, are
represented in the form of genealogical trees (Fig. 2
). The unrelated single clones of unique
V-J joints may well be considered representative of a minor population
of less diversification in the bursa.
|
|
V16
(e2204) and
V23 (e2103 and e2109) resulted in the out-of-frame
sequences by shifting the reading frame of productive V-J
joints. Repeated gene conversion events with
V23 (e2202) corrected
the out-of-frame joints of e2103 or e2109. Repeated use of the gene
conversion donors
V7 and
V10 was also observed in the CDR1 to
CDR2 (Fig. 1Effect of Ags in the bursal lumen on the clonal diversification of B cells after hatching
We aligned the clonally related L chain sequences from each single
bursal follicle of BDL and NP-BDL chickens with the germline sequence.
Representative related clones from the bursal follicles of b3 of BDL
chickens and n1 of NP-BDL chickens are shown in Fig. 3
. Putative precursor segments shared by
BDL b3-I clones (Fig. 3
A) show an out-of-frame V-J joining
event, suggesting that nonproductive joining is not a lethal event by
itself. The pseudogenes
V2,
V6,
V8, and
V23 are
preferentially and repeatedly used as the gene conversion donor in the
CDR1 and CDR3. The more complicated gene conversions were
observed in the n1-I clones of NP-BDL chickens (Fig. 3
B).
The first common mutational event in this group was the point mutation
A to T in the CDR3 flanking region. All the Ig L sequences derived from
the single bursal follicles b3 and n1 are represented in the form of
genealogical trees (Fig. 4
).
|
|
and J
-C
intron of the rearranged L chain genes (Figs. 1Mutation mechanism of B cells specified in the bursa
In Table II
, the number of mutation
events was calculated for each pair-group of IgL sequences as shown in
the genealogical trees (Figs. 2
and 4
). The number of conversion events
increased with time: two on day 18 of incubation and five on 7 days
after hatching. The gene conversion events were not different between
BDL and NP-BDL chickens and thus were unaffected by the environmental
Ags. A significant number of point mutations were observed during the
late embryonic stage. However, the increase in point mutations was very
small during development and was not affected by the environmental Ags.
Total base modifications during development were achieved mainly by a
mechanism of gene conversion and were independent of the clonal
selections by the environmental Ags.
|
V23 segments at the late embryonic
stage and in theBDL chicken (Fig. 5
V23 may be an accidental event in a total of
104 follicles per bursa. Only the pseudogene
V22, carrying the shortest coding segment between CDR1 and CDR2, was
not used for the gene conversion donors.
|
We translated the PCR sequences of the productive clone to the
corresponding amino acid sequences. Then we searched amino acid
sequence similarities between a pair of neighbor sequences and
constructed a unique evolutionary tree under the principle of minimum
evolution according to the NJ method (18) (Fig. 6
). The NJ method provided not only the
topology but also the horizontal branch lengths representing
evolutionary distance of the final tree. The average evolutionary
distance of IgL from the germline was 3.3% during late embryonic life
and expanded to 15% 1 week after hatching. There were no significant
differences in IgL in the evolutionary distance from germline between
BDL and NP-BDL chickens.
|
Because the primary structure responsible for Ag binding is
located in CDRs of each Ig chain, we examined the average evolutionary
distances between clones of the same group and between clones of
different groups in the region corresponding to the CDR germline of the
Ig L chain (26 aa of CDR1, CDR2, and CDR3) as shown in Table III
. Clonal diversity in CDRs was
expanded during bursal development. No significant differences were
observed between intra- and interclonal diversities or in the clonal
diversities between BDL and NP-BDL chickens. The evolutionary distance
from the germline was expanded 2-fold more in the CDRs than in the full
length of IgL.
|
| Discussion |
|---|
|
|
|---|
In chickens, the Ig gene rearrangement is not the key event for Ig
diversity, but the postrearrangement diversification by gene conversion
in bursa generates the B cell repertoire. Therefore, the
bursa of Fabricius is the primary site of B cell preimmune
repertoire formation in the chicken. The evolutionary distance of the
IgL sequence from the germline increases with time in the bursa: 3.3%
at the intraembryonic phase and 15% at the posthatching period (Fig. 6
). These bursal diversifications are expanded to the average
evolutionary distance of 22% in the periphery, as shown by
Ag-activated B cells migrating into germinal centers (14).
