| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Departments of
* Respiratory and Infectious Diseases and
Dermatology, Graduate School of Medicine, and
Laboratory of Pathophysiological Biochemistry, Graduate School of Pharmaceutical Sciences, Tohoku University, Sendai, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
formation by
Th1 cells, but also induced Th1 differentiation from unprimed T cells.
These effects paralleled with the increase in the expression of CD40,
CD86, and class II molecules on B cells and the coordinated production
of IL-12 by the cells. To our knowledge this is the first report
revealing that B cells share with dendritic cells common intrinsic
characteristics, such as the Ag-nonspecific capture and presentation,
and the induction of Th1 differentiation from unprimed T
cells. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B cells also serve as APCs (7, 8, 9). Resting B cells are poor at presenting Ag (10, 11, 12) or are tolerogenic to T cells (13, 14), and turn into effective APCs with the increased expression of costimulatory molecules after the activation (15, 16, 17). However, Ags specifically bound to surface Ig (sIg) on B cells are presented to T cells 103- to 104-fold more efficiently than those entering the cells in an sIg-independent manner (10, 18, 19). B cells are efficient APCs for Ag-primed T cells (13, 20) and are likely to induce Th2-dominant responses (21, 22, 23, 24, 25, 26, 27). It has long been debated whether B cells can prime naive T cells (28, 29, 30, 31, 32). Recent in vitro experiments using Ig transgenic (tg) mice demonstrated that B cells have the capacity of activating naive T cells for proliferation (33, 34) and the development of Th2 cells (35) or unpolarized effector T cells (36). However, little is known about the ability of B cells to prime naive T cells for differentiation toward Th1 cells.
The nature of DNAs as immune stimulators has recently been attracting much attention. Initially, CpG oligodeoxynucleotides (CpG) were found to trigger B cells to proliferate and differentiate into Ig-secreting cells (37). CpG were also found to activate monocytes, macrophages, and DCs to produce IL-12, which facilitates the development of Th1 cells (38, 39, 40, 41, 42, 43, 44, 45). We reported that the ability of Ag to induce the differentiation of Ag-specific Th1 cells was greatly enhanced when CpG were covalently conjugated to the Ag (46, 47). The underlying mechanisms included the augmented capture of the CpG-tagged Ag by DCs in a CpG-guided manner and the expression of costimulatory molecules and IL-12 by the Ag-pulsed DCs (47). While the binding of CpG to B cells has recently been extensively studied (48), the functional relevance of CpG binding has not been addressed.
In this report we examined the role of CpG in the CpG-Ag conjugate in Ag capture and T cell stimulation by B cells. We observed that the CpG-Ag conjugates were efficiently captured by B cells regardless of the Ag specificity of sIg. The CpG-activated B cells could, in turn, present the Ag and induce the differentiation of Th1 cells from unprimed tg T cells by elaborating IL-12.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
BALB/c mice were bred in our animal facility and were used at 7–12 wk of age. BALB/c mice tg for TCR specific for OVA323–339 and I-Ad were supplied by Dr. S. Habu (Tokai University, Kanagawa, Japan) (49).
Ags, CpG, and direct conjugation to Ags
OVA (Sigma, St. Louis, MO), BSA (Sigma-Aldrich), and keyhole
limpet hemocyanin (KLH; Calbiochem, La Jolla, CA) were conjugated with
2,4,6-trinitrobenzen sulfonate (Wako Pure Chemical, Osaka, Japan). The
degree of substitution was 10 trinitrophenyl (TNP)
residues/100-kDa Ag. The CpG (1826) used throughout this study
consisted of 20 bases containing two CpG motifs
(TCCATGACGTTCCTGACGTT) (50)
and were fully phosphorothioated (underlining indicates a CpG motif).
The control non-CpG oligodeoxynucleotides (ODNs; 1745) were identical,
except that the CpG motifs were rearranged (TCCATGAGCTTCCTGAGTCT)
(50). Phosphorothioate ODNs were synthesized by Nihon Gene
Research Laboratories (Sendai, Japan) or Takara Shuzo (Osaka, Japan).
