HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kanayama, N. Articles by Ohmori, H. Search for Related Content PubMed PubMed Citation Articles by Kanayama, N. Articles by Ohmori, H.

B Cell Selection and Affinity Maturation During an Antibody Response in the Mouse with Limited B Cell Diversity¹

Naoki Kanayama^*, Takafumi Kimoto^*, Kagefumi Todo^*, Yumiko Nishikawa^2,*, Masaki Hikida^2,*, Masaki Magari^*, Marilia Cascalho and Hitoshi Ohmori^3,*

^* Department of Biotechnology, Faculty of Engineering, Okayama University, Tsushima-Naka, Okayama, Japan; and Department of Surgery and Immunology, Mayo Clinic, Rochester, MN 55905

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
The quasi-monoclonal mouse has limited B cell diversity, whose major (80%) B cell Ag receptors are comprised of the knockin V_H 17.2.25 (V_HT)-encoded H chain and the 1 or 2 L chain, thereby being specific for 4-hydroxy-3-nitrophenylacetyl. The p-nitrophenylacetyl (pNP) was found to be a low affinity analog of nitrophenylacetyl. We examined affinity maturation of anti-pNP IgG by analyzing mAbs obtained from quasi-monoclonal mice that were immunized with this low affinity Ag. The results are: 1) Although V_HT/1 and V_HT/2 IgM were equally produced, V_HT/2 IgG almost exclusively underwent affinity maturation toward pNP. 2) A common mutation in complementarity-determining region 3 of V_HT (T313A) mainly contributed to generating the specificity for pNP. 3) Because mutated V_HT-encoded -chains could form 1-bearing IgG in Chinese hamster ovary cells, apparent absence of V_HT/1 anti-pNP IgG may not be due to the incompatibility between the -chains and the 1-chain, but may be explained by the fact that V_HT/1 B cells showed 50- to 100-fold lower affinity for pNP than V_HT/2 B cells. 4) Interestingly, a pNP-specific IgM mAb that shared common mutations including T313A with high affinity anti-pNP IgG was isolated, suggesting that a part of hypermutation coupled with positive selection can occur before isotype switching. Thus, even weak B cell receptor engagement can elicit an IgM response, whereas only B cells that received signals stronger than a threshold may be committed to an affinity maturation process.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
When the peripheral lymphoid tissues are exposed to an Ag, several groups of B cells are clonally selected, and differentiate into plasma or memory cells. One characteristic feature of a T cell-dependent Ab response is that the isotype of the produced Abs is switched from IgM to other classes, including IgG with time after immunization. The other is a gradual increase of Ab affinity to an inducing Ag particularly in the switched isotypes, a process termed affinity maturation (1, 2, 3, 4, 5, 6). It has been shown that isotype switching and affinity maturation are strongly dependent on germinal centers (GC)⁴ that are transiently formed from Ag-stimulated B and T cells in the follicular region of secondary lymphoid tissues (1, 2, 6). A series of previous reports have revealed that affinity maturation of an Ab is the result of somatic hypermutation of V region genes coupled with the positive selection of B cells (centroblasts) whose mutated B cell Ag receptors (BCR) acquire higher affinity, while B cells that failed to improve their BCR may be deleted (1, 2, 7, 8, 9). It has been shown that mutated BCR are tested for their quality in terms of affinity to the inducing Ag that are trapped in the form of immune complexes onto follicular dendritic cells in GC (1, 10, 11). B cells with improved affinity are considered to receive survival signals via their BCR and the complement receptors (CD21/CD35) and from CD4⁺ T cells (1, 12, 13), thus leading to the retention of B cells that will subsequently secrete higher affinity Abs.

In wild-type mice, somatic hypermutation and affinity maturation have been systematically investigated in Ab responses to several haptens, including 2-phenyl-5-oxazolone (14, 15) and 4-hydroxy-3-nitrophenylacetyl (NP) (16, 17, 18, 19, 20), because limited Ig genes are preferentially used in these Ab responses, V_HOx1/VOx1 in the former response, and V_H 186.2 in the latter, respectively. However, it has not been fully elucidated how an Ag-stimulated B cell clone becomes a winner in the competition with others, and what criteria direct B cells to enter affinity maturation pathway. To examine these issues, we used the quasi-monoclonal (QM) mouse with limited BCR diversity, in which one of the J_H loci is replaced with the 17.2.25 V_HDJ_H segment (V_HT) derived from an anti-NP mAb (21), with the other J_H locus and both loci being disrupted (22). The advantage of this type of knockin strain is that the site-directed V_H-encoded (V_HT⁺) H chain has been shown to undergo class switching and somatic mutation normally (23, 24). However, it has not been fully analyzed how a site-directed V gene is tuned during affinity maturation. Approximately 80% of QM B cells expressed V_HT⁺ NP-specific BCR that bear -chains (21, 22), of which 1- and 2-chains were major L chains used. By stimulating B cells with NP analogs of varying affinity, this mouse will enable us to examine how the B cell differentiation into plasma or memory cells is regulated by the intensity of BCR engagement. We tested various NP analogs, and found that p-nitrophenylacetyl (pNP) showed at least 20-fold lower affinity than NP for V_HT⁺ QM B cells (25). In the present study, using QM mice that were immunized with pNP-conjugated chicken -globulin (CGG), we examined affinity maturation of anti-pNP IgG in the following two respects: 1) How do originally NP-specific B cells acquire pNP specificity by somatic hypermutation during affinity maturation toward pNP? 2) How are two major B cell clones, V_HT/1 and V_HT/2, selected by pNP to be committed to affinity maturation process?

