| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Department of Immunology and Cell Biology, Research Center Borstel, Borstel, Germany; and
Department of Experimental Pneumology, University Hospital Bergmannsheil, Bochum, Germany
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
release.
However, inhibition of T cell functions such as proliferation, IL-2
release, and IL-2 mRNA production did also occur when isolated T cells
were activated in the absence of monocytes with immobilized Abs
directed against CD3 in combination with cross-linked anti-CD28
Abs. The effect could be reversed when low concentrations of exogenous
IL-2 instead of anti-CD28 were used as a costimulus in combination
with anti-CD3 Abs. Further evidence for direct modulation of T cell
function by PF-4 was obtained by the detection of specific binding
sites for the chemokine on the surface of these cells. Taken together,
our results show that specific binding of PF-4, resulting in the
down-regulation of the IL-2-release correlates with the inhibition of
functions in activated T cells. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and -1
are
able to induce chemotaxis and adherence, as well as transendothelial
migration of T cells or specific T cell subsets (reviewed in Ref.
2). Furthermore, three members of the CXC subfamily of
chemokines, the IFN--inducible protein 10 (IP10), the human Mig, and
the most recently discovered IFN-inducible T cell chemoattractant
have been shown to attract activated T cells through binding to their
common receptor CXCR3 (3, 4). Besides these typical
chemokine functions, little is known about a potential role of
these molecules in the control of TCR-mediated responses. In a
pioneering work, Taub and coworkers (5) demonstrated that
CC chemokines RANTES, MCP-1, and MIP-1 are capable of directly
costimulating human T cell proliferation as well as IL-2 production in
the presence of anti-CD3 Abs. In addition, these chemokines
enhanced Ag-specific proliferation and increased the level of CD25
surface expression on T cells.
Platelet factor 4 (PF-4), a member of the CXC subgroup of the chemokine
family, is released in high concentrations from activated platelets
(6, 7). The functional role of PF-4 appears to be quite
exceptional. In a recent report we could show that highly purified PF-4
lacks chemotactic activity for polymorphonuclear neutrophil
(PMN), but in the presence of TNF- stimulates these cells to
exhibit functions like exocytosis of secondary granule markers or tight
adhesion to different surfaces (8). Investigating PF-4
binding sites, we could demonstrate that PF-4-induced functions were
not elicited through binding to IL-8Rs or another
seven-transmembrane-domain molecule, but through interaction with an
integral chondroitin sulfate proteoglycan expressed on the surface of
human PMN (9, 10). Apart from short-term responses, PF-4
activity was shown to be also involved in long-term differentiation and
regulatory processes such as the control of endothelial cell and
fibroblast proliferation (11, 12, 13) and the support of the
survival of hemopoietic stem cells as well as of progenitor cells
(14). In a most recent report, we could show that PF-4
prevents human monocytes from spontaneous apoptosis and induces
differentiation of monocytes into a certain subtype of macrophages
(15). In contrast to GM-CSF-exposed or serum-derived
macrophages, PF-4-treated cells were characterized by a total lack of
surface-expressed HLA-DR Ag, while the costimulatory molecule B7-2 was
found to be significantly up-regulated on the cell membrane.
Because a loss of HLA-DR could affect the capacity of macrophages to present Ag to T cells, we studied potential direct or indirect effects of PF-4 on human T cell activation in vitro. Our results demonstrate that PF-4 can act as a potent regulator of T cell functions by down-modulating cell proliferation and cytokine release. These results may indicate a potential role for PF-4 as a mediator of long-term effects in the regulation of inflammatory processes in vivo.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Human natural PF-4 was purified to homogeneity from release supernatants of thrombin-stimulated platelets in a three-step procedure as previously described (8). The preparations contained <0.125 ng LPS/mg PF-4 (i.e., below 4 pg/ml at 4 µM PF-4) as determined by the Limulus amoebocyte lysate assay, ruling out potential side effects caused by contaminating LPS. PF-4 was lyophilized, stored at -80°C, and reconstituted to stock solutions of 1 or 2 mg/ml in 0.1% trifluoroacetic acid (TFA) before use.
Abs and fluorescence labeling
For stimulation of T cells, murine mAbs against CD3 (clone X35; Dianova, Hamburg, Germany) and CD28 (clone 28.1; Serotec, Wiesbaden, Germany) in combination with a rat-anti-mouse Ig antiserum (Dianova) were used. All Abs were without sodium azide and tested for low endotoxin levels.
Immunophenotyping of the cells was performed with the following mAbs: anti-CD3 (UCHT-1, IgG1; DAKO, Hamburg, Germany), anti-CD14 (M5E2, IgG2A; BD Biosciences, Heidelberg, Germany), anti-CD16 (DJ130c, IgG1; DAKO), anti-CD19 (HD37, IgG1; DAKO), anti-HLA-DR (L243, IgG2A; BD Biosciences), and the appropriate IgG1 and IgG2A isotype control Abs (DAKO), all directly labeled with PE. Briefly, 1 x 106 cells were stained at 4°C with amounts of Ab according to the recommendations of the manufacturer. Thereafter, the cells were washed, resuspended in PBS, and fixed with 3% paraformaldehyde solution for storage until analysis in the flow cytometer (FACSCalibur; BD Biosciences). The Abs directed against CD16, CD19, and HLA-DR were also used for T cell isolation (see next section). A murine mAb against PF-4 (clone PF63.1) was generated in our laboratory (15).
