|
|
||||||||
Guy-Bernier Research Center, Maisonneuve-Rosemont Hospital, Montreal, Quebec, Canada
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
14-J
18 rearrangement are positively selected on
double-positive (DP)3
thymocytes rather than thymus epithelial cells (7).
Furthermore, studies using relatively constrained models have shown
that fibroblasts and hemopoietic cells can support positive selection
of mainstream thymocytes when they were located in the thymus
environment (8, 9, 10, 11). Importantly, positive selection of T
lymphocytes by hemopoietic cells is largely thymus dependent because
practically no T lymphocytes developed in athymic hosts (10, 11). In contrast with positive selection, thymocyte negative selection is initiated by strong TCR signals triggered by MHC-restricted interactions mainly with dendritic cells and to a lesser extent with thymic medullary epithelial cells (12, 13). Although cortical epithelial cells can induce deletion of some thymocytes (14, 15), this negative selection is probably limited to a subset of DP thymocytes that bind with high avidity to the most abundant self peptides expressed by cortical epithelial cells (13, 16, 17, 18). Teleologically, one highly controversial issue with regard to the shaping of the T cell repertoire is whether there is any reason for the division of labor between discrete subsets of cortical and medullary stromal cells (13, 19). In other terms, if the strength of the TCR signal dictates whether thymocytes will be positively or negatively selected, is there any advantage in positive and negative selection being induced mainly by interactions with cortical epithelial cells and medullary dendritic cells, respectively?
Following export from the thymus, naive T cells require continued engagement by MHC molecules to survive in the periphery and for homeostatic expansion (1, 20, 21, 22). Notably, T cells with different TCRs display major discrepancies in their ability to undergo homeostatic expansion (reviewed in Ref. 23). Thus, the T cell repertoire shaped in the thymus is subject to further molding in the peripheral lymphoid organs (2). The nature of the specific peptides involved in peripheral survival/expansion remains controversial. Some studies suggest that peptides involved in peripheral expansion may be identical with those that support intrathymic positive selection, while other studies suggest that they are structurally different, but share the same affinity or avidity (24, 25, 26). However, one indisputable point has unclear implications: the postselection T cell repertoire is anatomically secluded from the site in which it has been positively selected. Because of the blood-thymus barrier, mature T lymphocytes never reenter the thymus cortex (27, 28).
Two cytokines of the IL-6 family, leukemia inhibitory factor (LIF) and
oncostatin M (OM), can cause thymic involution. In vivo administration
of LIF and OM by i.p. injection to mice over 3 days is sufficient to
induce profound thymic atrophy with loss of cortical thymocytes
(29). Accordingly, LIF- and OM-transgenic mice present a
profound thymic atrophy (30, 31). Unexpectedly however,
LIF- and OM-transgenic mice were shown to develop massive extrathymic T
cell development, localized exclusively in the lymph nodes (LNs)
(30, 31, 32). Thus, abundant pT
transcripts are detectable
in the LNs of OM-transgenic mice, but not in their wild-type
counterparts (32). Furthermore,
215 x
106
Thy-1+CD4+CD8+
cells are present in the mesenteric LNs of 12-wk-old OM-transgenic mice
(31). Studies of adult thymectomized recipients of fetal
liver grafts have shown that the lymphopoietic pathway modulated by OM
is truly thymus independent (31). The paracrine influence
of OM is sufficient to induce T cell development in the LNs:
nontransgenic fetal liver-derived progenitors generate
CD4+CD8+ cells as well as
mature T cells in the LNs of nontransgenic recipients, whereupon OM is
supplied in a paracrine manner by coinjected OM-transgenic hemopoietic
cells (31). The OM-dependent extrathymic pathway generates
both CD4+ and CD8+ T cells,
which are diverse in terms of V
usage and show a more rapid turnover
rate (5-bromo-2'-deoxyuridine pulse-chase assays) than thymus-derived T
lymphocytes in wild-type mice (31). Of note, the mature
progeny (CD4+8- and
CD4-8+ T cells) of the
OM-dependent extrathymic pathway shares properties of classical
mainstream T lymphocytes: 1) CD4+ and
CD8+ elements are NK1.1-
(31), unlike NK1.1+ T cells that are
positively selected by interactions with hemopoietic cells in normal
mice (33); 2) the CD8+ T cells
express 
CD8 heterodimers (R. Terra, unpublished observation), as
opposed to CD8
T cells that have been reported to differentiate
extrathymically in the intestines and liver (34).
OM can transform the LN into a primary lymphoid organ whose ability to support T cell development and to seed peripheral compartments is similar to that of a normal thymus (31, 32). This fact raises fundamental questions for two reasons. The OM+ LN is devoid of thymic epithelial cells, and DP T lymphocytes are admixed with single-positive (SP) T cells without any thymus-like corticomedullary segregation (I. Louis and C. Perreault, manuscript in preparation). Moreover, mature SP T cells such as those from the spleen readily recirculate from the blood to the OM+ LN (31). We address two pressing issues. In the OM-conditioned LN, which cell type can replace thymic epithelial cells in supporting the positive selection of T cell progenitors? Do positive and negative selection in the LN follow the same rules as in the thymus, and will the T cell repertoires generated in the thymus and the LN be similar? The need to investigate these queries is compelling for at least two reasons. The extrathymic T cell differentiation pathway that emerges following chronic exposure to OM has potential therapeutic interest for individuals with impaired thymus function. Moreover, because the OM+ LN functions as a primary and secondary lymphoid organ, these studies should allow us to evaluate to which extent the canonical separation between primary and secondary lymphoid organs influences T lymphocyte development and homeostasis.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6J (B6),
B10.D2-H2dH2-T18cHc1/nSnJ
(B10.D2),
B6.SJL-PtprcaPep3b/BoyJ
(Ly-5a) (B6.SJL; Ly-5.1+),
and MHC class I-deficient (B6.129-B2 mtm1)
(35) mice were purchased from The Jackson Laboratory (Bar
Harbor, ME). H-Y TCR-transgenic mice
(C57BL/10AiTac-Ragtm1-TgN (TCRHY)N11)
(36) were obtained from Taconic Farms (Germantown, NY).
The 2C TCR-transgenic mice on a C57BL/6 background were from D. Y.
Loh (Washington University School of Medicine, St. Louis, MO)
(37). OM-transgenic mice on a C57BL/6 background have been
previously described (31, 32). H-Y TCR/LckOM-, 2C
TCR/LckOM-, and LckOM
2-microglobulin-/-
(
2m-/-)-transgenic
mice were obtained by breeding heterozygous LckOM males with
heterozygous H-Y TCR, 2C TCR, and homozygous
2m-/- female mice,
respectively. The genotype was confirmed by PCR assay using 200 ng
genomic tail DNA and the following primers: LckOM 5' to 3',
AGTCCCGTACTGCAGGAACA and GCTCACACCATTAAAGTGC; H-Y TCR 5' to 3',
GAGCCTCCAGTTTCTCCTCA and AAAGATGAGCTTCGCAGACC; 2C TCR 5' to 3',
GTGACACAGCCCGATGCTCG and TCCAAATGTCAGCGCACTTG; and
2m-/-, a mixture of
three primers 5' to 3', 1) GCTATTCGGCTATGACTGGG, 2)
TATCAGTCTCAGTGGGGGTG, and 3) CTGAGCTCTGTTTTCGTCTG. Mice were bred
at the Guy-Bernier Research Center, maintained in autoclaved
microisolator cages, and provided with autoclaved food and water,
according to the standards of the Canadian Council on Animal
Care.
Thymectomy and fetal liver cell transplantation
At 45 wk of age, mice were anesthetized by i.p. injection of
75 mg/kg sodium pentobarbital (Somnotol; MTC Pharmaceuticals,
Cambridge, Ontario, Canada), and the thymus was removed with a suction
cannula introduced over the suprastrenal notch. Visual inspection at
the time of sacrifice verified completeness of thymectomy in each
animal. Cell transplantation was performed at least 2 wk after surgery.
Hemopoietic chimeras were created by i.v. injection of 5 x
106 fetal liver cells, collected on day 13
postcoitum, into irradiated (12 Gy) recipients. MHC
I+ recipients of
2m-/- fetal liver
cells were injected i.p. with 200 µg anti-NK1.1 Ab (PK136; BD
PharMingen, Mississauga, Ontario, Canada) on days -2 and -1 to
prevent NK cell-mediated rejection of MHC class I-deficient donor cells
(38). Chimeras were analyzed 8090 days after
transplantation.
Abs and flow cytometry
For each sample, 106 cells were stained
with Abs and analyzed on a FACSCalibur flow cytometer using CellQuest
software (BD Biosciences, Mountain View, CA). The following Abs
obtained from BD PharMingen were used: PerCP anti-CD4 (RM4-5), APC
anti-CD8
(53-6.7), biotinylated anti-V
3 TCR (KJ25)
detected with FITC-streptavidin, FITC anti-V
5.1,2 TCR (MR9-4),
FITC anti-V
6 TCR (RR4-7), FITC anti-V
7 TCR (TR310), FITC
anti-V
8.1,2 TCR (MR5-2), FITC anti-V
9 TCR (MR10-2), FITC
anti-V
10b TCR (B21.5), FITC
anti-V
11 TCR (RR3-15), FITC anti-V
13 TCR (MR12-3), FITC
anti-V
14 TCR (14-2), FITC anti-V
17a
TCR (KJ23), FITC anti-Thy-1.2, FITC anti-Ly-5.1, FITC
anti-Ly-5.2, FITC anti-CD44 (IM7), FITC anti-CD122 (5H4),
FITC anti-heat-stable Ag (HSA), FITC anti-1B11 (CD43), FITC
anti-CD25, FITC and PE anti-CD62L (Mel-14), FITC anti-CD5
(53-7.3), FITC anti-TCR
/
, FITC and PE anti-CD3
,
biotinylated anti-Ly-5.2 detected with PE-streptavidin and PE
anti-CD69. Rat IgG2a,
was used as control Ab. Anti-H-Y TCR
(T3.70) and anti-2C TCR (1B2) mAb (kind gifts from H. S. Teh
and J. Wu, respectively) were detected with rat anti-mouse
IgG1 PE.
| Results |
|---|
|
|
|---|
We wished to determine whether extrathymic positive selection in
the OM-conditioned LN is supported by hemopoietic or nonhemopoietic
cells (that is, fibroblasts or endothelial cells). Our study of T cell
differentiation used four types of hemopoietic chimeras in which
adult-thymectomized lethally irradiated (12 Gy) Ly-5-congenic
recipients were transplanted with OM-transgenic fetal liver cells.
Chimeras differed in that MHC class I expression was either 1) normal
(MHC I+
MHC I+); 2)
deficient on both hemopoietic (donor-derived) and nonhemopoietic
(recipient) cells
(
2m-/-
2m-/-),
or selectively deficient on either 3) hemopoietic
(
2m-/-
MHC
I+) or 4) nonhemopoietic (MHC
I+
2m-/-)
cells. Although the first two groups served as positive and negative
controls, the last two groups allowed us to estimate the role of
nonhemopoietic vs hemopoietic cells in positive selection of
CD8+ T lymphocytes. OM-dependent extrathymic T
cell development involves all LNs, but is particularly massive in the
mesenteric LNs. Thus, all analyses of LN cells in this work were
performed on mesenteric LNs. As expected, positive selection of CD8 T
cells was defective in
(
2m-/-
2m-/-)
chimeras (Fig. 1
, A and
B). A key finding was that positive selection of CD8 T cells
proceeded normally in (MHC
I+
2m-/-)
chimeras (Fig. 1
, A and B) and generated a TCR
repertoire with a diversified V
profile (Fig. 1
C). Thus,
expression of MHC I molecules on hemopoietic cells is sufficient for
positive selection of OM+ T cells. At face value,
the presence of significant proportions of SP CD8 T cells in
(
2m-/-
MHC
I+) chimeras suggested that nonhemopoietic cells
can also support positive selection, albeit with reduced efficiency
(Fig. 1
, A and B). However, these results must be
regarded as inconclusive because expression of Ly-5.1 and Ly-5.2
markers showed that 13% of LN hemopoietic cells were of recipient
type (data not shown). Because residual host hemopoietic cells in the
latter group were MHC I+, they could have
supported positive selection of CD8 T cells.
|
To study the process of positive and negative selection during
extrathymic T cell differentiation, we analyzed T lymphocyte
populations in single (H-Y TCR)- and double-transgenic (H-Y TCR and OM)
male and female mice (Fig. 2
; Tables I
, II
, and III
). These mice possessed a
C57BL/6 background and were not RAG deficient. Note that the fact that
the OM+ LN is both a primary
and
secondary lymphoid organ complicates the
interpretation. In contrast to SP T cells in the thymus, SP T cells in
the OM+ LN are a combination of cells generated
in situ admixed with recirculating T cells.
|
|
|
|
97%
in the thymus and
36% in the spleen (Fig. 2
3 in the thymus to
0.6
in the spleen. This is consistent with previous reports that in
H2b female mice, T cells bearing the transgenic
H-Y TCR are positively selected in the thymus, but expand poorly in the
periphery (39, 40). In contrast, in double-transgenic (H-Y
TCR and OM) mice, the proportion of T3.70+ cells
among CD8 SP T cells was only
25% in the LNs (the site in which T
cells develop) and
6% in the spleen (Fig. 2
Negative selection in male mice.
As previously reported (41), we confirmed that
T3.70+ T cells are negatively selected at the DP
stage in the thymus of H2b male mice (Fig. 2
C). The number of DP T cells and the ratio of CD8-CD4 T
cells in the thymus are severely decreased, and the expression of CD8
is decreased on SP T cells. Yet, consistent with observations by Rocha
and von Boehmer (40), SP CD8low H-Y
TCR+ T cells that escaped intrathymic negative
selection expanded well in the periphery in which
97% of CD8 T
cells were T3.70+. In fact, the absolute numbers
of spleen T3.70+ CD8 T cells, greater in male
than female mice (Tables I
and II
), illustrate how extensively
homeostatic expansion can remold the postselection repertoire.
Similarly, the number of DP T cells was drastically decreased in the LN
of OM+ male mice, yet
CD8low SP T cells that escaped negative selection
expanded well in the periphery (spleen) (Fig. 2
D and Tables I
and II
). Thus, negative selection of H-Y TCR+ T
cells takes place very efficiently in the LN of
OM+ mice. In comparison with
T3.70+ CD8 T cells originating from the thymus of
single-transgenic female mice, those found in single- and
double-transgenic male mice showed an up-regulation of CD44 and CD122
and a paucity of HSA+ cells. The latter findings
were more marked in T cells of LN than those of thymus origin (Fig. 2
, C and D).
Extrathymic differentiation of 2C TCR-transgenic T lymphocytes
During intrathymic development, the 2C TCR is positively selected
by H2Kb and negatively selected by
H2Ld (42, 43). To evaluate whether
the development of 2C+ T lymphocytes obeys the
same rules in the LN as in the thymus, we analyzed T lymphocyte
populations in single (2C TCR)- and double-transgenic (2C TCR and OM)
H2b and H2b/d RAG-competent
mice (Fig. 3
; Tables I
, II
, and III
).
|
|
Development of double-negative TCR-transgenic T cells
Double chain TCR
transgenes expressed at the double-negative
(DN) stage alter early ontogeny especially when affinity of the TCR for
its ligand is strong, that is, conditions of negative selection. In
this situation, increased numbers of DN cells are exported in the
periphery. These TCR
+ DN T cells have
properties of 
T cells, and their development is MHC independent
(44, 45, 46). This prompted us to evaluate whether a similar
expansion of TCR+ DN T cells was present in
OM-transgenic mice. We indeed detected TCR+ DN T
cells in OM+ mice. Some differences were observed
between the numbers of TCR+ DN T cells in the
thymus of OM- mice vs the LN of
OM+ mice (Tables I
and II
). However, it is
difficult to speculate about the significance of these data because the
LN of OM+ mice contains not only cells generated
in situ, but also recirculating cells. Nonetheless, comparing the
numbers of H-Y and 2C TCR+ DN T cells in the
spleen of OM- and OM+ mice
was more informative and allowed us to make three points (Tables I
and II
). In both OM+ and OM-
mice, DN TCR+ T cells were more abundant when the
mice expressed the nominal Ag recognized by the TCR (H-Y TCR male and
2C TCR H2b/d). This is consistent with previous
reports in OM- mice (44, 45). In
mice lacking the nominal Ag (H-Y TCR female and 2C TCR
H2b), the number of spleen
TCR+ DN T cells was greater for the 2C than the
H-Y TCR. Finally, the number of splenic TCR+ DN T
cells was of similar magnitude in OM- and
OM+ mice. Indeed, among the four groups of mice
(H-Y TCR female and male, 2C TCR H2b, and
H2b/d), numbers of TCR+ DN
T cells in OM+ mice corresponded to 38%130%
of those in OM- mice. Thus, no dramatic
differences were found in the TCR+ DN T cell
development in OM+ relative to
OM- mice.
CD5 expression on T lymphocytes of thymic vs extrathymic origin
CD5 is a cell surface glycoprotein that functions as a negative regulator of TCR-mediated signaling (47). CD5 is up-regulated at crucial points during thymocyte development by pre-TCR and TCR engagement, and the level of CD5 surface expression is directly related to pre-TCR and TCR signaling intensity. Thus, CD5 surface levels were found to vary considerably among mature SP thymocytes and peripheral T cells that express distinct TCRs. The level of CD5 expression paralleled the avidity of the positively selecting TCR-MHC-ligand interaction (48, 49). Our data imply that positive selection in the OM+ LN is much more effective for lymphocytes bearing the 2C TCR than the H-Y TCR. Thus, by measuring CD5 expression, we sought to estimate the strength of the signals transmitted by these two types of TCR during thymic vs extrathymic development.
Expression of CD5 was decreased on DP and SP CD8
T3.70+ T lymphocytes developing in the
OM+ LN relative to intrathymic
T3.70+ T cells (Fig. 5
A). This is consistent with
the idea that H-Y-specific T cells receive TCR signals of lesser
intensity in the periphery than in the thymus. Notably, low expression
of CD5 was not a general characteristic of all T cells that maturated
in the OM+ LN: T3.70-negative T cells present in
the LNs of H-Y TCR+OM+
female mice expressed high levels of CD5 (Fig. 5
A).
Following development in the thymus or in the OM+
LN, DP and CD8 SP T cells bearing the 2C TCR expressed higher levels of
CD5 than H-Y TCR+ T cells. When compared with
thymic T lymphocytes, 2C TCR+ T lymphocytes in
the OM+ LN expressed barely or substantially
decreased levels of CD5 at the DP and the CD8 SP stage, respectively.
In sum, two major findings emerged from evaluation of CD5 expression.
First, in the OM+ LN, expression of CD5 and
presumably the strength of TCR signals were greater on 2C
TCR+ than on H-Y TCR+ T
lymphocytes (Fig. 5
C). Data on both the efficacy of positive
selection (Fig. 2
) and CD5 expression (Fig. 5
) suggest that for T
lymphocytes bearing the H-Y TCR, the efficacy of positive selection in
the OM+ LN is low because they receive only weak
TCR signals. Second, T lymphocytes bearing the 2C or the H-Y TCR
express lower levels of CD5 when they develop in the
OM+ LN than in the thymus.
|
Naive T lymphocytes do not normally recirculate into the thymus. Only a few activated/memory T cells in the S phase of the cell cycle reenter the thymus medulla (but not the cortex) at time of infection (28, 50). In the LNs of OM-transgenic mice, however, SP T lymphocytes live in the environment in which their differentiation/selection took place. Thus, one fundamental difference between T lymphocytes developing in the thymus vs the OM+ LN is that in the latter case, the postselection T cell compartment is steadily confronted with the very cells that induced positive selection.
The phenotype of DP T cells found in the OM+ LN
was similar to that of DP thymocytes of wild-type mice concerning
expression of HSA, CD3, CD4, CD5, CD8, and CD44 (Fig. 6
A). When compared with
wild-type thymocytes, SP T cells in the OM+ LN
showed several distinctive features: expression of CD3 was decreased,
while that of CD44 was up-regulated; few CD4 or CD8 cells were
HSA+; and few CD8 cells were
CD69+ (Fig. 6
A). In addition, the
intensity of CD5 staining was not decreased on polyclonal populations
of CD4 and CD8 T lymphocytes found in the OM+ LN
(Fig. 6
A) as it was on transgenic T cells bearing the H-Y
and 2C TCR (Fig. 5
). In fact, the mean CD5-labeling intensity was
increased on CD8 SP T cells, being
151 in the
OM+ LN and
118 in the wild-type thymus (Fig. 6
A).
|
All these results indicate that two inferences are possible regarding
extrathymic T lymphocytes that develop in the OM+
LN. First, SP T cells steadily confronted with cells that display the
MHC-peptide mixture that was instrumental in their positive selection
have a phenotype similar to that of T lymphocytes undergoing
homeostatic expansion (24, 51). Second, the intensity of
TCR signals (CD5 levels) received during the DP
SP transition is
normal (CD4) to high (CD8), even though CD3 levels (and those of
TCR
, not shown) of SP T cells are relatively low. Decreased CD3
expression could represent a compensatory mechanism either to decrease
the strength of the TCR signal at the time of selection or to dampen
the ongoing stimulation of postselection SP T lymphocytes by self
epitopes.
| Discussion |
|---|
|
|
|---|
Positive selection
One salient finding emerging from our experiments in hemopoietic
chimeras is that MHC I+ hemopoietic cells were
sufficient to support positive selection of a polyclonal repertoire of
extrathymic CD8 T cells (Fig. 1
). It has been shown that hemopoietic
cells can support intrathymic positive selection, although, with the
exception of CD1d-dependent NKT cells, the importance of intrathymic
positive selection by hemopoietic cells (as opposed to epithelial
cells) is still a matter of debate (10, 11). Clearly,
however, extrathymic hemopoietic cells do not normally support any
significant level of T cell-positive selection (10, 11).
That OM allows LN hemopoietic cells to induce positive selection of
developing T lymphocytes is remarkable.
Positive selection did not proceed in the same fashion in the thymus
and the OM+ LN, at least for CD8 SP T cells.
Indeed, taking CD5 expression as a surrogate marker for the avidity of
the positively selecting TCR-MHC-ligand interactions, we found a
discrepancy between T cells bearing a transgenic TCR vs polyclonal T
cells (Figs. 5
and 6
). CD8 SP T lymphocytes bearing the 2C or the H-Y
TCR expressed lower levels of CD5 when they developed in the
OM+ LN than in the thymus (Fig. 5
). In contrast,
in the case of non-TCR-transgenic polyclonal CD8 SP T cells, the CD5
staining intensity was superior for those developing in the
OM+ LN than in the thymus (Figs. 5
and 6
). In
general, there is no reason why the OM+ LN would
select polyclonal T cells more efficiently than TCR-transgenic T cells.
The most straightforward explanation is that expression of relevant
MHC-peptide complexes by cells supporting positive selection dictates
the efficacy of positive selection and that the MHC-peptide complexes
that positively select the H-Y and 2C TCR are less abundant in the LN
than in the thymus cortex. Yet, other MHC-peptide ligands expressed in
the LN do generate TCR signals of optimal quality for proper positive
selection of a diverse repertoire. Thus, the inference is that positive
selection is supported by different sets of MHC-peptide complexes in
the thymus vs the LN and that the two postselection repertoires are
different, even though they may overlap. We also note that when T cells
develop in a thymus in which MHC class I expression is limited to
hemopoietic cells, 2C+, but not H-Y
TCR+CD8 T cells are positively selected
(10, 11). This observation also supports the concept that
epithelial cells and hemopoietic cells express different sets of MHC
I-associated peptides and that the peptide mixture of hemopoietic cells
better supports selection of 2C than H-Y TCR+ T
cells.
Negative selection
Negative selection of extrathymic T lymphocytes bearing the H-Y or
2C TCR was very effective in the OM+ LN (Figs. 2
and 3
). If anything, depletion of H-Y TCR+ DP T
cells was more drastic in the OM+ LN than in the
thymus (Fig. 2
). This finding provides proof of principle for the
concept that negative selection does not require a dedicated APC
(53). Although thymus stromal cells have a unique ability
to promote positive selection, their capacity to induce negative
selection is shared by peripheral APCs. Put simply, negative selection
occurs in the thymus because immature T lymphocytes are produced there.
It could possibly occur in any organ, although it may require a certain
abundance of hemopoietic APCs. We note that following negative
selection, the fate of CD8 T cells bearing the 2C and the H-Y TCR was
different. Irrespective of their thymic or extrathymic origin, the few
H-Y TCR+ T cells that escaped negative selection
(in male mice) expanded considerably in the periphery, whereas 2C
TCR+ T cells did not (in
H2b/d mice) (Tables I
and II
). This demonstrates
how extensively peripheral homeostatic mechanisms can remold the
postselection repertoire by inducing a major expansion of T cells
specific for some, but not all self epitopes.
The activated/memory phenotype of extrathymic T cells
One salient characteristic of SP extrathymic T lymphocytes that
developed under the influence of OM is their phenotype, which is
typical of Ag-experienced or memory T lymphocytes (Fig. 6
). This idea
fits well with our previous reports using in vivo 5-bromodeoxyuridine
pulse-chase experiments in (non-TCR-transgenic) LckOM mice: their
extrathymic T cells proliferate very rapidly and have a high turnover
rate (31), as would be expected for T cells with a memory
phenotype (54). However, 5-bromodeoxyuridine-labeling
experiments have not been performed in TCR-transgenic
OM+ mice. Therefore, we could not formally
evaluate the peripheral survival and expansion of T cells bearing the
H-Y and 2C TCR in OM+ mice. Interestingly, while
the vast majority of our extrathymic T cells displayed a memory
phenotype (Figs. 2
and 6
), we observed one noticeable exception: most
extrathymic CD8 T cells bearing the 2C TCR had a naive phenotype (Fig. 3
). This means that acquisition of the memory phenotype was not a
direct consequence of exposure to OM, but was dependent on the TCR
clonotype. Collectively, these data suggest that, with a few possible
exceptions (e.g., the 2C TCR), extrathymic T cells in the
OM+ LN have a memory phenotype and a high
turnover rate because they undergo homeostatic expansion induced by
chronic exposure to the LN MHC/peptide mixture that entailed their
positive selection. That being the case, we recently observed that SP T
cells derived from the OM+ LN behave functionally
like memory T cells following in vitro and in vivo Ag priming (M.
E. Blais, G. Gérard, and C. Perreault, manuscript in
preparation). Nevertheless, that most 2C+ T cells
in OM+ mice did not display an activated
phenotype was surprising because 2C T cells can undergo homeostatic
peripheral expansion (24). One explanation would be that
the OM+ LN produces enough
2C+ T cells to fill peripheral niches without the
need for peripheral expansion.
Aside from their memory phenotype, it is remarkable that the vast
majority of extrathymic SP LN T lymphocytes were
HSAlow (Fig. 6
). To some extent, this is because
the OM+ LN contains recirculating T cells in
addition to T cells generated in situ (31). Interestingly,
in the thymus of wild-type mice, the CD44high
HSAlow phenotype is shared by the single subset
of thymocyte positively selected on hemopoietic cells:
-GalCer-CD1d-reactive T cells (55). These data lead us
to propose that the CD44high
HSAlow phenotype is characteristic of T
lymphocytes positively selected on hemopoietic cells. We envision at
least two nonmutually exclusive explanations for the low proportion of
HSA+ SP T cells in the OM+
LN. Expression of HSA, which was high on DP T lymphocytes, might be
down-modulated more rapidly following positive selection on hemopoietic
cells. Alternatively, HSA+ T cells may simply be
diluted by rapidly proliferating HSA- T
lymphocytes because the latter cells undergo vigorous postselection
proliferation. A parallel with studies of TCR excision circles (TREC)
illustrates the latter mechanism. T cell division was indeed identified
as the most important factor for decreasing TREC content
(56). Thus, in the presence of normal thymic output,
chronic Ag stimulation leads to low TREC levels (57, 58).
Another important feature of extrathymic SP LN T lymphocytes was their low levels of TCR/CD3. Strong TCR ligation by peptide/MHC complexes leads to TCR down-regulation whose probable role is to protect T cells from overstimulation (59, 60). TCR down-modulation, which is mediated by the intracellular retention and degradation of ligated complexes (61), is an effective means of tolerance to extrathymic Ags. Thus, in transgenic mice expressing low levels of the H2Kb Ag exclusively on hepatocytes, tolerance of Ag-reactive CD8 T cells was induced by TCR down-modulation (62). Interestingly, extrathymic T cells (whose site of development is unclear) found in nude mice or in irradiated adult-thymectomized hosts reconstituted with hemopoietic progenitors are indeed TCRlow/int (63). We therefore propose that TCR/CD3 down-modulation found in SP T cells developing in the OM+ LN is a general characteristic of extrathymic T cells. This TCR/CD3 down-modulation is required to prevent overstimulation of T lymphocytes that live in the microenvironment in which their positive selection took place.
Thymic and extrathymic T cell development pathways follow different rules. Extrathymic T cells that develop along the OM-dependent LN pathway are different from classic T cells in terms of repertoire selection, turnover kinetics, and expression of activation/maturation markers. These findings beg the question: what is the functionality of these extrathymic T cells? Athymic mice reconstituted with OM+ hemopoietic stem cells can reject allogeneic cancer cells (32) and do not show increased incidence of infections (at least when housed in a specific pathogen-free environment). In addition, we recently obtained evidence that they can generate protective antiviral responses (M. E. Blais, G. Gérard, C. Perreault, manuscript in preparation). Hence, OM-induced extrathymic T cells appear to be quite functional. The thymus constitutes the primary T lymphoid organ in all jawed vertebrates, and in evolutionary terms is much more ancient than the LN. The thymus appeared in Chondrichthyes, the first vertebrates known to elicit adaptive immune responses, while LNs occur strictly in endothermic vertebrates and reach their full development only in eutherian mammals (64). The fact that extrathymic T cells generated in the LN under the influence of OM can replace the mainstream thymic T lymphocytes without any obvious disadvantage means that several features unique to the thymus are not essential to generate a functional T cell repertoire (e.g., thymic epithelial cells, corticomedullary segregation, blood-thymus barrier preventing the reentry of mature T lymphocytes). In other words, a primary T lymphoid organ does not have to share all the features of the thymus. This concept will lead us to further studies of the OM-dependent pathway and its potential medical relevance for the treatment of congenital and acquired immune deficiencies.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Claude Perreault, Guy-Bernier Research Center, Maisonneuve-Rosemont Hospital, 5415 de lAssomption Boulevard, Montreal, Quebec, Canada H1T 2 M4. E-mail address: c.perreault{at}videotron.ca ![]()
3 Abbreviations used in this paper: DP, double positive;
2m,
2-microglobulin; DN, double negative; HSA, heat-stable Ag; LIF, leukemia inhibitory factor; LN, lymph node; OM, oncostatin M; SP, single positive; TREC, TCR excision circle. ![]()
Received for publication March 5, 2002. Accepted for publication May 24, 2002.
| References |
|---|
|
|
|---|
2-microglobulin deficient mice lack CD4-8+ cytolytic T cells. Nature 344:742.[Medline]

T-cell receptor determine the CD4/CD8 phenotype of T cells. Nature 335:229.[Medline]

T cell receptor can replace the 
receptor in the development of 
lineage cells. Immunity 5:343.[Medline]

suppresses TCR
gene rearrangement but permits development of 
lineage T cells. J. Exp. Med. 192:537.
+ intraepithelial lymphocytes of the gut in mice bearing TCR transgenes. Eur. J. Immunol. 31:2593.[Medline]