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Haptens and Ags

NP, pNP, 4-hydroxy-5-iodo-3-nitrophenylacetyl (NIP), 4-hydroxy-phenylacetyl, and m-nitrophenylacetyl were purchased as the free acids from Tokyo Kasei (Tokyo, Japan). NP, NIP, or pNP was conjugated to CGG (Sigma-Aldrich, St. Louis, MO) or BSA by reacting the N-hydroxysuccinimide ester of each acid, as described previously (25). Usually, CGG was conjugated with 25 molecules of each hapten.

Estimation of affinity of NP-related haptens for V_HT⁺ anti-NP Ab

An appropriately diluted anti-pNP IgM Ab purified from a QM mouse serum was added at 50 µl to 96-well microplates (Nunc, Roskilde, Denmark) that were coated with rabbit anti-mouse IgM (Funakoshi Chemicals, Tokyo, Japan). After incubation for 2 h at 25°C, followed by washing, 50 µl of PBS containing 10 µg/ml NP-conjugated -galactosidase (-Gal) (3 NP/enzyme molecule) and varying concentrations of a free hapten were added in each well. NP--Gal was prepared by reacting Escherichia coli -Gal (Sigma-Aldrich) with N-hydroxysuccinimide ester of NP in the same fashion as described previously (26). The plate was incubated for 1 h at 25°C, followed by washing thoroughly. PBS containing 0.1% BSA was used for diluting reagents and washing. The bound NP--Gal activity was assayed by adding a fluorescent substrate, 4-methylumbelliferyl--D-galactoside (Sigma-Aldrich), as reported previously (27). The affinity of each hapten for the anti-NP IgM was estimated by measuring the free hapten concentration that is required for 50% inhibition of the binding of NP--Gal to the solid phase.

Flow cytometric analysis

B cells were stained with anti-mouse Abs in PBS containing 0.2% BSA, 0.1% sodium azide, and, when necessary, 50 µg/ml of normal rat IgG (ICN Pharmaceuticals, Costa Mesa, CA). FITC or CyChrome anti-B220 (RA3-6B2), PE anti-CD138 (281-2), biotinylated anti-1 L chain (R11-153), and biotinylated anti-2 L chain (2B6) that was cross-reactive with 3 were purchased from BD PharMingen (San Diego, CA). B cells bearing V_HT-encoded IgH were detected with biotinylated mAb to the Id of V_HT, R2.438 (a gift from T. Imanishi-Kari, Tufts University, Boston, MA). Surface IgM (sIgM) was detected using PE anti-IgM (Southern Biotechnology Associates, Birmingham, AL). Biotinylated Abs were visualized with FITC- or PE-labeled streptavidin. Stained cells were analyzed with FACSCalibur and CellQuest software (BD Biosciences, Mountain View, CA).

Mice and immunization

The quasi-monoclonal (QM) mouse is a gene-targeted strain whose genotype is V_HT/J_H^-, J^-/J^-, ⁺/⁺ (22). QM mice were immunized in the hind footpad with 20 µg of pNP₂₅-CGG emulsified in CFA, and bled on indicated days after immunization. All mice were treated in accordance with the guidelines approved by the Committee of Laboratory Animal Care, Okayama University.

In vitro culture of QM B cells

In the induction of an Ab response in vitro, QM spleen B cells (3 x 10⁶), prepared as described (27), were cultured with 3 x 10⁴ CGG-specific Th2 clone, CTH, which was established in our laboratory, in the presence of varying concentrations of NIP-CGG or pNP-CGG in 1 ml of RPMI 1640 medium supplemented with 10% FCS and 1 x 10^-5 M 2-ME. On day 3 of the culture, the cells were washed to remove free Ags, and cultured for an additional 3 days. Culture supernatants were assayed for V_HT Id⁺ IgM Abs by a sandwich ELISA using R2.438 anti-Id and anti-µ Abs. Data were presented as the mean values of triplicate experiments. SEs do not usually exceed 10% of the mean.

For observing down-regulation of sIgM, QM B cells (3 x 10⁶/ml) were cultured with 1 µg/ml of pNP-CGG or NIP-CGG for 3 h. B220⁺Id⁺ B cells were assessed for the level of sIgM by flow cytometry.