Cell preparation and culture
PBMC were prepared from venous blood of healthy single donors
using density gradient centrifugation (16). The obtained
PBMC were further separated into lymphocyte and monocyte fractions
using counterflow centrifugation as previously described
(17). Purity of the monocyte fractions exceeded 95% as
determined by flow cytometry analysis of CD14 expression and
-naphtyl-esterase staining (17). Peripheral blood T
cells were isolated from the lymphocyte fractions by MACS as previously
described (18). Briefly, 50 x
106 lymphocytes were suspended in 5 ml PBS and
labeled with Abs directed against CD16, CD19, and HLA-DR (50 µl
each), and incubated for 20 min on ice. After a washing-step, cells
were incubated with a biotin-conjugated goat-anti-mouse Ig
antiserum (diluted 1/100) and finally combined with
streptavidin-coupled magnetic microbeads (diluted 1/10; Miltenyi
Biotec, Bergisch Gladbach, Germany). The labeled cells were passed
through a magnetic separation column, the effluent cells were collected
and analyzed by flow cytometry. Purity of T cells was determined by
flow cytometry analysis of CD3 expression and passed 97% without
detectable platelet contamination in all experiments.
All cell cultures (T cells, T cells with monocytes, and PBMC) were performed in RPMI 1640 medium containing 10% v/v heat-inactivated FCS (Biochrom, Berlin, Germany), 100 U/ml penicillin G (Biochrom), 100 µg/ml streptomycin (Biochrom), and 2 mM L-glutamine (Biochrom) in 96-well flat-bottom microtiter plates (200,000 cells/well; Nunc, Roskilde, Denmark). Viability of cells was routinely tested before and after stimulation by trypan blue exclusion and exceeded always 95%.
Binding of PF-4 to T cells
Iodination of PF-4 and binding experiments with iodinated PF-4 to T cells were performed as described for PMN in detail elsewhere (9). Briefly, cells were suspended at 2 x 107 cells/ml in D-PBS supplemented with 20 mg/ml BSA (binding buffer), and duplicate samples of 2 x 106 cells were incubated on ice for 2 h with 5-nM 125I-labeled PF-4 in the presence or absence of increasing concentrations of unlabeled PF-4.
Alternatively, the association of PF-4 with T cell surfaces was determined by using indirect immunofluorescence labeling: 1 x 106 T cells were incubated in 100-µl volumes with increasing concentrations of PF-4 for 1 h on ice or left untreated. After repeated washing steps, cells reacted for 30 min on ice with saturating concentrations of mAb PF63.1 (10 µg/ml) to allow direct correlation between the Ab signal obtained and the relative amount of cell-associated PF-4. Following another washing step, the cells were incubated with a FITC-conjugated goat-anti-mouse Ig Ab (Dianova) for 30 min on ice and finally analyzed by flow cytometry. In some experiments, PF-4 (4 µM) was preincubated with heparin (20 µg/ml; Sigma-Aldrich, St. Louis, MO) for 30 min at 37°C before addition to the cells. In assays where chondroitinase ABC-digested T lymphocytes were used, 5 x 106 cells were treated with 1 U/ml of the enzyme (protease-free; Sigma-Aldrich) for 30 min at 37°C as described previously for neutrophils (9) and subsequently tested for their capacity to bind PF-4.
Activation of T cells
For polyclonal stimulation, anti-CD3 Abs (clone X35) were immobilized to the surface of 96-well flat-bottom microtiter plates (Nunc) using a modification of the method described by Geppert and Lipsky (19). Briefly, volumes of 30 µl of Ab solution (1 µg/ml in PBS) per well were incubated for 1 h at 37°C. Following removal of unbound Ab by washing with HBSS, cells were distributed into the wells and, when indicated, anti-CD28 Abs were added (final concentration 1 µg/ml). After 30 min at 37°C, cross-linking was performed by addition of rat-anti-mouse Ig (0.5 µg/ml). PF-4 was added directly to the cell suspension before seeding into the culture plates (final concentration 4 µM).
In some experiments, native human IL-2 (Blutspendedienst Niedersachsen, Springe, Germany) at a concentration of 10 U/ml was used instead of anti-CD28 Abs.
For antigenic stimulation, PBMC or T cells reconstituted with 10% autologous monocytes were seeded into culture plates (in the presence and absence of PF-4 at concentrations indicated in the text) and stimulated with purified protein derivative of tuberculin (PPD; Statens Serum Institut, Copenhagen, Denmark) at a concentration of 10 µg/ml or with tetanus toxoid (TTX; Behring Werke, Marburg, Germany) at a concentration of 5 LF/ml.
Determination of lymphoproliferation and cytokine release
Cell proliferation was determined after 80 h of culture by
pulsing the cells for 16 h with 17.4 kBq
[3H]methylthymidine (Amersham-Buchler,
Braunschweig, Germany) per well. Thereafter, the cells were harvested
onto glass fiber filtermats and the radioactivity was measured by beta
scintillation counting. The release of cytokines into the supernatant
was determined by sandwich ELISA. Cell culture supernatants were
harvested after 24 and 96 h and analyzed for their content of IL-2
and IFN-, respectively. ELISA for IL-2 (BD PharMingen, Hamburg,
Germany) was performed as recommended by the manufacturer while ELISA
for IFN- (a kind gift from Dr. H. Gallati, Intex, Mutans,
Switzerland) was done as described elsewhere (20).