Both bursal and germinal center diversifications contribute equally to
the evolutionary distance at the periphery.
In the pseudogene sequences used for gene conversion,
framework regions are well conserved but the CDRs are more diversified
(1). Accordingly, the evolutionary distance from the
germline is enlarged to >30% in neonatal bursal cells when compared
with the CDR sequences (Table III
). However, repertoire of bursal
lymphocyte specificities shown by both intraclonal and interclonal
evolutionary distances in CDRs of the Ig L chain was not significantly
affected by the NP antigenic administration. These results based on the
sequence diversity are compatible with the functional evidence that the
BDL treatment did not impede the rate of Ab diversification during
embryonic development (21).
The postbursal Ig diversifications in the germinal center are equally
induced by gene conversion and by point mutations in the early phase of
Ag stimulation, but gene conversion events are strongly suppressed
during the late stage (14). Although we
identified base modifications induced by gene conversion
and point mutations separately, somatic point mutations remained
suppressed to a low level during bursal development (Table II
). Point
mutations occurred at sites distant from gene conversion events (Figs. 1
and 3
). The generation of the bursal preimmune repertoire is mostly
brought out by gene conversion events.
In both embryonic and posthatching stages, intraclonal CDR diversity
shown by average evolutionary distances between clones of the same
group is not markedly different from the interclonal CDR
differences between clones of different groups (Table III
). This is
characteristic of the Ag-independent bursal diversifications generating
the preimmune repertoire. In the Ag-dependent germinal center reaction,
in which Ag-activated B cells are diversified during the early phase
and are subsequently subjected to selection for oligoclonality,
intraclonal diversity was restricted to a narrow range in contrast with
the expanded interclonal diversity (14).
Nonproductive clones are not lethal
Joining events were identified by unique V-J junctions. These
numbers may be different from the actual number of independent joints,
because many of the joints are clonally amplified and are counted as
one independent event. Many nonproductive V-J joints and abortive
clones were observed in sequences derived from the single bursal
follicles at different developmental stages (Table I
). Nonproductive
rearrangements cloned at day 18 of incubation were 42% in total
sequences and 33% in independent joints. This percentage is higher
than the previous values, 6% of all V-J joints (5) and
4% of all V-D-J joints (22) cloned from pools of bursal
cells. Minor nonproductive clones in each single follicle may not be
counted in a large pool of bursal follicle cells.
Clonal expansion of nonproductively rearranged IgL alleles and
the base modifications by gene conversion continued during bursal
development without artificial Ag stimulation (Figs. 2
B and
4A). We also characterized gene conversion events that
result in either the loss of a productive rearrangement or correct
out-of-frame joints by shifting the reading frame during late embryonic
life (Fig. 1
A). The nonproductive V-J joining event is not a
lethal event by itself in bursa. These findings would account for the
Ag-independent clonal diversification by gene conversion. Constitutive
basal signaling may be sufficient to support B cell development in the
bursa. In contrast, no abortive clones carrying crippling mutations in
the Ig L chain have been diversified in the Ag-induced germinal centers
(14).
Ag-dependent positive selection of B cells
The proportion (one-third) of nonproductive V-J joints at the late embryonic stage is lower than the two-thirds expected if V-J joining is random at the earliest bursal stage (5). Thus, selective amplification of cells with productive gene rearrangements could be induced by an interaction between the surface receptor and ligands in the bursal microenvironments.