The LPS content of ODN was <6 pg LPS/mg DNA, as measured by a
Limulus HS-J Single Test (Wako Pure Chemical). The
phosphorothioate ODNs were conjugated to OVA, TNP-OVA, TNP-BSA, and
R-PE (PE; Molecular Probes, Eugene, OR) by mixing SH-conjugated ODNs at
the 5' end and maleimide-activated Ag using sulfosuccinimidyl
4-(N-maleimidomethyl)cyclohexane-1-carobylate (Pierce,
Rockford, IL). Unconjugated ODNs were removed by extensive dialysis.
Aliquots of CpG-OVA conjugate were purified by gel filtration
chromatography to minimize the effects of the contaminating aggregates,
as described previously (47). The molar and weight ratios
of the ODN to Ag are listed in Table I
.
|
Spleen or LN cells depleted of RBC by hypotonic treatment were
layered onto 50% Percoll (Pharmacia Biotech, Uppsala, Sweden) and
centrifuged for 10 min at 2000 rpm. The cells under the 50% Percoll
layer were incubated with anti-B220 magnetic microbeads and
enriched for B220+ B cells using a MACS magnetic
separation system (Miltenyi Biotec, Auburn, CA). B cells used as APCs
for the stimulation of Th cells were further purified by depleting them
of CD11c+ DCs with anti-CD11c microbeads
before enrichment for B220+ cells. Reanalysis of
the recovered B220+CD11c-
cells revealed that B220+ B cells and
CD11c+ DCs comprised >98% and <0.5%,
respectively (Fig. 1B). Low
and high buoyant density B cells were prepared by centrifugation over a
discontinuous Percoll gradient containing 55–60 and 70% layers. B
cells at the medium/55–60 and 60/70% interface were collected
separately and used as large and small B cells, respectively. Where
indicated, the BCL1 B cell leukemia line (51) (provided by
Cell Resource for Biomedical Research, Tohoku University) was used as
alternative APCs for the Th1 induction or activation.
|
CD4+ T cells were prepared from spleens of
unimmunized OVA-specific TCR tg mice by depleting
CD8+ and Ia+ cells using a
panning method (47).
B220+CD11c- B cells
(2.5 x 106) purified from unimmunized
BALB/c mouse spleens or the BCL1 B cell line were pulsed with OVA
and/or CpG for 3 h. The BCL1 cell line was then fixed with 0.5%
paraformaldehyde at 37°C for 15 min. After extensive washing they
were cocultured with 2.5 x 106 OVA-specific
CD4+ T cells in 2 ml medium in 12-well plates.
After 6 days of culture, viable lymphocytes (1 x
105) recovered by Ficoll-Paque (Pharmacia
Biotech) density-gradient centrifugation were restimulated with 2
x 105 APCs in the presence or the absence of OVA
(100 µg/ml) in quadruplicate in 96-well plates. APCs were prepared by
treating spleen cells from unimmunized BALB/c mice with mitomycin C
(MMC; 50 µg/ml; Wako Pure Chemical) for 30 min at 37°C. After 2
days of culture, the culture supernatants were assayed for IFN- and
IL-4. To neutralize IL-12 activity, 10 µg/ml anti-IL-12 (Genzyme,
Cambridge, MA) or isotype-matched control mAb (rat IgG2a; BD
PharMingen, San Diego, CA) were included in the cultures.
Restimulation of OVA-specific Th1 cells with CpG and OVA
OVA-specific TCR tg Th1 (hereafter referred to as Th1) cells
were induced in vitro and enriched for CD4+ cells
as described previously (47). In brief, spleen cells from
unimmunized OVA-specific TCR tg mice were cultured with OVA (100
µg/ml) and IL-12 (1 ng/ml). After 6 days of culture, viable
lymphocytes were enriched for CD4+ T cells by a
panning method. CD4+ Th1 cells (1 x
105) were cultured in 96-well plates with 2
x 105 untreated spleen cells or
B220+CD11c- B cells from
BALB/c mice or the BCL1 B cell line as APCs in the presence of OVA
and/or CpG in quadruplicate. After 2 days of culture, the culture
supernatants were assayed for IFN- and IL-4. The enriched T cells
failed to produce IFN- or IL-4 in response to OVA or CpG-OVA in the
absence of additional APCs.