Quantitative RT-PCR
Cells (106/well) were cultured for 24 h in a 24-well culture plate using various stimuli, centrifuged, and the resulting cell pellets were frozen at -80°C. T cell mRNA was isolated using mRNA Direct MicroKit (Dynal, Hamburg, Germany) and subsequently reverse transcribed into cDNA (Superscript II; Invitrogen, Karlsruhe, Germany) according to the manufacturer’s protocols. Quantitative PCR was performed in a LightCycler instrument (Roche, Mannheim, Germany) using 2 µl cDNA and 8 µl PCR master reaction (FastStart DNA Master SYBR Green I; Roche) for the following primer combinations and PCR parameters: GAPDH, 5' primer: accacagtccatgccatcac, 3' primer: tccaccaccctgttgctgttgctgta, annealing temperature 58°C; quantification at 88°C after 19 s elongation time at 72°C; IL-2, 5' primer: cacagctacaactggagcattta, 3' primer: agaaattctacaatggttgctgtc, annealing temperature starting at 68°C and touching down to 58°C with a decrease of 0.5°C/cycle, quantification after 16 s elongation time at 72°C. For quantification, several dilutions of stimulated human mononuclear cell cDNA was used as internal standard and calculation was performed using LightCycler software version 3.5.3 (Roche) and the second derivative maximum algorithm. Data were expressed as ratio between amounts of mRNA of IL-2 and GAPDH.
Determination of intracellular free calcium and chemotaxis
Intracellular Ca2+ transients were
measured using the fura 2 method as described previously for human
neutrophils (8). T cell chemotaxis was measured using a
48-well Boyden’s chamber (NeuroProbe, Cabin John, MD) according to the
method of Ludwig et al. (21). Briefly, agonists were
serially diluted in RPMI 1640 (without phenol red) containing 0.1% BSA
and added to the bottom wells of the chamber. These were covered with a
polycarbonate membrane (pore size 5 µm; Costar Nucleopore,
Tübingen, Germany), and the top wells received 1 x
105 purified T cells suspended in 50 µl RPMI
1640 supplemented with 0.1% BSA. After incubation for 2.5 h at
37°C in an atmosphere containing 5% CO2 cells
in the bottom, wells were lysed and the number of migrated cells was
determined by measurement of endogenous -glucuronidase enzymatic
activity and calculation from a standard of lysed cells run in
parallel.
Statistics
All experiments were performed four to eight times. Due to the quantitative differences measured for single donors, the data from proliferation and cytokine responses were not pooled. The statistical significance of these results was analyzed by using Wilcoxon’s signed-ranks test for paired samples. This nonparametric test does not require a normal gaussian distribution of the samples.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In a first approach, a potential impact of PF-4 on the
proliferation of human T lymphocytes was investigated. Mononuclear
cells were isolated as described and subsequently stimulated with the
recall Ag tuberculin (PPD, from Mycobacterium tuberculosis)
in the presence or absence of increasing concentrations of PF-4 (0.1–8
µM). After 96 h of culture, the rate of lymphoproliferation was
determined by incorporation of
[3H]methylthymidine. As depicted in Fig. 1
, the proliferation rate of cells
treated with PF-4 concentrations up to 0.1 µM did not differ from
that receiving no PF-4 (
5600 cpm). However, PF-4 dosages of 0.5 µM
or higher provoked a dose-dependent decrease in cell proliferation,
with maximal inhibition by 60% observed at 4 µM PF-4. No effect
was seen in cultures run in parallel receiving only medium supplemented
with an equivalent proportion of the PF-4 solvent TFA (data not shown).
In the absence of PPD, no cell proliferation was seen, irrespective of
whether PF-4 was present or not (data not shown). Because a dosage of 4
µM PF-4 appeared to be optimal, this dosage was chosen for all
additional experiments. These data suggested a potent immunomodulatory
function of PF-4. However, because mononuclear cells represent a mixed
fraction of T cells, B cells, NK cells, and monocytes, it remained
unclear whether the observed effect was caused by changes in the
interaction between monocytes and T cells or whether other cell types
could also participate in this process.
|
release in
cocultures of monocytes and T cells
In a next series of experiments, we analyzed the effects of PF-4
on Ag-specific T cell activation by the use of highly purified
leukocyte subsets. T cells were cultured with 10% autologous monocytes
as APCs and stimulated with PPD or TTX (from Clostridium
tetani). Additional to the rate of lymphoproliferation, the
release of the typical Th1 cytokine IFN- was determined as an
important activation marker for the recall Ags tuberculin and TTX.
Stimulation of Ag-specific T cells with the appropriate Ag, either
tuberculin or TTX, led to cell proliferation (16,200 and 28,700
cpm, respectively; Fig. 2A)
and secretion of IFN- (9,200 and 6,600 pg/ml, respectively;
Fig. 2B). Neither proliferation nor IFN- release were
observed in control cultures run in parallel and receiving no Ag (data
not shown). The presence of PF-4 caused a substantial and significant
(p < 0.001, calculated on the basis of 10
experiments) inhibition of both cell proliferation (84 and 79% of
inhibition) and IFN- release (81 and 84% of inhibition) in PPD and
TTX-stimulated cells, respectively. Again, treatment of cells with the
solvent TFA was without effect on the responses measured. These data
provide evidence that either monocytes or T cells are the principal
effector cells responsible for the inhibitory effects of PF-4 on T cell
proliferation and cytokine release, while the presence of other cell
types from the mononuclear cell fraction is not required.