After hatching, environmental Ags are transported along the bursal duct
connecting the intestinal lumen to the bursal lumen across the
follicle-associated epithelium into the medullary areas of the bursal
follicle (23). Thus, bursal cells with the prediversified
receptor are exposed to foreign Ags at a time and place in which the B
cell repertoire is being generated. Although the proportion of
productive joints was not changed during this time period, the
selective expansion of B cell clones with in-frame V-J joints was
observed (Table I
). To clarify whether the selective amplification of
bursal lymphocyte with productive rearrangements could result as a
consequence of exposure to environmental Ags, we compared the IgL
sequences of B cells from a single bursal follicle of BDL and NP-BDL
chickens. Antigenic administration into the bursal lumen immediately
before BDL caused a significant decrease in lymphocytes with a
nonproductive V-J joint at the IgL locus (Table I
) and a remarkable
decrease in abortive IgL clones in the bursa (Table I
) in comparison
with nonimmunized BDL chickens. However, administration of bacterial Ag
into the bursal lumen did not cause an increase in the proliferation
rate of bursal cells in comparison with the bursa of BDL chickens
(13). There is no evidence for Ag-specified B cell
proliferation in bursa. Antigenic stimulation into the bursal lumen
before BDL caused a significant increase in bursal cells expressing
IgM+IgG+ double-positive
immune complexes on their surface (12). These immune
complexes were verified as the surface (s)IgM-positive B cells bound to
the complex of environmental Ag and maternal IgG trapped on the surface
of follicular dendritic cells as illustrated in Fig. 7
(Ref. 24 and M. Yasuda, H.
Arakawa, H. Yokoyama, Y. Yokomizo, and S. Ekino, unpublished
results). Starting around the time of hatching, B cells in the
epithelial buds segregate to form an outer cortex of cells surrounding
the inner medulla, and most bursal cell proliferation occurs in the
cortex (13, 24, 25, 26). The medulla contains largely
nondividing cells. CD4+ T cells were distributed
not in the medulla but in the cortex, where some cytoplasmic
IgG+ cells were found (24). The
frequency of apoptotic cells in the normal bursa increases after
hatching and is especially enhanced in B cells expressing a truncated
Igµ chain (27). Thus, we suggest that B cells stimulated
by enormous environmental Ags are escaped from apoptotic cell death and
potentiated to migrate to form the cortex of rapidly dividing cells.
Bursal B cells emigrate directly from the cortex to the periphery via
lymph vessels (26, 28). Introduction of Ag into the bursal
lumen has been shown to induce the specific production of Ab-forming
cells in the periphery following subsequent systemic challenge
(11, 29).
|
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Department of Cellular Immunology, Heinrich-Pette-Institute, D-20251, Hamburg, Germany. ![]()
3 Address correspondence and reprint requests to Dr. Hideo Yamagishi, Health Research Foundation, Pasteur Building 5F, 103-5 Tanaka Monzen-cho, Sakyo-ku, Kyoto 606-8225, Japan. E-mail address: yama{at}mail.taishitsu.or.jp ![]()
4 Abbreviations used in this paper: BDL, bursal duct ligation; NP, 4-hydroxy-3-nitrophenylacetyl; CDR, complementarity-determining region; s, surface; NJ, neighbor joining. ![]()
Received for publication June 18, 2001. Accepted for publication May 15, 2002.
| References |
|---|
|
|
|---|
1-J
and novel joints of chimeric V pseudogenes on extrachromosomal circular DNA from chicken bursa. Eur. J. Immunol. 23:245.[Medline]
This article has been cited by other articles:
![]() |
J. J. Dibner, J. D. Richards, and C. D. Knight Microbial Imprinting in Gut Development and Health J. Appl. Poult. Res., January 1, 2008; 17(1): 174 - 188. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hansell, X. W. Zhu, H. Brooks, M. Sheppard, S. Withanage, D. Maskell, and I. McConnell Unique Features and Distribution of the Chicken CD83+ Cell J. Immunol., October 15, 2007; 179(8): 5117 - 5125. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. D'Avirro, D. Truong, B. Xu, and E. Selsing Sequence Transfers between Variable Regions in a Mouse Antibody Transgene Can Occur by Gene Conversion J. Immunol., December 15, 2005; 175(12): 8133 - 8137. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mehr, H. Edelman, D. Sehgal, and R. Mage Analysis of Mutational Lineage Trees from Sites of Primary and Secondary Ig Gene Diversification in Rabbits and Chickens J. Immunol., April 15, 2004; 172(8): 4790 - 4796. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Jasper, S.-K. Zhai, S. L. Kalis, M. Kingzette, and K. L. Knight B Lymphocyte Development in Rabbit: Progenitor B Cells and Waning of B Lymphopoiesis J. Immunol., December 15, 2003; 171(12): 6372 - 6380. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |