| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Emory Vaccine Research Center and
Department of Microbiology and Immunology, Emory University, Atlanta, GA 30329
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CD94 covalently pairs with members of the NKG2 family (A, B, C, or E) via a disulfide bond to form CD94/NKG2 heterodimers (6, 7, 8, 9, 10). Immunoreceptor tyrosine-based inhibitory motifs possessed by NKG2A and NKG2B mediate signals that inhibit NK killing (11). In contrast, positively charged intracellular residues of NKG2C and NKG2E receptors bind to DAP-12 and transduce signals that induce NK killing when bound to its receptor ligand (11, 12, 13).
The ligand for CD94/NKG2 is Qa-1b (8, 10). Qa-1b is a nonpolymorphic
(14), nonclassical MHC class I molecule encoded by the
t23 gene of the murine H-2 complex (15).
All tissues express Qa-1b, though at much lower
levels on the cell surface than classical class I molecules
(16). Similar to classical MHC class I molecules,
Qa-1b binds peptides and
2-microglobulin (16, 17). The
preferred peptide ligand for Qa-1b is the peptide
Qa-1b determinant modifier (Qdm), which is
derived from the leader sequence of some, but not all, classical class
I MHC alleles (17, 18). Despite its preference for binding
Qdm, Qa-1b can also bind to Salmonella
and insulin peptides (19, 20).
Multiple laboratories have demonstrated that CD94/NKG2 expression on
human CTL clones and lines inhibits cytolysis and cytokine secretion.
Mingari et al. (21) first showed that anti-CD94
blocking Abs increased CTL killing and TNF-
secretion of a
CD94-expressing T cell clone, BC2.4. Similarly, Noppen et al.
(22) showed that killing by CD94high
but not CD94low subclones of the CTL clone TRP-2
was enhanced by an anti-CD94 mAb. Concurrently, Le Drean et al.
(23) showed that engagement of CD94/NKG2A inhibits TNF-
release and CTL activity using melanoma-specific human T cell clones.
Finally, recent studies by Speiser et al. (24) yielded
similar results to those above using tumor-specific CTL ex
vivo.
Current studies in mice largely corroborate human research. Lohwasser et al. (5) found that Qa-1b expressed on target cells partially inhibits target cell killing by allospecific CTL derived from a MLR. More recently, Moser et al. (25) showed that polyoma virus (PyV)-specific CTL that express CD94/NKG2 do not kill peptide-pulsed targets cells. Treating the target cells with anti-Qa-1b Abs in combination with goat anti-mouse secondary Abs in the presence of brefeldin A reversed this inhibition at high E:T ratios.
Our study of CD94/NKG2 used the LCMV system. The murine LCMV infection
model yields immune responses especially suited for the study of
Ag-specific CD8+ T cells. Following acute LCMV
infection, Ag-specific CD8+ T cells expand
10,000-fold, and the virus is cleared from most tissues within 8
days (26). CD8+ T cells respond
against four major epitopes in C57BL/6 mice, glycoprotein-1 33–41
(gp33), glycoprotein-2 276–286 (gp276), nucleoprotein 396–404
(NP396), and glycoprotein 34–42 (gp34) (26, 27, 28). In
BALB/c mice, most activated CD8+ T cells respond
to the Ld-restricted peptide epitope
nucleoprotein 118–126 (NP118) (26). With these models, we
sought to determine the dynamics of CD94/NKG2 expression on
CD8+ T cells following viral infection and to
examine the effects of expression of this receptor on
CD8+ T cell function. In contrast to previous
studies (5, 21, 22, 23, 24, 25), we show that CD94/NKG2 expression is
not sufficient to inhibit CTL killing or cytokine secretion in the LCMV
model.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Six- to 8-wk-old C57BL/6, BALB/cJ, and C3H/HeJ mice were purchased from The Jackson Laboratory (Bar Harbor, ME). Animal care was provided according to the guidelines of the Institutional Animal Care and Use Committee and Emory University (Atlanta, GA).
Cell lines
BALB clone 7 and Ag104 cells were grown in DMEM containing 10% FCS and penicillin/streptomycin antibiotics. Cells were grown at 37°C in 5% CO2.