|
To investigate whether there existed a direct effect of PF-4 on T
cells, experiments with highly purified T cells in the absence of
monocytes were performed. In a polyclonal stimulation model, PF-4 or a
corresponding amount of medium was added to purified T cells, which
were activated with immobilized anti-CD3 and cross-linked
anti-CD28 as described in Materials and Methods. Control
cultures were performed in parallel in the absence of any Ab or with
anti-CD3 alone. Because T cells do not produce IFN- in such a
stimulation model, the secretion of IL-2 and the rate of
lymphoproliferation were determined as activation markers after 24 and
96 h, respectively. Stimulation with immobilized anti-CD3
alone did not induce a relevant cell proliferation (780 cpm in
[3H]thymidine incorporation, Fig. 3A), indicating that no
accessory cells were left in the T cell preparation. Furthermore,
treatment with PF-4 alone or in combination with CD3 Abs was without
effect on this cell function. However, the combination of anti-CD3
and anti-CD28 induced a strong proliferative response (34,500
cpm), which became significantly (p < 0.005)
reduced by >64% in the presence of PF-4. Interestingly, this
inhibitory effect of PF-4 did not occur when cell stimulation was
performed with anti-CD3 in combination with exogenous IL-2 (10
U/ml) instead of Abs against CD28 (Fig. 3A). Cultures of T
cells with IL-2 alone without anti-CD3 stimulation did not show a
significant proliferation response (data not shown). These data provide
first evidence that PF-4 is directly active on T cells; and moreover,
suggest a critical role for IL-2 in the regulation of this process.
|
B,
neither medium nor immobilized anti-CD3 alone were able to induce
measurable amounts of IL-2 (<78 pg/ml), while as expected,
costimulation of cells with anti-CD3 and anti-CD28 provoked the
release of high amounts of the cytokine (16,000 pg/ml). However, the
presence of PF-4 caused a strong and significant
(p < 0.005) inhibition of IL-2 release by
>84%. The addition of exogenous IL-2 (10 U/ml, equivalent to 4,000
pg/ml) instead of anti-CD28 Abs led to the induction of additional
endogenous IL-2 (a total of 28,000 pg/ml as calculated by subtraction
of the exogenous IL-2 added to the cultures). In contrast to its
inhibitory effect in anti-CD3/anti-CD28-simulated cultures,
PF-4 did not affect IL-2 induction in the latter cultures.
FACS analysis of anti-CD3/anti-CD28-stimulated T cells revealed
that treatment of these cells with PF-4 did neither affect the surface
expression of CD25 (IL-2R -chain) nor that of CD28 itself,
indicating that the inhibitory effect of PF-4 was not mediated through
down-regulation of these receptors (data not shown). Taken together,
our data indicate that PF-4 directly inhibits T cell proliferation and
that the observed antiproliferative effects are most likely due to
inhibition of the autocrine IL-2 release.
PF-4 inhibits the induction of IL-2 mRNA
As PF-4 strongly reduced the release of IL-2 from activated T
cells, the question arose whether this could be due to a reduced
expression of IL-2 mRNA in these cells. Therefore, purified T cells
were stimulated with immobilized anti-CD3 alone or in combination
with anti-CD28 in the presence and absence of PF-4 as described
above. After 24 h of culture, total mRNA was extracted and the
presence of IL-2 mRNA was quantitatively analyzed by real-time
fluorescence RT-PCR with the LightCycler system and expressed as ratio
to the amount of the housekeeping gene GAPDH. The amplified product was
further identified by DNA-sequencing of the product. As expected,
unstimulated cells as well as cells stimulated with immobilized
anti-CD3 alone express only very low amounts of IL-2 mRNA (1- to
2-fold over GAPDH-mRNA, Fig. 4).
Costimulation of cells with anti-CD3 and anti-CD28 led to a
clear up-regulation of IL-2 mRNA expression (6,600-fold over
GAPDH-mRNA). Addition of PF-4 to the stimulated cells resulted in clear
and significant (p < 0.04) reduction of the
expression of IL-2 mRNA (1,760-fold over GAPDH-mRNA) as compared with
CD3/CD28 costimulated cells. Although IL-2 mRNA expression in
anti-CD3/CD28-stimulated cells showed a strong variation between
the individual experiments (from 1,600-fold to 185,000-fold over
GAPDH), PF-4-mediated inhibition appeared to be rather constant
(between 74 and 88.9%, data not shown). These data clearly show that
the observed decrease in IL-2 release correlates with a reduced IL-2
mRNA expression and indicate that PF-4 exerts its regulatory effect
upstream of the transcription event.
|
Our unexpected finding that PF-4 has the capacity to directly
modulate T cell functions as described above raised the question as to
whether these effects were mediated through binding of PF-4 to specific
receptors on these cells. Although the rather high PF-4 concentrations
required for T cell activation suggested that the putative receptors
were of relatively low affinity, we first performed binding analyses to
examine T cells for the presence of potential high-affinity binding
sites. Therefore, cells were incubated with a low concentration of
iodinated PF-4 (5 nM) in the presence of increasing dosages of
unlabeled PF-4. With concentrations up to 50 nM of cold PF-4, binding
of the labeled ligand remained unchanged, indicating the absence of
PF-4 high-affinity binding sites (Fig. 5). However, at dosages of cold PF-4
higher than 50 nM, 125I-labeled PF-4 binding
dramatically increased over background levels, reaching a maximum with
1 µM of cold PF-4. Further enhancement of cold ligand concentration
led to a dose-dependent decrease in the amount of bound
125I-labeled PF-4 down to background levels. This
kind of "bell-shaped" competition kinetics has been previously
described for the interaction of PF-4 with the chondroitin sulfate side
chain of a proteoglycan which represents the PF-4 receptor on human PMN
(9) and was found to be due to the selective interaction
PF-4 receptors with the tetrameric form of the chemokine. This aspect
will be discussed in more detail later on.