Assay of the level and the affinity of anti-pNP Abs

ELISA for anti-pNP Abs was performed using 96-well microplates coated with pNP₂₀-BSA (a high hapten density) to detect both high and low affinity anti-pNP Abs. Each class of Abs bound to the plates was measured with peroxidase-conjugated goat IgG specific for mouse IgM (Southern Biotechnology Associates) or peroxidase-conjugated horse Abs to mouse IgG (Vector Laboratories, Burlingame, CA), respectively. IgG1 and IgG2b were major subclasses in the anti-pNP response. Usually, IgG was assayed without discriminating subclasses in the present experiments. Relative affinity of anti-pNP IgG in serum samples or mAbs was estimated by differential binding of the Ab to plates coated with pNP4-BSA (a low hapten density) and pNP20-BSA (a high hapten density), and expressed as the ratio of IgG bound to pNP4/IgG bound to pNP20 (sometimes abbreviated as pNP₄-pNP₂₀), as reported previously (25, 28). As the positive control for the affinity assay, an anti-pNP IgG mAb (pNP₄-pNP₂₀ = 0.7) was used as a standard sample.

To compare the affinities of V_HT/1 and V_HT/2 IgM mAbs for pNP and NP, a displacement ELISA was conducted (29). Briefly, 1 µg/ml of each mAb was incubated for 3 h at room temperature in microplates coated with pNP₂₀-BSA or NP₇-BSA. After washing, the bound mAb was incubated for 1 h with varying concentrations of NP--aminocaproate. The displacement of the bound mAb by the free hapten was estimated by determining the residual mAb on the plates.

Estimation of Ag specificity of mAbs

An appropriately diluted mAb was added to microplates that were coated with pNP-BSA, NP-BSA, or NIP-BSA (6–7 each hapten/BSA molecule), and incubated at 25°C for 1 h. After washing, bound mAb was assayed by reacting peroxidase-conjugated second Abs, as described above.

Generation and characterization of anti-pNP mAbs

On day 16 after immunization of QM mice with pNP-CGG/CFA in the footpads, popliteal lymph node (LN) cells were prepared and fused with a myeloma cell line, NSO^bcl-2 (30), which was given by B. Diamond (Albert Einstein College of Medicine, New York, NY). mAbs were screened on the basis of binding to pNP₂₀-BSA. The retention of V_HT and the usage of -chains in the mAbs were examined by ELISA using anti-V_HT Id, anti-1, and anti-2 mAbs, and further confirmed by RT-PCR using specific primers, as described previously (31, 32).

Hybridomas secreting nonmutated V_HT/1 IgM, V_HT/2 IgM, or V_HT/2 IgG1 mAb were generated by the cell fusion with NSO^bcl-2 of QM B cells that were stimulated in vitro for 5 days with 20 µg/ml of LPS from E. coli (Sigma-Aldrich) in the presence or absence of 10 ng/ml of IL-4 (PeproTech EC, London, U.K.). The absence of somatic mutations in the V_HT⁺ mAbs was confirmed by sequencing V_H and V_L genes.

Sequencing of V_H and V_L genes

cDNA was synthesized from total RNA of each anti-pNP mAb-secreting hybridoma, as described previously (25). V_H and V_L regions of mAbs were amplified with PCR using AmpliTaq Gold DNA polymerase (Applied Biosystems, Foster City, CA). Primers used were as follows. For amplifying V_H regions, CTGAATCTCAAGGTCCTTAC specific for V_HT, and ARCTKSWGSAGWCWGGRSSWG and ARCTKAWGSAGWCWGGRSSWG for endogenous V_H as sense primers; GACAGGGMTCCAKAGTTCCA for all IgG subclasses, and GTTCTGATACCCTGGATGACTTC for IgM as antisense primers. For amplifying V regions, GCTGCTGACCAATATTGAAAAGAATAGACC and GCATGTTTCTGATCTCAGCCTCTG for the 1-chain; GCTGCTGACCAATATTGAAAATAATAGACT and TCCCAGGCTAAGGAGAAACCTG for the 2-chain. Amplified fragments were purified with QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and directly sequenced using BigDye Terminator Cycle Sequencing FS Ready Kit equipped with ABI PRISM 310 Genetic Analyzer (Applied Biosystems). The BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) and the IgBLAST (http://www.ncbi.nlm.nih.gov/igblast/) programs were used to find the closest matching sequences in the nonredundant database at the National Center for Biotechnology Information server, and the Seqhunt II (http://immuno.bme.nwu.edu/seqhunt.html) was used to search the Kabat database (33).