Restimulation of anti-OVA Th1 cells by TNP-primed B cells
BALB/c mice were immunized in the hind footpads with TNP-KLH or
KLH emulsified in CFA (Difco, Detroit, MI). After 1 wk, popliteal LN
cells were pooled from three mice and purified for
B220+CD11c- B cells as
described above. CD4+ Th1 cells (1 x
105) were cultured with 2 x
105 purified B cells in the presence of OVA
conjugated with CpG, TNP, or both in quadruplicate in 96-well plates
for 2 days, and the culture supernatants were assayed for IFN-.
Stimulation of the purified B cells with CpG
The purified B220+CD11c- B cells (2 x 105/well) from unimmunized BALB/c mice were cultured with LPS (Sigma-Aldrich), CpG, or control non-CpG ODNs in quadruplicate in 96-well plates. After 2 days of culture, the culture supernatants were assayed for IL-12 by ELISA as described below.
Cytokine assay
The concentrations of IFN- and IL-4 in the culture
supernatants were determined using ELISA as described previously
(52). The concentrations of IL-12 were determined using
paired anti-IL-12 mAbs (BioSource International, Camarillo, CA)
according to the manufacturer’s instructions. Tetramethylbenzidine
reagent (Kirkegaard & Perry Laboratories, Gaithersburg, MD) was used
for color development, and ODs determined at 450 nm were converted to
concentrations (nanograms per milliliter) according to a standard
curve. Standard recombinant mouse IL-12 was purchased from PeproTech
(Rocky Hill, NJ).
Reagents used for flow cytometry
FITC-conjugated anti-B220 mAb, PE-conjugated anti-IL-12 mAb, and allophycocyanin-conjugated streptavidin (SA) were purchased from Immunotech (Westbrook, ME), BD PharMingen, and Biomeda (Foster City, AC), respectively. Biotinylated anti-CD40 and anti-CD86 mAbs were purchased from Caltag Laboratories (Burlingame, CA). Anti-I-Ad mAb (MK-D6) (53) was partially purified from ascites by ammonium sulfate precipitation and conjugated to biotin (Sigma-Aldrich) in our laboratory.
Analyses of B cells by flow cytometry
The B220+ B cells from unimmunized spleens were incubated with PE alone, a mixture of PE and CpG, or graded doses of PE-CpG conjugates overnight. The cells were stained with FITC-conjugated B220 mAb together with biotinylated anti-CD40, anti-CD86, or anti-I-Ad mAb. The binding of biotinylated mAbs was detected with allophycocyanin-SA. The correlations between PE staining and the CD40, CD86, or I-Ad expression on the viable B220+ B cells were analyzed using FACSCalibur (BD Biosciences, Mountain View, CA). Propidium iodide (Sigma-Aldrich)-stained dead cells were excluded from analyses. For staining of intracytoplasmic IL-12, the purified B220+ B cells were cultured with CpG or LPS overnight, with 10 µg/ml brefeldin A (Wako Pure Chemical) added for the final 4 h. After staining with FITC-labeled anti-B220 mAb, the cells were treated with cell permeabilization solution (Immunotech, Minneapolis, MN) and then stained with PE-labeled anti-IL-12 mAb (0.3 µg). Where indicated, a 20-fold excess of unlabeled anti-IL-12 mAb (BD PharMingen) was also added. They were analyzed by flow cytometry.
Statistics
Data from in vitro culture experiments are expressed as the mean ± SEM. Each experiment was repeated at least twice. Student’s t test was used in the analysis of the results.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We first determined whether unprimed B cells could present Ag to
OVA-specific Th1 cells. Spleen cells from unimmunized BALB/c mice (Fig. 1
A) were enriched for B cells using magnetic beads. The
purity of B220+ B cells was >98%, and the
contamination by CD11c+ DCs was <0.5% (Fig. 1B). When spleen cells were employed for APCs, the Th1 cells
predominantly produced IFN- in response to OVA. With the purified B
cells, however, Th1 cells failed to produce IFN- in response to
10–100 µg/ml OVA, verifying the depletion of DCs and the high purity
of the B cell fraction (Fig. 1C). The lack of cytokine
production from the Th1 cells cultured with CpG-OVA in the absence of
APCs substantiated the depletion of DCs in the Th1 population (data not
shown). The purified B cells failed to present OVA in the copresence of
10 µg/ml CpG, whereas the same B cells cultured with CpG-OVA
conjugate potently activated Th1 cells for the production of IFN-,
but not IL-4, in a dose-dependent manner. We also employed purified
CpG-OVA that contained minimal amounts of aggregates (47)
and found that the monomeric CpG-OVA and CpG-OVA before purification
were comparable in their ability to activate Th1 cells (Fig. 1D), indicating that the Th1 activation reflects the
feature of the monomeric CpG-conjugated OVA, but not the
aggregates. Although B cells could also present non-CpG
ODN-conjugated OVA to Th1 cells, the IFN- levels induced by
non-CpG-OVA were significantly lower than those induced
by CpG-OVA (Fig. 1E). Neither large nor small B cells
presented OVA to Th1 cells, whereas both B cell populations presented
CpG-OVA to stimulate Th1 cells to comparable levels at the doses tested
(Fig. 1F).
Differentiation of Th1 cells from naive T cells by stimulation with CpG-OVA and unprimed B cells
We next examined whether purified B cells could induce the
differentiation of Ag-specific Th1 cells from naive T cells.
CD4+ T cells precultured with MMC-treated spleen
cells and OVA developed into effector Th cells that produced comparable
levels of IFN- and IL-4 upon antigenic stimulation. However,
CD4+ T cells precultured with purified B cells in
the presence of 100 µg/ml OVA did not produce cytokines upon
restimulation with Ag in the presence of APCs (Fig. 2A). The B cells failed to
present OVA to naive T cells for the development of effector Th cells
even after stimulation with a mixture of OVA and CpG. In contrast, the
conjugate of the corresponding doses of CpG and OVA induced naive T
cells for the development of Th1 cells. Purified monomeric CpG-OVA
devoid of aggregates had a Th1-inducing activity comparable to that of
CpG-OVA before fractionation, indicating that the Th1 development can
be ascribed to the monomeric CpG-OVA conjugates. The non-CpG-OVA
conjugate failed to induce the differentiation of naive T cells. It was
also found in an additional experiment that IFN- production of Th1
cells induced by CpG-OVA increased in a dose-dependent manner (Fig. 2B). The results clearly showed that unprimed B cells could
present Ag to induce the Th1 differentiation from unprimed T cells if
the Ag was in the form of a conjugate with CpG.
|
We then determined the effects of CpG in the conjugate on Ag
uptake by and the expression of costimulatory molecules on B cells. To
track the fate of Ag, CpG-conjugated PE was employed. Previous
experiments showed that CpG-PE contained no discernible amounts of
aggregates, as determined by SDS-PAGE, and that free PE or CpG in the
CpG-PE preparation did not affect the function of DC (47).
Splenic B cells were incubated overnight with either the conjugate or a
mixture of PE and CpG, and PE in B220+ cells and
the expression of costimulatory molecules were analyzed by flow
cytometry. As shown in Fig. 3, the CpG-PE
conjugate and the mixture were comparable in activities for increased
expression of CD86, CD40, and class II MHC. However, PE staining in B
cells was entirely different between the two; only a minor fraction
(1.4–1.8%) of unimmunized B cells phagocytosed PE in the mixture.
After incubation with CpG-PE, the proportion of PE-bearing B cells
(19.4–100%) and the intensity of PE staining increased in a
dose-dependent manner, and the enhanced PE staining paralleled
the increase in the expression of costimulatory molecules.
Most notable was CD86 expression. The results show that the
CpG-PE conjugate induced concomitant increases in CD86 expression and
PE uptake in a dose-dependent fashion. CpG in the mixture with PE
induced CD86 expression without an accompanying increase in PE uptake.