|
To circumvent these problems, we chose an alternative approach to characterize the kinetics of PF-4 binding to T cells. To assess the binding kinetics of PF-4 to T cells, we made use of a newly developed mAb (PF63.1) which binds PF-4 in its soluble as well as in its cell-associated form. Different to another anti-PF-4 Ab previously established in our laboratory (mAb PF1; Ref. 22), binding of PF-4 to mAb 63.1 could not be inhibited by soluble chondroitin sulfate or other glycosaminoglycans (data not shown). Furthermore, PF-4 in complex with the latter Ab was still able to bind to GAG-chains associated with the PF-4 receptor on neutrophils (data not shown), all indicating the binding sites for GAGs and Ab on the PF-4 molecule are different. The applicability of the Ab for the analysis of PF-4 binding kinetics to PMN was verified by FACS Analysis, where binding of saturating amounts of the Ab to cells receiving increasing concentrations of all cell-associated PF-4 followed saturation kinetics identical with those observed with the binding of radiolabeled PF-4 (data not shown). In accordance with experiments performed with iodinated PF-4 in parallel, neither binding of PF-4 nor of mAb PF63.1 was observed with PMN pretreated with chondroitinase ABC or under conditions where PF-4-binding was blocked by the addition of heparin (data not shown). These results demonstrate that mAb PF63.1 detects PF-4 bound to its receptor on cell surfaces.
In a first approach, isolated T cells were incubated with increasing
concentrations of PF-4, ranging from 0.001- 8 µM, and cell-associated
PF-4 was subsequently detected with saturating concentrations of the
Ab. As depicted in Fig. 6A, a
first signal exceeding background levels (median fluorescence intensity
(MFI) of 5) was observed at 0.1 µM PF-4 (MFI of 45). Fluorescence
intensity increased dose dependently, reaching a maximum at 4 µM PF-4
(MFI of 912). Cells not preincubated with PF-4 did not bind the Ab. The
observed binding kinetics correlated with the kinetics of PF-4-induced
T cells functions (refer to Fig. 1). However, with regard to affinity
and selectivity, PF-4 binding sites appear to be rather untypical for
chemokine receptors which are activated already at nanomolar
concentrations of their ligands. This impression was strengthened by
our observations that PF-4 does not induce characteristic chemokine
functions in T cells such as changes in the intracellular free calcium
concentration at dosages up to 4 µM (data not shown). Furthermore, we
were unable to detect any chemotactic activity of the chemokine at
concentrations varying between 0.125 and 4 µM (data not shown).
Because we have shown previously that PF-4 binding to neutrophils does
not involve typical seven-transmembrane domain receptors, but is
mediated by chondroitin sulfate proteoglycans (9, 10), we
wondered whether glycosaminoglycans could also be responsible for its
interaction with T cells. To investigate this, PF-4 binding to T cells
was conducted either in the presence of heparin or, in a parallel set
of experiments, with cells digested with chondroitinase ABC before
incubation with PF-4. Although cells treated with PF-4 showed a strong
positive signal upon detection with mAb 63.1 (MFI of 995, Fig. 6B), the presence of heparin completely abrogated PF-4
binding to the cells (MFI of 5). Furthermore, binding of PF-4 was
reduced by >94% with cells pretreated with chondroitinase ABC (MFI of
64), indicating that indeed glycosaminoglycans of the chondroitin
sulfate type are involved in this process. Therefore, our data provide
first evidence that PF-4 binding to cell surface glycosaminoglycans may
not be restricted to neutrophils and endothelial cells, but could
represent a more general mechanism in the interaction of PF-4 with
cellular receptors.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Our study was initiated by the observation that treatment of monocytes
with PF-4 leads to a complete loss of HLA-DR Ag expression on their
surface. By looking for a function of this specific subtype of
macrophages, we hypothesized that PF-4 could potentially act as an
indirect suppressor of T cell activation by reducing the capacity of
monocytes to present Ag to these cells. However, in this report we show
for the first time that not only monocytes are affected by the
chemokine, but that PF-4 directly elicits long-term biological effects
in T cells and can act as a potent suppressor of T cell function in
terms of reducing lymphoproliferation and IL-2 mRNA expression, as well
as inhibiting the release of IL-2 and IFN-. Thus, PF-4 acts in a
manner quite opposite to several other chemokines, which were reported
to promote T cell functions. In a first report, Bacon et al.
(24) showed that a high concentration of RANTES (1 µM)
can directly induce T cell proliferation and IL-2 production in the
absence of additional activating signals. In a more detailed study,
Taub et al. (5) could demonstrate that at physiological
concentrations the CC chemokines MIP-1 and -1, RANTES, and MCP-1
are capable of directly costimulating purified human T cell
proliferation and IL-2 production in the presence of anti-CD3 mAb
and of augmenting lymphoproliferation in an Ag-specific stimulation
model in vitro. Nevertheless, in the same study the authors found PF-4
to lack any capacity for the modulation of these T cell responses.