Expression of recombinant mAbs in Chinese hamster ovary (CHO) cells

Various combinations of germline or mutated V_HT-encoded H chain with the 1- or 2-chain derived from V_HT⁺ mAbs were expressed as recombinant Abs in CHO cells. CHO cells were maintained in RPMI 1640 medium suplemented with 10% FCS, 1 x 10^-5 M 2-ME, 100 U/ml penicillin G, and 50 µg/ml streptomycin. V_HT regions from mAbs, V_HT/2 IgM, G83, and G149, were amplified using Pfu DNA polymerase (Stratagene, La Jolla, CA) and primers, TCAAGCTAGCCACCATGAAATGCAGCTGGGTTATC and TTTTAGCGCTCGAGACGGTGACTGAGGTTCC, followed by the digestion of the products with NheI and Eco47III. The IgG2b C region was amplified with CCGTCTCGAGCGCTAAAACAACACCCCCATCAGTC and CTTTGCGGCCGCTGAGCTCATTTACCCGGAGA, and the product was digested with Eco47III and NotI. The digested V_H fragments derived from V_HT/2 IgM, G83, and G149 were each inserted in combination with the fragment of the 2b C region between NheI and NotI sites of a mammalian expression vector, pCI-neo (Promega, Madison, WI), which were designated as pCIGV_HT, pCIG83, and pCIG149, respectively. Another two constructs bearing the 2b genes containing only one (T313A) or two (T313A/G316A) mutations in V_H complementarity-determining region 3 (CDR3) were constructed by replacing a KpnI-Eco47III fragment of pCIGV_HT with the corresponding sequence from pCIG83 or pCIG149, respectively. A PvuII-BamHI fragment containing neomycin phosphotransferase gene of pCI-neo was exchanged with a PvuII-BamHI fragment containing puromycin N-acetyltransferase gene of pBSpacDp (34). This expression vector was termed as pCI-puro. The 1- and 2-chains were amplified from V_HT/1 IgM and V_HT/2 IgM hybridomas using ACCTGTCGACGCCACCATGGCCTGGATTTCACTTATAC as a sense primer for both 1 and 2, and GGAAGCGGCCGCTCACCTAGGAACAGTCAGCAC and GGAGCGGCCGCGGTTCTTAGAGACATTCTGCAGGAG as antisense primers for 1 and 2, respectively. The 1 and 2 fragments were digested with SalI and NotI, and cloned into pCI-puro. Sequence analysis of all the gene constructs confirmed that no mutation was introduced during PCR amplification. The IgG2b C region and the 1- and 2-chains had germline sequences. All constructs were linearized by digesting with BamHI or BglII before transfection. CHO cells were transfected with an appropriate combination of a 2b and a gene using LipofectAmine (Life Technologies, Rockville, MD). Stable transfectants were selected and maintained in the presence of 500 µg/ml G418 and 5 µg/ml puromycin (Sigma-Aldrich).

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
pNP as a low affinity analog of NP for QM B cells

The V_HDJ_H gene segment, V_HT, is derived from 17.2.25 anti-NP mAb (1, ) that binds to NP and its iodinated analog NIP. The affinity (K_a) of 17.2.25 for NIP has been estimated to be 4 x 10⁵ M^-1 (21). In QM mice bearing the site-directed V_HT with the genotype of V_HT/J_H^-, ^-/^-, ⁺/⁺, a majority (80%) of B cells expressed V_HT-encoded BCR that were detected by an anti-Id mAb, R2.438 (35) (Fig. 1A). Because both loci are disrupted, QM B cells exclusively express -chains (22). Although an anti-2 mAb used in the flow cytometric analysis has cross-reactivity with 3, of 30 -chains randomly sequenced, 1 and 2, but not 3, were found (data not shown), thus suggesting that the 1- and 2-chains are major L chains used. Flow cytometric analysis shows that each V_HT/1 and V_HT/2 B cell population has a comparable size (Fig. 1B). Both V_HT/1 and V_HT/2 Abs have been shown to bind to NP (21, 22). To examine various NP-related haptens for their binding activity to V_HT⁺ anti-NP IgM derived from QM mice, free hapten inhibition of the binding of NP-conjugated -Gal to the immobilized anti-NP IgM was assessed. We found that pNP had 20-fold lower affinity than NP (Fig. 2A). pNP has not been tested as a NP analog by other investigators. In contrast, m-nitrophenylacetyl showed a comparable affinity to NP, while NIP bound to the anti-NP Ab more strongly than NP, as observed in various anti-NP mAbs (21, 35). The 4-hydroxyphenylacetyl showed no significant binding. Thus, stimulation of QM B cells with haptens of varying affinity will provide useful means to analyze the correlation between the intensity of BCR engagement and subsequent B cell differentiation.

View larger version (29K): [in this window] [in a new window]   FIGURE 1. Flow cytometric analysis of BCR expressed on peripheral B cells of QM mice. A, LN B220+ B cells were examined for the expression of VHT+ BCR. The percentage of VHT Id+ cells in B220+ B cells (16.5% of total LN cells) is indicated in the parentheses. B, The percentage of 1+ or 2+ cells among B220+Id+-gated cells. Data are the representative of three measurements.