Viral and bacterial infections
Naive mice were infected i.p. with 2 x 105 PFU LCMV Armstrong strain. Following protocols that are standard in the field, LCMV-immune mice were subsequently challenged with 2 x 106 PFU LCMV clone 13 i.v. (26, 29). To infect mice with Listeria monocytogenes (strain 45231; American Type Culture Collection, Manassas, VA), 2 x 103 PFU were injected i.v. (30). For influenza virus infections, BALB/cJ mice were anesthetized and subsequently infected by intranasal inoculation with 50 µl of A/PR/8/34 (H1N1) virus diluted in PBS/2% BSA (0.005–0.01 LD50; 0.00025 hemagglutinating units) (31). Polyoma infections were performed by injecting 2 x 106 PFU of virus s.c. into the hind footpads of C3H/HeJ mice (25). To generate splenocytes, spleens from infected mice were ground on a metal screen and treated with ammonium chloride to lyse RBCs. Lung-infiltrating lymphocytes were isolated by collagenase D treatment of total lungs (32) followed by ammonium chloride treatment.
Flow cytometry and reagents
MHC tetramers were made as previously described
(33). For Qa-1b tetramer stains,
single-cell splenocyte suspensions were stained with PerCP-labeled
anti-CD8 (clone 57-6.7; BD PharMingen, San Diego, CA),
allophycocyanin-labeled MHC class I tetramers, FITC-labeled
anti-CD4 (negative gate; Coulter, Fullerton, CA), and PE-labeled
Qa-1b tetramers in 1x PBS containing 1% BSA
fraction V (Sigma-Aldrich, St. Louis, MO). Excess free
D-biotin (0.5 µM; Sigma-Aldrich) and unlabeled CT-CD8
(1/1600 dilution; Caltag Laboratories, Burlingame, CA) were added to
staining solutions to eliminate binding of free biotinylated MHC
monomers to free streptavidin and to inhibit binding of
Qa-1b to CD8, respectively (data not shown). All
other cytometry reagents were purchased from BD PharMingen. Flow
cytometry data were acquired on a FACSCalibur cytometer (BD
Biosciences, Mountain View, CA) and analyzed using FlowJo software
(Treestar, San Carlos, CA). Sorted T cells were obtained using a
FACSVantage Cell Sorter (BD Biosciences) or a MoFlo (Cytomation, Fort
Collins, CO).
Peptides
Peptides were synthesized by B. Evavold (Department of Microbiology and Immunology Peptide Core Facility, Emory University) using F-moc chemistry using a Symphony/Multiplex Peptide Synthesizer and purified by HPLC (Rainin Instrument, Woburn, MA).
Relative quantitative RT-PCR
CD8+NP118+ T cells were sorted by flow cytometry. Total RNA was obtained using an RNAeasy kit (Qiagen, Valencia, CA). Total RNA was treated with DNase I (Roche, Basel, Switzerland) and reverse transcribed with Superscript II (Invitrogen, Carlsbad, CA) and a mixture of random hexamers and oligo(dT) primers. The resulting cDNA was amplified in an iCycler PCR machine (Bio-Rad, Hercules, CA) using the following NKG2 isoform-specific primer pairs: NKG2A/forward (FWD), GTTGTAATTACTACAGTTGCCACACCATATAACG; NKG2A/reverse (REV), CTGTGCTGAAGATAGAGTGTAGTTTATATCTCT; NKG2B/FWD, CAGAGAAACCTCATTGCTGGTACCCTGGGCCT; NKG2B/REV, CTGAAGATAGAGTGTAGTTTATATATGG; NKG2C/FWD, AATCTTGGAATGACAGTTTGGGGTCCTGCC; NKG2C/REV, CGGAAAATCCTGCTCCTGTTCACTATCTATGTG; NKG2E/FWD, TATTCTCACAATTGTTATTACATTGGCATGGAA; NKG2E/REV, GTCCATGAGACCAGTGAAAGGGATTGCAGAAAG; GAPDH/FWD, GGATGCAGGGATGATGTTC; and GAPDH/REV, TGCACCACCAACTGCTTAG. Each 50-µl quantitative PCR contained 50 nM forward and reverse primers, 0.1% Tween (Sigma-Aldrich), 5% DMSO (Sigma-Aldrich), 5 µg BSA (New England Biolabs, Beverly, MA), 2.25 mM MgCl2, 0.1% SYBR green (BioWhittaker, Walkersville, MD), and 2 U of Taq polymerase (Promega, Madison, WI) (34). The amount of starting cDNA was determined using a standard curve derived from cloned plasmids. Results are expressed as a percentage of GAPDH amplification.
Intracellular IFN-
staining assay
Intracellular IFN- staining was performed as previously
described (26). For Qdm cross-titration experiments,
1 x 106 splenocytes from day-30
LCMV-infected BALB/cJ mice were incubated in flat-bottom 96-well plates
with different concentrations of the antigenic peptide LCMV NP118
(RPQASGVYM) and either the Qdm (AMAPRTLLL) or the Qdm variant peptide,
Qdm·R5K (AMAPKTLLL), as indicated. Cultures were then incubated for
1 h at 37°C without brefeldin A, followed by a 5-h incubation in
the presence of brefeldin A. After transfer to round-bottom 96-well
plates, we stained for cell surface and intracellular Ags using an
intracellular staining kit (BD PharMingen). Chronic LCMV and polyoma
experiments were performed similarly using gp33 (KAVYNFATM), NP396
(FQPQNGQFI), or MT389 (RRLGRTLLL) peptides in place of NP118.
CTL assay
CTL assays and blocking of Qa-1b on target cells were performed as previously described (25, 35). Briefly, target cells were loaded with chromium and incubated with antigenic peptide. For Qa-1b blocking experiments, target cells were incubated with 20 µg/ml anti-Qa-1b (BD PharMingen), washed, and then incubated with goat anti-mouse IgG (The Jackson Laboratory) in the presence of brefeldin A. Washed targets were incubated with dilutions of effector cells for 5 h at 37°C. CTL supernatants were spotted on 96-well ytrium silicate scintillator plates (Packard Instrument, Meriden, CT), dried overnight, and assayed using a 96-well plate gamma counter (Wallac, Turku, Finland).
Virus plaque assay
Virus plaque assays were performed as described (29).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B), while the CD94-specific
mAb 18d3 did not (Fig. 1A). This demonstrates that the
Qa-1b/Qdm tetramer binds specifically to
CD94/NKG2 receptors expressed on CD8+ T cells.
Identical results were observed in experiments using NK cells (data not
shown).
|
, A and B). The
frequency of Ag-specific CD8+ T cells that
express CD94/NKG2 increases until the peak of the
CD8+ T cell response at day 8 postinfection, at
which point nearly all of the specific cells express CD94/NKG2.
CD94/NKG2 expression on LCMV-specific CD8+ T
cells in BALB/c and C57BL/6 mice is then uniformly maintained for at
least 1 year. At all time points, CD94/NKG2 expression was restricted
to CD44high cells (Fig. 2C),
indicating that only activated T cells express this receptor following
LCMV infection. CD4+ T cells did not express
CD94/NKG2 at any time point following infection (data not shown). The
demonstration that LCMV-specific CD8+ T cells
express a molecule associated with inhibition of lytic function (at
least in NK cells) begs the question of whether CD94/NKG2 receptors
play a similar functional role at any stage of the in vivo T cell
response.
|
). The results of this experiment show
that LCMV-specific CD8+ T cells transcribe NKG2A,
NKG2B, and some NKG2C transcripts but few, if any, NKG2E transcripts.
This experiment demonstrates that LCMV-specific
CD8+ T cells express more CD94/NKG2 inhibitory
receptors than activating receptors.
|
). We did observe a clear but
low-frequency population of
Ly49G2+CD8+ T cells, but
only a small fraction (<1%) of the cells that stained with any of the
three Db tetramers also stained for Ly49G2.
Previous studies of Ly49G2 expression on LCMV-specific
CD8+ T cells did not report the fraction of
LCMV-specific cells that were also Ly49G2+
(36). Likewise, memory CD8+ T cells
did not appreciably express Ly49 receptors. In summary, the primary
NK-IR expressed on LCMV-specific CD8+ T cells
appears to be CD94/NKG2.
|
). The dynamics of the U5A2-13 Ag are similar to
CD94/NKG2, demonstrating that activated CD8+ T
cells express multiple Ags normally associated with the NK lineage.
However, due to a dearth of information regarding the U5A2-13 Ag
(37, 38), the significance of this result remains
unknown.
To ascertain whether CD94/NKG2 expression is a common characteristic of
Ag-specific CD8+ T cells, BALB/cJ mice were
infected with L. monocytogenes and influenza virus. At
multiple time points post-L. monocytogenes infection,
Kd/LLO91 tetramer-positive
CD8+ T cells stained positive for the
Qa-1b/Qdm tetramer (Fig. 5A). Similarly, at day 9
post-influenza infection, Kd/HA533
tetramer-positive CD8+ T cells expressed
CD94/NKG2 as detected by Qa-1b/Qdm tetramer
staining (Fig. 5B). These results are analogous to previous
experiments using LCMV virus (Fig. 2, A and B).
Moreover, experiments using the vesicular stomatitis virus/C57BL/6
(data not shown) and PyV/C3H/HeJ viral infection models showed that
CD8+ T cells specific for these viruses also
express CD94/NKG2. These data imply that CD94/NKG2 expression
may be a common characteristic of Ag-specific T cells following acute
infection with different viral or bacterial pathogens.
|
A). During this time, resting
memory LCMV-specific CD8+ T cells are reactivated
and regain the ability to lyse NP118 peptide-coated target cells (Fig. 6B), which express Qa-1b by both Ab
staining and bioassay (data not shown) (20). In contrast
to previous studies in the polyoma model system (25),
these results clearly show that CD94/NKG2 levels are not altered by
LCMV rechallenge, suggesting that down-regulation of CD94/NKG2
expression is not necessary to achieve re-expansion of memory
populations and the development of effector functions.
|
by Ag-stimulated cells. At day 30
post-LCMV infection, we incubated BALB/cJ splenocytes with the NP118
peptide and with cross-titrations of either Qdm or the Qdm variant
peptide, Qdm·R5K. The Qdm and Qdm·R5K peptides bind to
Qa-1b with similar affinity (9), but
the Qa-1b/Qdm·R5K complex is not recognized by
CD94/NKG2 (Fig. 7A). Because
Qdm and Qdm R5K peptides quickly dissociate from
Qa-1b complexes (P. Jensen and J. Kraft,
personal communication), we used excess concentrations of each Qdm
peptide to ensure binding to Qa-1b throughout the
assay. Splenocytes were incubated for 6 h in the presence of
brefeldin A and subsequently stained for intracellular IFN-. At all
concentrations of NP118 peptide, splenocytes stimulated with Qdm or Qdm
R5K-pulsed target cells yielded identical frequencies of responders
with equal mean fluorescence intensities (Fig. 7B). Similar
results were obtained at day 8 post-LCMV infection (data not shown).
Thus, CD94/NKG2 expression on LCMV-specific CD8+
T cells does not inhibit IFN- production in the LCMV system, even
when the LCMV-specific cells are stimulated with suboptimal
concentrations of their peptide Ag.
|
at day 8 post-PyV infection. To
explore this apparent paradox more closely, we stimulated splenocytes
from day-8 PyV-infected C3H/HeJ mice with 10 µM MT389 peptide, in the
presence of excess Qdm peptide to stabilize Qa-1b
in the presence of brefeldin A, and then stained cells for
intracellular IFN- and surface NKG2A/C/E. As expected, all
MT389-specific CD8+ T produced IFN- (Fig. 8A) when compared with
unstimulated splenocytes stained with Dk/MT389
tetramers (Fig. 8B). We performed this experiment with the
same concentration of MT389 peptide that was previously used to
demonstrate that CD94/NKG2 inhibits killing by MT389-specific
CD8+ T cells (25). Thus, we were not
using a supraoptimal concentration of MT389 that would overwhelm
CD94/NKG2 inhibition. This result shows that CD94/NKG2 does not inhibit
IFN- production by PyV-specific CD8+ T cells.
Together with studies demonstrating that CD94/NKG2 inhibits PyV
CD8+ T cell killing (25), this
result suggests that CD94/NKG2 differentially regulates
CD8+ T cell effector functions in the acute
polyoma model. We could not perform a peptide stimulation experiment as
described in Fig. 7, because high concentrations of Qdm (AMAPRTLLL)
or Qdm·R5K (AMAPKTLLL) peptide can bind to Dk
and thereby compete with MT389 (RRLGRTLLL) due to peptide sequence
homology (A. Lukacher and A. Byers, personal communication),
yielding uninterpretable results.
|
). None
of the T cell populations lysed uninfected target cells. These results
were repeated in five separate experiments. Experiments using
peptide-coated targets in lieu of virus-infected targets and
experiments using targets cultured overnight in the presence or absence
of IFN- yielded identical results (data not shown). These data show
that CD94/NKG2 expression by CD8+ T cells is not
sufficient to inhibit killing of virus-infected targets following acute
LCMV infection.
|
). This result is consistent with
earlier experiments in which CD94/NKG2 expression did not correlate
with differences in CTL killing (Fig. 9), and suggests that CD94/NKG2
expression by CD8+ T cells is not sufficient to
inhibit CTL killing in the LCMV model. Similar to previous studies
(25), splenocytes from PyV-infected mice displayed an
increased ability to kill Qa-1b-blocked target
cells as compared with control target cells treated with
anti-Kk mAbs (Fig. 10).
|
A). As shown
previously (44), these cells lack the ability to produce
IFN- following peptide stimulation (Fig. 11B) when
compared with immune controls. This result suggests that CD94/NKG2 is
not responsible for the phenotype of anergic LCMV-specific
CD8+ T cells and implies that chronic viral
infection alone is not sufficient for CD94/NKG2 expression.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Our surprising data raise at least two conundrums. What advantage is gained by expressing inhibitory receptors on Ag-specific CD8+ T cells? Why do CD94/NKG2 inhibitory receptors not appear to affect function in the LCMV model, in contrast to the observations in the polyoma and other models?
Although we have observed that CD94/NKG2 expressed on LCMV-specific
CD8+ T cells does not inhibit their lytic and
IFN--producing functions, we must still consider what potential
advantage is gained by expressing inhibitory receptors on Ag-specific T
cells, perhaps even using assumptions that CD94/NKG2 inhibits some
function of these cells that we have not detected.
CD8+ T cells that are chronically exposed to Ag
can be functionally deficient (44, 48), and it has been
proposed that this is a mechanism for avoiding immunopathology.
Although the mechanisms by which this impotent phenotype is induced
often aren’t known, expression of inhibitory receptors is one of a
number of possible causes. The attraction of this model is enhanced by
the observation that, until recently, most reports of NK-IR on
CD8+ T cells were on cells that were responding
to chronic stimuli, such as melanoma Ags or HIV (21, 22, 24, 41). However, our data, together with the recent data from the
polyoma model (25), show that CD94/NKG2 inhibitory
receptors can be up-regulated on murine CD8+ T
cells during an acute primary immune response, demonstrating that
chronic Ag exposure is not required for killer inhibitory receptor
(KIR) expression. Furthermore, using the same chronic LCMV infection
model in which Zajac et al. (44) found impotent
Ag-specific CD8+ T cells, we found, to our
surprise, that the Db/gp33-specific
CD8+ cells were present and lacked function, but
they also lacked CD94/NKG2 expression. Of course, it remains possible
that other, unidentified, inhibitory receptors are responsible for the
unusual phenotype of the LCMV-specific cells seen in this model, but
that is well beyond the scope of our present work.
In the context of an acute infection, it is difficult to understand what advantage might be gained by inhibiting the function of T cells that recognize a foreign Ag. Perhaps one solution to this problem follows from the observations that NK-IR tend to inhibit CTL function only at low doses of activating Ag (21, 22, 23), and even then KIR-mediated inhibition of lytic function is often only partial (21, 22, 23, 24). From these observations, a number of investigators have concluded that the function of KIR on CTL is to raise their threshold of TCR-mediated activation. Although we were unable to detect CD94/NKG2-mediated inhibition of LCMV-specific CD8+ T cell function, even at suboptimal LCMV-peptide doses, we cannot rule out the possibility that CD94/NKG2 acts to inhibit virus-specific T cells from killing cells that present low-affinity, otherwise cross-reactive self-peptides on their surfaces, thereby reducing potential immunopathology. In addition, although Ag-specific T cells predominantly express inhibitory receptor transcripts, we cannot discount a possible role of the CD94/NKG2C activating receptors. It is possible, although unlikely, that the net result of CD94/NKG2C activating signals and CD94/NKG2 A and B inhibitory signals is no signal to the cell. The development of assays that would allow determination of the expression of individual NKG2 isoforms at the single cell level would shed light on this problem.
Because we were already using the polyoma model as a positive control
for our attempts to increase LCMV-specific killing by blocking the
CD94/NKG2 ligand on target cells with
anti-Qa-1b plus a cross-linking secondary Ab
(25), we also looked at the effect of CD94/NKG2 expression
on IFN- production by peptide-stimulated, polyoma-specific
CD8+ T cells. Previously, we had shown that at
days 7, 9, and 12 postpolyoma infection of C3H/HeN mice, all
Dk/MT389
tetramer+CD8+ T cells
produce IFN- following peptide stimulation (39).
Together with the more recent data from Moser et al. (39),
which demonstrated that between 50 and 80% of
Dk/MT389-specific CD8+ T
cells express CD94/NKG2 at days 7–13 postinfection, we expected that
CD94/NKG2 would not inhibit IFN- production by these cells, which is
what we indeed found. In contrast to our previous IFN- production
experiments, we performed these experiments in the presence of a vast
excess of the Qdm peptide, counteracting the potential loss of
the CD94/NKG2 ligand that might occur by dissociation of Qdm from
Qa-1b. Our IFN- production experiments in the
polyoma model were performed at the same concentration of MT389 peptide
that was previously used to demonstrate that CD94/NKG2 inhibits killing
by MT389-specific CD8+ T cells (25)
and that we repeated here (Fig. 10), demonstrating that we were not
using a superoptimal concentration of MT389 in our experiments that
would overcome CD94/NKG2 inhibition. In the polyoma model, we were
unable to perform the same MT389/Qdm cross-titration experiment that we
performed in the LCMV model, because at low concentrations of MT389 we
cannot rule out that the Qdm peptide competes with MT389 binding to
Dk. The discordant results that we obtained in
the polyoma model (CD94/NKG2 mediated inhibition of lytic function by
not cytokine production) are puzzling. Slifka et al. (49)
have shown that direct ex vivo CTL retain their lytic function in the
presence of cycloheximide, indicating that lytic function does not
require de novo protein synthesis but that cytokine production by
Ag-stimulated CD8+ T cells was inhibited by
treatment with actinomycin D, indicating that cytokine production does
require de novo mRNA synthesis. It will be interesting to determine how
CD94/NKG2 can transduce signals that inhibit an effector function
(lysis of target cells) that does not require de novo RNA and protein
synthesis, while leaving intact an effector function (cytokine
production) that does.
How, then, do we account for the differences between the ability of
CD94/NKG2 to inhibit lytic function in the polyoma and LCMV systems? We
have no satisfying resolution to this problem, but we can offer some
speculations. The possibilities start with differences in virology, and
different viruses (or different epitopes in the context of different
viruses) may induce specific CD8+ T cells that
have different phenotypes. This may also account for our observation
that, during a secondary immune response to LCMV, CD94/NKG2
down-regulation on Ag-specific cells is not observed during viral
clearance (Fig. 6B, inset), in contrast to previous
observations in which CD94/NKG2 down-regulation is observed on
PyV-specific CD8+ T cells that are recalled with
a recombinant vaccinia virus (25). It is also possible
that the differences lie in the strains of mice that are used in the
two systems. For example, CD94/NKG2-mediated inhibition of
CD8+ CTL may be particularly effective in C3H/HeJ
(or N) mice, as both recent reports of CTL inhibition—the polyoma
system used by Moser et al. (25) and the allospecific CTL
used by Lohwasser et al. (5)—used
Dk-restricted T cells. The obvious experiments to
perform include testing the ability of CD94/NKG2 to inhibit lytic
function of 1) polyoma-specific CD8+ T cells in
B6 and BALB/c mice, and 2) LCMV-specific CD8+ T
cells in C3H/HeN or CBA/J mice. However, in both cases the relevant CTL
epitopes have not been mapped, making it difficult to characterize the
expression of CD94/NKG2 on virus-specific CD8+ T
cells using MHC tetramer methods, as in Fig. 1. We are currently
working with the A. Lukacher laboratory to map polyoma CTL epitopes in
B6 mice, and we will soon begin to map LCMV epitopes in
H-2k mice (50, 51, 52). In addition,
experiments in MHC congenic mice might shed light on whether the
different susceptibility to NK-IR-mediated inhibition of function lies
inside or outside the MHC.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Current address: Department of Microbiology, University of Alabama, Birmingham, AL 35294.
3 Address correspondence and reprint requests to Dr. John D. Altman, Emory Vaccine Center at Yerkes, Emory University, 954 Gatewood Road, Atlanta, GA 30329. E-mail address: altman{at}microbio.emory.edu
4 Abbreviations used in this paper: NK-IR, NK inhibitory receptor; LCMV, lymphocytic choriomeningitis virus; KIR, killer inhibitory receptor; PyV, polyoma virus; Qdm, Qa-1b determinant modifier; FWD, forward; REV, reverse.
5 McMahan, et al. Submitted for publication.
6 C. McMahon, A. Zajac, A. Jamieson, L. Corral, G. Hammer, R. Ahmed, and D. Raulet. Viral and bacterial infections induce expression of multiple NK cell receptors in responding CD8+ T cells. Submitted for publication.
Received for publication March 21, 2002. Accepted for publication May 3, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
/ T cells by the class Ib gene product, Qa-1b. J. Exp. Med. 188:961.
T cells, and antigen-specific CTL. J. Immunol. 160:5239.This article has been cited by other articles:
|
|
 |
|
  J. Zhou, M. Matsuoka, H. Cantor, R. Homer, and R. I. Enelow Cutting Edge: Engagement of NKG2A on CD8+ Effector T Cells Limits Immunopathology in Influenza Pneumonia J. Immunol., January 1, 2008; 180(1): 25 - 29. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. G. Dauner, I. R. Williams, and J. Jacob Differential Microenvironment Localization of Effector and Memory CD8 T Cells J. Immunol., January 1, 2008; 180(1): 291 - 299. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. C. Kemball, E. Szomolanyi-Tsuda, and A. E. Lukacher Allogeneic Differences in the Dependence on CD4+ T-Cell Help for Virus-Specific CD8+ T-Cell Differentiation J. Virol., December 15, 2007; 81(24): 13743 - 13753. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Li, S.-i. Kashiwamura, H. Ueda, A. Sekiyama, and H. Okamura Protection of CD8+ T cells from activation-induced cell death by IL-18 J. Leukoc. Biol., July 1, 2007; 82(1): 142 - 151. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. J. Cavanaugh, D. H. Raulet, and A. E. Campbell Upregulation of CD94/NKG2A receptors and Qa-1b ligand during murine cytomegalovirus infection of salivary glands J. Gen. Virol., May 1, 2007; 88(5): 1440 - 1445. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. J. Robertson, J.