Although these findings appear to contradict our present observations,
it has to be taken in account that the experimental approaches used
differed from ours by several important features. Taub et al.
(5) used T cell preparations that responded vigorously to
immobilized anti-CD3 alone, indicating a residual costimulatory
potential within their cell preparation which may have overcome the
PF-4-mediated effects. Even more important may be the fact that these
authors used concentrations of the different chemokines up to maximally
1 µg/ml (0.14 µM). However, we observed first biological effects
with PF-4 at 3- to 4-fold higher concentrations. Although in general
it may be sufficient to investigate chemokine-induced cellular
functions within the nanomolar concentration range, conditions for PF-4
are likely to be somewhat different. PF-4 is not secreted from cells
after a prolonged time of stimulation, but is released at high
concentrations from activated platelets within minutes. Although no
data exist in the literature concerning the PF-4 concentrations
existing at sites of acute platelet activation in vivo, normal serum
concentrations of PF-4 (1–2.5 µM; Refs. 6 and
25 and our unpublished observations) would be
sufficient to modulate T cell responses. Interestingly, according to
our findings, PF-4-mediated modulation of T cell functions occurs in
the same concentration range (0.5–4 µM) as that required for the
activation of human neutrophils (22) and monocytes
(15, 26).
The capacity of PF-4 to inhibit proliferation of various cell types has
been reported earlier. However, the reported mechanisms of PF-4 action
appear to be different from those we observed in T cells.
Antiproliferative activity of the chemokine for endothelial cells and
fibroblasts was shown by several authors (12, 13) to
involve competition of PF-4 for coreceptor binding of growth factors,
the formation of heterooligomers with growth factors as well as direct
effects of PF-4 on these cells (11). However, we could
show that PF-4 suppresses significantly the secretion of IL-2 by
purified T cells. This will most likely lead to disturbance of the IL-2
autocrine loop required for the activation of these cells. There exists
several possibilities of how PF-4 could affect T cell activation. One
aspect could be the induction of immunosuppressive cytokines by PF-4,
for example, TGF- or IL-10. These cytokines are known to be secreted
by T cells in response to polyclonal stimulation and could inhibit
functions of these cells by an autocrine mechanism. However, in view of
the reported principles by which these cytokines suppress T cell
functions, their participation in PF-4-mediated processes appears
unlikely. TGF- has been shown to arrest the cell cycle progression
of T cells induced by IL-2 (27). By contrast, we found
that PF-4-mediated suppression of proliferation could be overcome by
low concentrations of exogenous IL-2 (4 ng/ml), indicating that IL-2
secretion rather than the susceptibility of T cells to IL-2 becomes
altered by the chemokine. Furthermore, Weller et al. (28)
reported that TGF- induces apoptosis in activated T cells, a
phenomenon we did not see during culture with PF-4 (our unpublished
observations). Finally, treatment of murine T cells with TGF-
resulted in an enhanced expression of IL-2 mRNA (29),
while PF-4 stimulation mediated the opposite effect. IL-10, a further
potential candidate for indirectly mediating PF-4-induced effects, was
reported to suppress T cell proliferation by down-regulating the
expression of the IL-2R, but not by modulating the IL-2 mRNA expression
(30). According to our own observations, the amount of
surface-expressed IL-2R -chain (CD25) remained unchanged during
stimulation with PF-4. These phenomena provide indirect evidence that
neither IL-10 nor TGF- are involved as indirect mediators of
PF-4-induced effects on T cells.
A further possibility of PF-4 action could be an interference with the
intracellular signaling of CD28. The latter molecule has been shown to
be involved in the induction and stabilization of IL-2 mRNA expression
(31, 32). In contrast, it should be mentioned that PF-4
stimulation did not alter the level of CD28-expression on the surface
of activated T cells. An even more complicated situation is encountered
with the interpretation of the effects of PF-4 in the more
physiological Ag-specific system using autologous monocytes. Comparable
to its effect on isolated T cells, PF-4 provoked a significant decrease
of lymphoproliferation in response to TTX as well as to tuberculin and
inhibited the release of IFN- in these cells. The release of IFN-
in the Ag-specific system depends on the presence of memory Th1 cells
(33). IFN- is not only a typical marker for a Th1-type
of response, but also a strong activator of monocyte functions
(34). Therefore, the observed inhibition of IFN-
release indicates not only a change in the T cell response but may also
have an effect on the subsequent activation of monocytes.
With respect to this, one has to take into account our previous findings that apart from activity on T cells, PF-4 also affects the APCs. The fact that PF-4 provokes the down-modulation of HLA-DR on monocytes (15) may interfere with PF-4-induced effects on T cells in the Ag-specific stimulation model. Thus, the question whether PF-4-mediated suppression of T cell functions in this model is due to modulation of either monocytes or T cells or represents a combinatory effect involving both cell types must be finally left open. However, our data clearly show that the capacity of PF-4 to suppress T cell functions is not limited to isolated cells but takes also place within the physiological context of an antigenic activation.