View larger version (14K): [in this window] [in a new window]   FIGURE 2. A, Estimation of relative affinity of NP-related haptens for VHT+ BCR of QM B cells. pNP is a low affinity analog of NP. NP--Gal was incubated in the microplates coated with anti-NP IgM purified from a QM mouse serum in the presence of varying concentrations of each hapten. Affinity of each hapten for VHT+ BCR was estimated by measuring the free hapten inhibition of binding of NP--Gal to anti-NP IgM. IC50 of each hapten is shown. Relative affinity of each hapten was calculated as the reciprocal of IC50 and shown in the parentheses, in which the value of NP is designated as 1. B, Comparison of the potency to down-regulate sIgM on QM B cells between NIP-CGG and pNP-CGG. After incubation of spleen B cells with 1 µg/ml NIP25-CGG or pNP25-CGG for 3 h, B220+-gated cells were analyzed for the expression of sIgM by flow cytometry. Thick and thin diagrams represent NIP- or pNP-CGG-treated B cells and mock-treated B cells, respectively. Representative data from four repeated experiments are shown. C, Induction of IgM Ab response in QM B cells in vitro. The spleen B cells were cocultured in triplicate with CGG-specific Th2 cells in the presence of varying concentrations of pNP-CGG (•) or NIP-CGG (). VHT Id+ IgM levels in the culture supernatants were assayed. Data are the representative of five repeated experiments.

In addition, pNP was able to elicit the hapten-specific V_HT⁺ IgG response efficiently in QM mice, as shown in the following section. These observations led us to investigate how V_HT/1 and V_HT/2 B cells that are originally specific for NP or NIP are triggered by pNP and undergo affinity maturation toward this low affinity hapten, and how the site-directed V_HT is modified during the affinity maturation process.

Affinity maturation of anti-pNP IgG

When QM mice were immunized with pNP-CGG in the footpad, serum anti-pNP IgG Abs that were negligible on day 0 increased appreciably from day 8 to 16 after immunization (Fig. 3A). Anti-pNP IgM titer was apparently high in the preimmune serum because V_HT⁺ anti-NP IgM Abs that are spontaneously present at a high level showed cross-reactivity with pNP, but was further increased after immunization (data not shown). Concomitant with an increase in anti-pNP IgG titer, there was a significant increase in the affinity of IgG Abs to pNP that was assessed by the ratio of the Ab binding to the low density hapten (pNP₄-BSA) to the binding to the high density counterpart (pNP₂₀-BSA) (Fig. 3B). The ratio (pNP₄-pNP₂₀) increased from 0.1 on day 8 to 0.6 on day 16, indicating that affinity maturation coupled with isotype switching occurred in this knockin strain.

View larger version (14K): [in this window] [in a new window]   FIGURE 3. A, Anti-pNP IgG response in QM mice immunized with pNP-CGG. QM mice (n = 4–5) were immunized in the footpad with pNP-CGG/CFA, and bled on indicated days. B, Affinity maturation of anti-pNP IgG. Sera collected on days 8 and 16 after immunization were assessed for the relative affinity of anti-pNP IgG Abs by measuring the ratio, the amount of IgG bound to pNP4-BSA/the amount of IgG bound to pNP20-BSA (pNP4-pNP20). In each panel, and • indicate two separate experiments.

To investigate how V_HT⁺⁺ Abs that were originally specific for NP underwent affinity maturation toward pNP by altering their Ag specificity, B cell hybridomas were generated from the draining LN cells on day 16 after immunization. Among 150 clones that secreted pNP-reactive IgG mAbs, 15 high affinity clones (pNP₄-pNP₂₀ > 0.7) were selected, of which 8 clones were V_HT⁺, and the rest were found to use endogenous V_H genes that are considered to be generated by the replacement of the V_H portion of V_HT with upstream endogenous V_H or V_HD, as reported previously (22, 36, 37) (Table I). V_H and V_L gene usage was examined by ELISA and/or RT-PCR. A characteristic feature is that all the V_HT⁺ anti-pNP IgG mAbs examined used 2 as the L chain, while both 1 and 2 were used in V_HT^- anti-pNP IgG mAbs (Table I). In contrast, all pNP-reactive IgM mAbs examined were V_HT⁺, and used either 1 or 2 L chains (Table I), suggesting that both V_HT/1 and V_HT/2 B cells were activated in response to pNP to differentiate into IgM producers. More direct evidence is presented in the later section.

View larger version (38K): [in this window] [in a new window]   FIGURE 4. Ag specificity of anti-pNP IgG or IgM mAbs obtained from pNP-CGG-immunized QM mice. The Ag specificity was assessed by measuring the binding of an appropriately diluted mAb to microplates coated with pNP-, NP-, or NIP-BSA. As the control, the Ag specificity of unmutated VHT/2 IgM or VHT/2 IgG1 mAb is shown. Data are presented as relative binding to each hapten, in which the highest value in each mAb is expressed as 100. Anti-pNP IgG mAbs shown here exhibit high affinity for pNP (pNP4-pNP20 > 0.7). All mAbs listed in Table I were examined, and results from representative clones are presented.

V_H and V_L sequences of V_HT⁺ anti-pNP mAbs

To identify somatic mutations that led to the change of Ag specificity from NP to pNP, nucleotide sequences of the V_H and V_L genes in V_HT⁺ anti-pNP IgG mAbs listed in Table I were analyzed. Data from six representative clones are shown (Fig. 5A). There was a unanimously shared point mutation (T to A) at position 313 (T313A), which resulted in the replacement of Tyr¹⁰⁵ with Asn. An additional mutation (G to A) at position 316 (G316A) that caused the change of Ala¹⁰⁶ to Thr was found in four of six IgG clones (Fig. 5A). There were one to three point mutations in the 2-chain of each IgG clone, but no common replacement mutation was found (Fig. 5B).

View larger version (51K): [in this window] [in a new window]   FIGURE 5. Nucleotide sequences of the VHT and V2 genes in anti-pNP mAbs. A, VHT nucleotide sequences in anti-pNP mAbs. Results from six IgG clones (G51, 142, 166, 149, 83, and 14) and one IgM clone (M53) listed in Table I are shown as representatives. Dots indicate sequence identity with unmutated VHT (17.2.25). Capital and small letters indicate amino acid replacement mutations and silent mutations, respectively. Asterisks at position 313–315 show a unanimous replacement mutation (Tyr to Asn) in these anti-pNP mAbs. IgM clones other than M53 that are shown in Table I have no somatic mutation in VHT (data not shown). B, V2 nucleotide sequences of the VHT+ anti-pNP IgG mAbs shown in A.

A pivotal role of the T313A mutation played in the acquisition of pNP specificity was further confirmed by the following transfection experiments. When the V_HT⁺ 2b chain possessing only T313A mutation was expressed in association with the 2-chain in CHO cells, the resultant IgG2b showed an increase in the binding to pNP compared with the native V_HT-encoded 2b (Fig. 6A). When another mutation, G316A, was introduced in addition to T313A, pNP binding of the secreted IgG2b further increased to the level that was comparable to that observed in a high affinity anti-pNP IgG2b clone, G149, suggesting that these point mutations play a critical role in the affinity maturation toward pNP.

View larger version (21K): [in this window] [in a new window]   FIGURE 6. Expression of recombinant IgG Abs in CHO cells. A, Contribution of mutations T313A and G316A in CDR3 of VHT+ 2b to an increase in pNP specificity. VHT+ 2b bearing none, T313A only, or G316A in addition to T313A (G316A/T313A) was each expressed together with 2 in CHO cells. As the control, 2b from G149 anti-pNP IgG2b mAb (see Table I) and native VHT+ 2b were expressed. Binding of secreted IgG to pNP was assayed by ELISA in appropriately diluted culture supernatants. B, Mutated VHT+ 2b chains from G83 and G149 anti-pNP mAbs can associate with the 1-chain. The mutated VHT+ 2b gene derived from the clones, G83 or G149, was expressed together with the native 1 or 2 gene in CHO cells. As the positive control, native VHT-encoded 2b was expressed. IgG secretion was measured by a sandwich ELISA using anti-IgG and anti-1 or anti-2. C, The 2-, but not the 1-chain forms pNP-specific IgG2b when expressed together with mutated VHT+ 2b chains derived from G83 and G149 in CHO cells. Native VHT+ 2b was used as a negative control.

Analysis of the mechanism leading to predominant use of the 2-chains in high affinity V_HT⁺anti-pNP IgG

Because V_HT⁺ QM B cells expressed 1 and 2 at comparable frequency (Fig. 1B), we investigated why 2 was predominantly used in high affinity V_HT⁺ anti-pNP IgG. This may be due to either that V_HT⁺ -chains harboring mutations that are responsible for the pNP specificity are structurally unfavorable in associating with the 1-chain, or that there is a difference in the affinity for pNP between V_HT/1 and V_HT/2 B cells. To examine whether the former possibility is correct, we transfected CHO cells with the mutated V_HT⁺ 2b genes derived from the two representative anti-pNP IgG2b clones, G83 and G149, together with the 1 or 2 gene, respectively. Sandwich ELISA using anti- and anti- revealed that either 2b chain was secreted in association with 1 or 2, respectively (Fig. 6B), thus ruling out that there is some incompatibility between the mutated 2b and 1. In contrast, IgG2b comprised of these V_HT⁺ 2b and the 1-chain showed much lower binding to pNP than the original 2-associated counterpart, thus suggesting that V_HT/1 B cells cannot improve their affinity for pNP by using the same IgH mutations as those used in V_HT/2 anti-pNP IgG mAbs (Fig. 6C).

Next, we compared unmutated V_HT/1 and V_HT/2 IgM for their affinity for pNP to estimate the affinity of each QM BCR for the hapten. V_HT/1 and V_HT/2 IgM showed comparable affinity for NP, while the former is considered to bind pNP 50- to 100-fold less strongly than the latter, as assessed by the displacement of pNP-bound Abs with increasing concentrations of free NP (Fig. 7, A and B). Because V_HT/1 IgM has very low affinity for pNP, the relative affinity of pNP estimated in Fig. 2A may virtually represent that of V_HT/2. We compared the relative affinity of V_HT/2 IgM mAb for pNP and NP with displacement ELISA, and obtained a similar result to those shown in Fig. 2 (data not shown).

View larger version (15K): [in this window] [in a new window]   FIGURE 7. A, Comparable binding of VHT/1 and VHT/2 IgM to NP. VHT/1 and VHT/2 IgM mAbs bound to a NP7-BSA-coated plate were incubated with varying concentrations of free NP. NP--aminocaproate was used as free NP. After washing, the level of residual IgM Abs on the plate was assayed. B, Comparison of the affinity for pNP between VHT/1 and VHT/2 IgM mAbs. VHT/1 and VHT/2 IgM mAbs bound to a pNP20-BSA-coated plate were displaced by varying concentrations of free NP. In each panel, and indicate VHT/1 IgM and VHT/2 IgM, respectively.

View larger version (46K): [in this window] [in a new window]   FIGURE 8. A, Detection of CD138+ B cells in the draining LN of QM mice after immunization. On day 5 after immunization with pNP-CGG in the footpad, the popliteal LN cells were analyzed for the expression of the Id of VHT and CD138. B, Id+-gated CD138+ cells from the day 5 LN cells were analyzed for the expression of the 1 (left panel) or the 2 (right panel) L chain. The number in each diagram represents percentage of the indicated population in the total gated cells.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
In QM mice with limited B cell diversity, we monitored how the two major B cell populations bearing NP-specific BCR, V_HT/1 and V_HT/2, were clonally selected and committed to affinity maturation in the immune response to a hapten pNP, a low affinity analog of NP. NP shows comparable affinity for V_HT/1 and V_HT/2 BCR, while pNP binds to V_HT/2 BCR 20-fold less strongly than NP. In contrast, V_HT/1 B cells have very low affinity for NP and pNP, which bind pNP 50- to 100-fold less efficiently than V_HT/2 B cells. The QM system is considered to have the following two characteristic features. One is that, by stimulating QM B cells with pNP, it is possible to investigate how originally NP-specific B cells somatically mutate their V region genes and change the Ag specificity toward pNP during affinity maturation. The other is that one is able to analyze how differentially V_HT/1 and V_HT/2 B cells respond to pNP depending on the intensity of BCR signals. Because pNP preferentially induces IgG Abs bearing the L chain, as we reported previously (25), it is reasonable to analyze anti-pNP response in QM mice who exclusively express -chains (22).

In consequence of affinity maturation of V_HT⁺ anti-pNP IgG, the Ag specificity of the resultant Abs was changed to pNP > NP > NIP in contrast to that of the unmutated Abs (NIP > NP > pNP). A common point mutation, T313A in CDR3 of V_HT is considered to be critical for generating the pNP specificity, although some other mutations, including G316A and those present in CDR2, may also be partly involved. The importance of the T313A mutation was confirmed by the observation that the V_HT-encoded 2b chain harboring only the T313A mutation constituted IgG2b with increased pNP specificity when it was expressed in CHO cells together with the unmutated 2-chain (Fig. 6A).

An IgM mAb, M53 is unique in that it showed higher specificity for pNP than NP. This is considered to be due to the presence of the same replacement mutations as those shared by V_HT⁺ anti-pNP IgG mAbs (Fig. 5A). Somatic hypermutation and isotype switching are considered to occur in a coordinated fashion, with the latter initiating later than the onset of the former in GC (37). The mutation frequency is usually higher in the IgG classes than in the IgM class (7, 38). The link between somatic hypermutation and isotype switching has been recently explained at the molecular level by the discovery of activation-induced cytidine deaminase, a putative RNA-editing enzyme responsible for these two processes (3, 39, 40). The replacement mutations, including T313A and G316A, found in high affinity V_HT⁺ anti-pNP IgG mAbs are considered to reflect the positive selection of high affinity B cells that occurred in GC (1, 2). Therefore, M53, whose Ag specificity is shifted to pNP with the same mutations, may have also been subjected to positive selection. It has been shown using lymphotoxin--deficient mice that affinity maturation occurred without GC, although with reduced efficiency (41). The occurrence of IgM Abs such as M53 implies that a part of hypermutation/positive selection can occur at the IgM level.