-G. Chai, M. Millrain, D. Scott, F. Hashim, E. Manktelow, F. Lemonnier, E. Simpson, and J. Dyson Natural Regulation of Immunity to Minor Histocompatibility Antigens J. Immunol., March 15, 2007; 178(6): 3558 - 3565. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Byers, N. P. Andrews, and A. E. Lukacher CD94/NKG2A Expression Is Associated with Proliferative Potential of CD8 T Cells during Persistent Polyoma Virus Infection J. Immunol., May 15, 2006; 176(10): 6121 - 6129. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Suvas, A. K. Azkur, and B. T. Rouse Qa-1b and CD94-NKG2a Interaction Regulate Cytolytic Activity of Herpes Simplex Virus-Specific Memory CD8+ T Cells in the Latently Infected Trigeminal Ganglia J. Immunol., February 1, 2006; 176(3): 1703 - 1711. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. K. Ahn, H. Chung, D.-s. Lee, Y. S. Yu, and H. G. Yu CD8brightCD56+ T Cells Are Cytotoxic Effectors in Patients with Active Behcet's Uveitis J. Immunol., November 1, 2005; 175(9): 6133 - 6142. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Han, M. Zhang, N. Li, T. Chen, Y. Zhang, T. Wan, and X. Cao KLRL1, a novel killer cell lectinlike receptor, inhibits natural killer cell cytotoxicity Blood, November 1, 2004; 104(9): 2858 - 2866. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Wojtasiak, C. M. Jones, L. C. Sullivan, A. C. Winterhalter, F. R. Carbone, and A. G. Brooks Persistent expression of CD94/NKG2 receptors by virus-specific CD8 T cells is initiated by TCR-mediated signals Int. Immunol., September 1, 2004; 16(9): 1333 - 1341. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Gold, M. W. Munks, M. Wagner, C. W. McMahon, A. Kelly, D. G. Kavanagh, M. K. Slifka, U. H. Koszinowski, D. H. Raulet, and A. B. Hill Murine Cytomegalovirus Interference with Antigen Presentation Has Little Effect on the Size or the Effector Memory Phenotype of the CD8 T Cell Response J. Immunol., June 1, 2004; 172(11): 6944 - 6953. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. J. Roberts, Y. Lin, P. M. Spence, L. Van Kaer, and R. R. Brutkiewicz CD1d1-Dependent Control of the Magnitude of an Acute Antiviral Immune Response J. Immunol., March 15, 2004; 172(6): 3454 - 3461. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. D. Lieto, F. Borrego, C.-h. You, and J. E. Coligan Human CD94 Gene Expression: Dual Promoters Differing in Responsiveness to IL-2 or IL-15 J. Immunol., November 15, 2003; 171(10): 5277 - 5286. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. T. Wilhelm, J.-R. Landry, F. Takei, and D. L. Mager Transcriptional Control of Murine CD94 Gene: Differential Usage of Dual Promoters by Lymphoid Cell Types J. Immunol., October 15, 2003; 171(8): 4219 - 4226. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. H. Maris, J. D. Miller, J. D. Altman, and J. Jacob A Transgenic Mouse Model Genetically Tags All Activated CD8 T Cells J. Immunol., September 1, 2003; 171(5): 2393 - 2401. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. H. Robbins, S. C. Terrizzi, B. C. Sydora, T. Mikayama, and L. Brossay Differential Regulation of Killer Cell Lectin-Like Receptor G1 Expression on T Cells J. Immunol., June 15, 2003; 170(12): 5876 - 5885. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Davies, S. Kalb, B. Liang, C. J. Aldrich, F. A. Lemonnier, H. Jiang, R. Cotter, and M. J. Soloski A Peptide from Heat Shock Protein 60 Is the Dominant Peptide Bound To Qa-1 in the Absence of the MHC Class Ia Leader Sequence Peptide Qdm J. Immunol., May 15, 2003; 170(10): 5027 - 5033. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Gu, A. Laouar, J. Wan, M. Daheshia, J. Lieberman, W. M. Yokoyama, H. R. Katz, and N. Manjunath The gp49B1 Inhibitory Receptor Regulates the IFN-{gamma} Responses of T Cells and NK Cells J. Immunol., April 15, 2003; 170(8): 4095 - 4101. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Gunturi, R. E. Berg, and J. Forman Preferential Survival of CD8 T and NK Cells Expressing High Levels of CD94 J. Immunol., February 15, 2003; 170(4): 1737 - 1745. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
); Qa-1b/Qdmhigh, infected targets
(
); unsorted splenocytes, uninfected targets (
);
Qa-1b/Qdmlow, uninfected targets (
);
Qa-1b/Qdmhigh, uninfected targets (
). Error
bars represent the SEM. This experiment is representative of five
separate experiments.