Finally, it is possible that PF-4 directly induces an inhibitory signal
without liberation of secondary mediators that would act in an auto or
paracrine manner. Current investigations are on the way to clarify this
by the analysis of early signal transduction events induced by the
chemokine. However, irrespective of the mechanisms underlying
PF-4-mediated effects, the direct modulation of T cell functions
requires the presence of specific receptors expressed on the cell
surface. Analysis of potential PF-4 receptors on T cells revealed a
pattern showing remarkable similarities in the binding profile and the
biochemical composition as compared with those previously found on
human neutrophils (9). First, binding sites on both cell
types preferentially interact with the tetrameric form of the
chemokine. Although 125I-labeled PF-4 alone did
not bind at low concentrations (<50 nM), addition of increasing
dosages of cold PF-4 (0.2–1 µM) led to a successive increase
in cell-bound radioactivity, suggesting that mixed oligomers of
iodinated and cold PF-4 had formed and interacted with the receptor.
Displacement of the ligand at further increased dosages of cold PF-4
(5–25 µM) was most likely due to the formation of unlabeled
oligomers that competed for binding. Second, PF-4 binding could be
completely inhibited in the presence of heparin and was sensitive to
digestion with chondroitinase ABC. Binding of PF-4 to T cells was
specific and saturable and occurred within a range of concentrations
where PF-4-mediated effects were observed, i.e., half maximal binding
occurred at 1–2 µM PF-4 and half maximal inhibition of T cell
proliferation was seen at 0.7 µM PF-4. These data indicate that
binding to the receptor on T cells involves interaction to a
chondroitin sulfate proteoglycan; and therefore, shares characteristics
with the PF-4 receptor we previously characterized on the surface of
human neutrophils (9, 10). Interestingly, binding of PF-4
to membrane-associated proteoglycans of the heparan sulfate-type on
bovine aortic endothelial cells (35) as well as to human
umbilical cord vein-derived cells (36) has been reported
earlier, and Luster et al. (11) found that PF-4 and IP10
share the same heparan sulfate proteoglycans for binding to human
endothelial cell lines. However, because we found chondroitin sulfate
glycosaminoglycan chains to be involved in PF-4 binding to T cells as
well as to neutrophils, and preliminary data exist that this may also
apply to binding to monocytes (our unpublished obervations),
this type of glycosaminoglycan rather than heparan sulfates appear to
be responsible for PF-4 binding to cells of the hemopoetic lineage.
However, our results do not exclude that PF-4 apart from binding to
chondroitin sulfate proteoglycans could interact with a second surface
molecule on T cells. Although PF-4 binding was completely blocked in
the presence of heparin, chondroitinase ABC treatment with optimal
concentrations of the enzyme revealed that 5% of the binding sites
are not susceptible to the enzyme. However, the lacking capacity of
PF-4 to induce characteristic chemokine functions in T cells such as
chemotaxis or intracellular calcium transients argue against the
participation of a typical seven-transmembrane domain receptor in this
context. Our present investigations are directed to the identification
of the receptors and to the mechanism that are involved in PF-4
receptor signaling.
In summary, our results provide unexpected new insight into the regulation of T cell functions by a rather atypical chemokine. Speculating on the biological effects of PF-4 in vivo at the site of inflammation one could envisage that PF-4 may play a role in maintaining peripheral tolerance and in suppressing responses of autoreactive T cells in a situation where high amounts of proinflammatory cytokines are present. Future investigations will focus on more detailed analysis of PF-4 effects on T cells and monocytes during coculture, a situation where one could expect synergistic effects between monokines and PF-4 on T cell activation and between T cell cytokines and PF-4 on monocyte functions, respectively. In conclusion, we were able to show previously unknown properties of PF-4 regarding T cell activation. These findings may give new insights into possible mechanisms of immunoregulation at the site of inflammation.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Frank Petersen, Department of Immunology and Cell Biology, Research Center Borstel, Parkallee 22 D-23845, Borstel, Germany. E-mail address: fpetersen{at}fz-borstel.de
3 Abbrevations used in this paper: MCP, monocyte chemotactic protein; IP10, IFN--inducible protein 10; MFI, median fluorescence intensity; MIP, monocyte inflammatory peptide; PF-4, platelet factor 4; PPD, purified protein derivative of tuberculin; TFA, trifluoroacetic acid; TTX, tetanus toxoid; PMN, polymorphonuclear neutrophil.