After activation with CpG-PE conjugate, B cells with higher levels of
PE expression exhibited concomitant increases in the expression of
CD40 and class II molecules. In additional experiments, the effects
of non-CpG control ODN were examined. The control ODN-conjugated PE did
not increase the expression of CD86(Fig. 3B).
|
We determined whether IL-12 secreted from B cells facilitated Th1
differentiation by the CpG-OVA conjugate. First, we assessed IL-12
production by CpG-activated B cells. CpG stimulated purified B cells to
form IL-12 in a dose-dependent manner (Fig. 4A). The CpG-OVA conjugate
also induced IL-12 formation to comparable levels as CpG alone at two
different doses. Non-CpG ODNs failed to induce IL-12 formation. The
unstimulated or LPS-stimulated B cells failed to produce IL-12, as
reported previously (54). The results confirmed the
exclusion of DCs, which produce IL-12 in response to LPS stimulation
(55), in the B cell preparation.
|
B). The induction of Th1
differentiation by purified B cells was neutralized by anti-IL-12
mAb, but not by the isotype-matched control. Control non-CpG ODNs
failed to induce Th1 differentiation.
More concrete evidence for the formation of IL-12 by B cells was
obtained by the staining of intracytoplasmic IL-12 in gated
B220+ B cells (Fig. 5). Neither unstimulated
B220+ B cells nor LPS-activated B cells were
stained with PE-labeled anti-IL-12 mAb, substantiating the lack of
nonspecific staining with PE-labeled anti-IL-12 mAb. In contrast,
the staining of CpG-activated B cells with PE-labeled anti-IL-12
mAb shifted the staining of the whole population by nearly 4 times, as
judged by the increase in the mean fluorescence intensity (from 11.42
to 44.67). The proportion of B cells scored as positive for IL-12
staining increased to 16.5%. IL-12 staining was specific, because
pretreatment of CpG-activated B cells with unconjugated anti-IL-12
mAb inhibited binding of PE-labeled anti-IL-12 mAb. Thus, we
concluded that CpG-conjugated Ag induced Ag-specific Th1 cell
differentiation through the elaboration of IL-12 in B cells.
|
We next examined the effects of sIg-mediated capture
of CpG-conjugated Ag on Th1 cell activation. TNP-primed and control B
cells were prepared from TNP-KLH- and KLH-primed LN cells,
respectively, and cultured with OVA-specific Th1 cells and OVA
conjugated with CpG, TNP, or both. Th1 cells produced low levels of
IFN- in response to TNP- or CpG-conjugated OVA presented by
TNP-primed B cells, whereas the same concentration of OVA conjugated
with both TNP and CpG stimulated Th1 cells when TNP-primed, but not
control, B cells were used as APCs (Fig. 6). In addition, TNP-KLH-primed B cells
induced IFN- production to a level comparable to that induced by
KLH-primed B cells when cultured with Th1 cells and the combination of
TNP-BSA-CpG plus OVA-CpG (Fig. 6A). These results indicate
that the Ag-specific sIg-mediated Ag capture enhanced Ag presentation
and Th1 activation by primed B cells in a synergistic manner with
Ag-nonspecific CpG-mediated Ag capture.
|
We examined the Ag-presenting ability of the B cell leukemia line
to exclude the possible contribution of DCs that might have
contaminated the purified B cell population. The BCL1 B cell line
activated Th1 cells by presenting CpG-OVA in a dose-dependent
manner (Fig. 7A), as did the
purified B cells shown in Fig. 2C. Similarly, the BCL1 B
cell line also induced Th1 cells from naive T cells in the presence of
CpG-OVA (Fig. 7B), as did the purified B cells shown
in Fig. 2A. These results reinforce our contention that
purified unprimed B cells, but not contaminating DCs, induce or
activate Th1 cells.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In this report we disclosed features of B cells that challenge the
ideas described above if Ag is chemically conjugated with CpG. B cells
could efficiently capture the conjugate and present antigenic peptides
to Th cells regardless of the Ag specificity of sIg (
Figs. 1–3), and
CpG-stimulated B cells could induce Th1 development by producing a
sufficient amount of IL-12 (Figs. 2, 4, and 5). The efficient Ag uptake
in an Ag-nonspecific manner and the ability to induce Th1
differentiation from naive T cells had been considered to be unique to
DCs. Here, we demonstrate that B cells are also endowed with these
characteristics and can work like DCs provided that Ag is linked
to CpG.
During the course of our studies of regulatory
CD4+ T cells that control Th2 responses, we found
that the CpG-OVA conjugate induced Ag-specific Th1 cells and inhibited
airway eosinophilia (46). One of underlying mechanisms was
the augmented capture of the CpG-tagged Ag by DCs in a CpG-guided
manner, because PE conjugated to CpG bound to DCs >100-fold more than
PE mixed with CpG (47). In this study we found that the
same mechanism for capturing Ag applies to B cells. B cells had been
thought to be poor for nonspecific Ag uptake (10, 18, 19).
Under physiological conditions, B cells neither efficiently processed
Ag (Fig. 3) nor stimulated Th cells (Figs. 1 and 2). The activation of
B cells by CpG failed to improve the uptake of Ag (Fig. 3) or the
presentation of antigenic peptide to Th cells (Figs. 1 and 2). When CpG
were conjugated to Ag, however, B cells could present the Ag and serve
as efficient APCs in an Ig-independent manner (
Figs. 1–3). The
enhanced uptake of CpG-conjugated Ag by B cells is considered to
reflect the efficient binding of CpG to surface receptors specific for
ODNs (59), which, however, have not been defined
yet.
IL-12 was initially identified as a product of human transformed B
lines, whereas it had been controversial whether murine B cells
produced IL-12 (54, 60). There has been accumulating
evidence that B cells as APCs are likely to skew T cell immune
responses toward the Th2-dominant phenotype (21, 22, 23, 24, 25, 26, 27). In
sharp contrast to these earlier studies, we here demonstrate that B
cells secreted IL-12 (Figs. 4 and 5) and can play a decisive role in
Th1 differentiation from unprimed T cells (Fig. 2). Recently, B
effector 1 (Be1) stimulated with Th1 cells was reported to produce
IL-12, although IL-12 failed to polarize the naive T cells to
differentiate into Th1 cells (61). IL-12 production from
Be1 cells was detected upon restimulation following an initial 4-day
culture with Th1 cells, whereas naive B cells could secrete IL-12 in
response to overnight CpG stimulation. Thus, CpG-activated B cells and
Be1 cells appear to represent the distinct activation status of B
cells.
The nonspecific Ag uptake that is independent of sIg specificity is
mediated by other receptors on B cells. The most notable is CD21
(complement receptor type 2)-mediated endocytosis. The Ag coupled to C3
fragment is taken up in an Ag-nonspecific manner and presented to T
cells as efficiently as those bound through sIg (62, 63, 64).
CD21 ligation failed to up-regulate costimulatory molecules (65, 66), whereas the activation of B cells by CpG enhanced the
expression of costimulatory molecules (Fig. 3), which highlights the
advantage of CpG as an immunostimulator.
What, then, could the physiological significance of the B cell
responses to CpG be? Ag-primed B cells are known to be efficient APCs
following Ag capture through sIg (10, 18, 19) and
activation (15, 16, 17). They are likely to induce
Th2-dominant responses (21, 22, 23, 24, 25, 26, 27). However, we have found
that CpG-activated B cells can initiate Th1 responses (Figs. 1 and 2).
Thus, B cells as APCs can modulate the immune outcome by converting
Th2-oriented responses to Th1-dominant responses in the presence of
CpG. An additional surprising finding is that the Th1 inducibility of
Ag-primed B cells was further amplified when the B cells bind to Ag in
both CpG- and sIg-mediated manners (Fig. 6). This mechanism might be
very advantageous for the induction of defensive Th1 responses against
microbial infections. Microbe-specific B cells could bind to bacteria
through sIg and CpG when bacteria are tagged with DNA spelled from
degraded microbes. This scenario could be plausible, since bacteria
express surface receptors specific for DNA (67).
In summary, we showed that B cells share common roles with APCs with DCs, including the Ag-nonspecific capture and the induction of Th1 differentiation from unprimed T cells.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Kunio Sano, Department of Respiratory and Infectious Diseases, Graduate School of Medicine, Tohoku University, Sendai 980-8574, Japan. E-mail address: sano{at}int1.med.tohoku.ac.jp
3 Abbreviations used in this paper: DC, dendritic cell; Be1, B effector 1; ODN, oligodeoxynucleotide; CpG, CpG ODN; KLH, keyhole limpet hemocyanin; MMC, mitomycin C; PE, R-PE; SA, streptavidin; sIg, surface Ig; tg, transgenic; TNP, trinitrophenyl.
Received for publication January 25, 2002. Accepted for publication May 10, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production is dependent on macrophage secretion of IL-12. Clin. Immunol. Immunopathol. 84:185.[Medline]
This article has been cited by other articles:
|
|
 |
|
  F. Hjelm, M. C. I. Karlsson, and B. Heyman A Novel B Cell-Mediated Transport of IgE-Immune Complexes to the Follicle of the Spleen J. Immunol., May 15, 2008; 180(10): 6604 - 6610. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Shirota, L. Petrenko, C. Hong, and D. M. Klinman Potential of Transfected Muscle Cells to Contribute to DNA Vaccine Immunogenicity J. Immunol., July 1, 2007; 179(1): 329 - 336. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L.-A. M. Pozzi, J. W. Maciaszek, and K. L. Rock Both Dendritic Cells and Macrophages Can Stimulate Naive CD8 T Cells In Vivo to Proliferate, Develop Effector Function, and Differentiate into Memory Cells J. Immunol., August 15, 2005; 175(4): 2071 - 2081. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. B. Drennan, B. Stijlemans, J. Van Den Abbeele, V. J. Quesniaux, M. Barkhuizen, F. Brombacher, P. De Baetselier, B. Ryffel, and S. Magez The Induction of a Type 1 Immune Response following a Trypanosoma brucei Infection Is MyD88 Dependent J. Immunol., August 15, 2005; 175(4): 2501 - 2509. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Li, A. C. Grover, E. J. Donald, A. Carr, J. Yu, J. Whitfield, M. Nelson, N. Takeshita, and A. E. Chang Simultaneous Targeting of CD3 on T Cells and CD40 on B or Dendritic Cells Augments the Antitumor Reactivity of Tumor-Primed Lymph Node Cells J. Immunol., August 1, 2005; 175(3): 1424 - 1432. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Yasuda, P. Yu, C. J. Kirschning, B. Schlatter, F. Schmitz, A. Heit, S. Bauer, H. Hochrein, and H. Wagner Endosomal Translocation of Vertebrate DNA Activates Dendritic Cells via TLR9-Dependent and -Independent Pathways J. Immunol., May 15, 2005; 174(10): 6129 - 6136. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Hon, A. Oran, T. Brocker, and J. Jacob B Lymphocytes Participate in Cross-Presentation of Antigen following Gene Gun Vaccination J. Immunol., May 1, 2005; 174(9): 5233 - 5242. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Heit, K. M. Huster, F. Schmitz, M. Schiemann, D. H. Busch, and H. Wagner CpG-DNA Aided Cross-Priming by Cross-Presenting B Cells J. Immunol., February 1, 2004; 172(3): 1501 - 1507. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Attanavanich and J. F. Kearney Marginal Zone, but Not Follicular B Cells, Are Potent Activators of Naive CD4 T Cells J. Immunol., January 15, 2004; 172(2): 803 - 811. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wagner, H. Poeck, B. Jahrsdoerfer, S. Rothenfusser, D. Prell, B. Bohle, E. Tuma, T. Giese, J. W. Ellwart, S. Endres, et al. IL-12p70-Dependent Th1 Induction by Human B Cells Requires Combined Activation with CD40 Ligand and CpG DNA J. Immunol., January 15, 2004; 172(2): 954 - 963. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Sano, H. Shirota, T. Terui, T. Hattori, and G. Tamura Oligodeoxynucleotides Without CpG Motifs Work as Adjuvant for the Induction of Th2 Differentiation in a Sequence-Independent Manner J. Immunol., March 1, 2003; 170(5): 2367 - 2373. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
IL-12) or
isotype-matched control (CTRL) mAb (10 µg/ml). After 6 days of
culture, 1 x 105 viable lymphocytes were restimulated
with OVA (100 µg/ml) and 2 x 105 MMC-treated spleen
cells for 2 days, and culture supernatants were assayed for IFN-
) or KLH (
) in CFA. B
cells (2 x 105) were cultured with 1 x
105 CD4+ Th1 cells in the presence of 0.1
µg/ml (A) or 1.0 µg/ml (B) of the
indicated stimulants for 2 days, and culture supernatants were assayed
for IFN-