Received for publication June 22, 2001. Accepted for publication May 9, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
chemoattractant (I-TAC): a novel non-ELR CXC chemokine with potent activity on activated T cells through selective high affinity binding to CXCR3. J. Exp. Med. 187:2009. chemokines costimulate human T lymphocyte activation in vitro. J. Immunol. 156:2095.[Abstract]
-release in vivo. Blood 58:607. renders human neutrophils responsive to platelet factor 4: comparison of PF-4 and IL-8 reveals different activity profiles of the two chemokines. J. Immunol. 156:1954.[Abstract]
receptor I (CD64)-negative monocytes, a minor human monocyte subpopulation with high accessory and antiviral activity. Eur. J. Immunol. 23:3126.[Medline]
on IL-2- and IL-4-dependent T cell-cycle progression. J. Immunol. 144:1767.[Abstract]
2 induces apoptosis of murine T cell clones without down-regulating bcl-2 mRNA expression. Eur. J. Immunol. 24:1293.[Medline]
1 (TGF-1) promotes IL-2 mRNA expression through the up-regulation of NF-
B, AP-1 and NF-AT in EL4 cells. J. Pharmacol. Exp. Ther. 287:1105., but not interleukin-2 or interleukin-4, by parasite-specific helper T cell clones obtained from cattle chronically infected with Babesia bovis or Fasciola hepatica. J. Interferon Cytokine Res. 15:915.[Medline]
This article has been cited by other articles:
|
|
 |
|
  M. Gereke, S. Jung, J. Buer, and D. Bruder Alveolar Type II Epithelial Cells Present Antigen to CD4+ T Cells and Induce Foxp3+ Regulatory T Cells Am. J. Respir. Crit. Care Med., March 1, 2009; 179(5): 344 - 355. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. A. Gleissner, P. von Hundelshausen, and K. Ley Platelet Chemokines in Vascular Disease Arterioscler. Thromb. Vasc. Biol., November 1, 2008; 28(11): 1920 - 1927. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Li Platelet-lymphocyte cross-talk J. Leukoc. Biol., May 1, 2008; 83(5): 1069 - 1078. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Mueller, A. Meiser, E. M. McDonagh, J. M. Fox, S. J. Petit, G. Xanthou, T. J. Williams, and J. E. Pease CXCL4-induced migration of activated T lymphocytes is mediated by the chemokine receptor CXCR3 J. Leukoc. Biol., April 1, 2008; 83(4): 875 - 882. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Woller, E. Brandt, J. Mittelstadt, C. Rybakowski, and F. Petersen Platelet factor 4/CXCL4-stimulated human monocytes induce apoptosis in endothelial cells by the release of oxygen radicals J. Leukoc. Biol., April 1, 2008; 83(4): 936 - 945. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Cervi, T.-T. Yip, N. Bhattacharya, V. N. Podust, J. Peterson, A. Abou-Slaybi, G. N. Naumov, E. Bender, N. Almog, J. E. Italiano Jr, et al. Platelet-associated PF-4 as a biomarker of early tumor growth Blood, February 1, 2008; 111(3): 1201 - 1207. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Kasper, E. Brandt, S. Brandau, and F. Petersen Platelet Factor 4 (CXC Chemokine Ligand 4) Differentially Regulates Respiratory Burst, Survival, and Cytokine Expression of Human Monocytes by Using Distinct Signaling Pathways J. Immunol., August 15, 2007; 179(4): 2584 - 2591. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Lasagni, R. Grepin, B. Mazzinghi, E. Lazzeri, C. Meini, C. Sagrinati, F. Liotta, F. Frosali, E. Ronconi, N. Alain-Courtois, et al. PF-4/CXCL4 and CXCL4L1 exhibit distinct subcellular localization and a differentially regulated mechanism of secretion Blood, May 15, 2007; 109(10): 4127 - 4134. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Piqueras, J. Connolly, H. Freitas, A. K. Palucka, and J. Banchereau Upon viral exposure, myeloid and plasmacytoid dendritic cells produce 3 waves of distinct chemokines to recruit immune effectors Blood, April 1, 2006; 107(7): 2613 - 2618. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Kasper, E. Brandt, M. Ernst, and F. Petersen Neutrophil adhesion to endothelial cells induced by platelet factor 4 requires sequential activation of Ras, Syk, and JNK MAP kinases Blood, March 1, 2006; 107(5): 1768 - 1775. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Vermeulen, Q. Lan, L. Zhang, L. Gunn, D. McCarthy, R. L. Woodbury, M. McGuire, V. N. Podust, G. Li, N. Chatterjee, et al. Decreased levels of CXC-chemokines in serum of benzene-exposed workers identified by array-based proteomics PNAS, November 22, 2005; 102(47): 17041 - 17046. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Schaffner, P. Rhyn, G. Schoedon, and D. J. Schaer Regulated expression of platelet factor 4 in human monocytes--role of PARs as a quantitatively important monocyte activation pathway J. Leukoc. Biol., July 1, 2005; 78(1): 202 - 209. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Y. Liu, M. Battaglia, S. H. Lee, Q.-H. Sun, R. H. Aster, and G. P. Visentin Platelet Factor 4 Differentially Modulates CD4+CD25+ (Regulatory) versus CD4+CD25- (Nonregulatory) T Cells J. Immunol., March 1, 2005; 174(5): 2680 - 2686. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Pervushina, B. Scheuerer, N. Reiling, L. Behnke, Jens.-M. Schroder, B. Kasper, E. Brandt, S. Bulfone-Paus, and F. Petersen Platelet Factor 4/CXCL4 Induces Phagocytosis and the Generation of Reactive Oxygen Metabolites in Mononuclear Phagocytes Independently of Gi Protein Activation or Intracellular Calcium Transients J. Immunol., August 1, 2004; 173(3): 2060 - 2067. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-Q. Xia and K.-J. Kao Effect of CXC chemokine platelet factor 4 on differentiation and function of monocyte-derived dendritic cells Int. Immunol., August 1, 2003; 15(8): 1007 - 1015. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Slungaard, J. A. Fernandez, J. H. Griffin, N. S. Key, J. R. Long, D. J. Piegors, and S. R. Lentz Platelet factor 4 enhances generation of activated protein C in vitro and in vivo Blood, July 1, 2003; 102(1): 146 - 151. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. S. V. Campanella, E. M. J. Lee, J. Sun, and A. D. Luster CXCR3 and Heparin Binding Sites of the Chemokine IP-10 (CXCL10) J. Biol. Chem., May 2, 2003; 278(19): 17066 - 17074. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) or presence (
) of a constant concentration of PF-4 (4 µM).
A, Proliferation of T cells was determined after 96
h as described in the legend to Fig. 1