IgM mAbs that were isolated from pNP-CGG-immunized QM mice almost exclusively bore V_HT⁺ IgH, whereas 40% of high affinity anti-pNP IgG mAbs used endogenous V_H genes. Because one J_H locus is disrupted, endogenous V_H genes found in the V_HT^- IgG Abs may have been generated by the replacement of V_H in the V_HT segment with upstream V_H or V_H-D segments, as reported previously (22, 36, 42). The apparent absence of V_HT^- IgM clones in immunized mice implicates that these were very minor in an early stage of the immune response probably due to low frequency of the precursor cells, but expanded drastically during GC reactions through competition with an enormous number of V_HT⁺ B cells. In a B cell line, LK35.2 expressing BCR specific for hen egg lysozyme, it has been shown that BCR-mediated triggering by mutant Ags with varying affinity, as assessed by Ag presentation to a T cell hybridoma, required a K_a value higher than 10⁶ M^-1. The minimal concentration of an Ag that is required to trigger a response decreased as the affinity increased (43). The parallelism between the intensity of BCR engagement and B cell activation has also been reported in 3-83 anti-H-2K^k transgenic B cells stimulated with recombinant virus-displayed peptide Ags with low or high affinity for the BCR (44). These findings suggest the strict nature of the selection process depending on the affinity of BCR for an Ag.

Recently, dependence of a T cell-independent or a T cell-dependent anti-NP Ab response on BCR affinity for the hapten has been analyzed in two lines of mice that carry targeted VHBI-8 anti-NP IgH genes with low or high affinity for the hapten (45, 46). When these two populations compete with each other in the responses to NP-Ficoll and NP-keyhole limpet hemocyanin, only high affinity B cells were found to respond preferentially, while low affinity B cells could respond significantly if there is no competitor. In the T cell-dependent anti-NP response, high affinity B cells predominantly accumulated in GC (46). Similar observations have been made in mice transgenic for mutated V_H 186.2-encoded µ genes that generate BCR with low or high affinity for NP when combined with the 1-chain (47). Consistent with these results, it has been reported that B cells with a wide variety of affinity for an inducing Ag populated early GC, but high affinity B cells gradually dominated during the course of an immune response (48).

Affinity maturation has not been fully analyzed in mice carrying a targeted Ab gene. QM mice are considered to be advantageous for analyzing selection and differentiation of B cells during an Ab response in that B cell repertoire is more limited due to the lack of genes, and that isotype switching and somatic mutation occur normally. In contrast, it may be argued that the situation in QM mice is unphysiological due to the abnormally high frequency of specific B cells. One of the experimental designs to avoid the unphysiological situation may be to use an adoptive transfer system. We immunized C57BL/6 mice (IgM^b) that were injected with 2 x 10⁶ QM B cells (IgM^a) with pNP-CGG or NP-CGG. NP-CGG with higher affinity for QM B cells than pNP-CGG induced IgM^a response in these mice. In contrast, while anti-pNP IgM^b Abs were induced by pNP-CGG, the production of IgM^a was negligible (H. Ohmori et al., manuscript in preparation). Thus, the transferred QM B cells with lower affinity for pNP are considered to be outcompeted by high affinity B cells of the host, suggesting that the adoptive transfer system is not advantageous in this case.

In contrast, immunization of intact QM mice with pNP-CGG resulted in the induction of IgM production predominantly from V_HT⁺ B cells. Besides the extremely high frequency of V_HT/ B cells (80% of total B cells), this may be due to a lower level of competitor B cells in QM mice, because the V_HT^- B cell diversity may be considerably limited due to disruption of the J_H locus on one allele and both loci (22). As we reported previously, in (QM x C57BL/6)F₁ mice (V_HT/germline, ⁺/^-, ⁺/⁺) that have 4–7% V_HT/ B cells and more diverse V_HT^- B cell repertoire than QM mice, V_HT^- B cells were preferentially activated by pNP-CGG (25). These are consistent with recent reports describing that even very low affinity B cells are activated by an Ag when relieved of competition from higher affinity B cells (46, 47). Despite some disadvantages relating to the unusual B cell repertoire, the anti-pNP Ab response in intact QM mice is likely to obey normal regulatory mechanisms, as follows: 1) The time course of the anti-pNP Ab response, IgG class switching, and GC formation (our unpublished observation) were normal in QM mice compared with wild-type mice. 2) The frequency of V_HT⁺ IgM-secreting B cells after immunization (less than 0.1% in the draining LN cells) was comparable to that observed in wild-type mice. 3) pNP-CGG-induced IgM-secreting plasma cells were derived from V_HT/1 or V_HT/2 B cells, and a majority of V_HT⁺ anti-pNP IgG Abs were the products of V_HT/2 B cells, which were found to bear a common point mutation in CDR3, contributing to affinity maturation toward pNP. Thus, it is suggested that V_HT⁺ B cells were activated in response to pNP-CGG and recruited to GC, in which mutated B cells were normally selected on the basis of the affinity for pNP. In addition, when QM mice were immunized with viral Ags (49) or SRBC (50) that were irrelevant to NP, V_HT^- B cells were exclusively involved in these Ag-specific Ab responses. We also confirmed that pNP-CGG, but not CGG without haptens, induced V_HT⁺ Abs in QM B cells that were cultured with CGG-specific Th2 clone (Fig. 2C). These data suggest that V_HT⁺ B cells in QM mice are normally subjected to affinity-dependent clonal selection.

Although pNP is a low affinity hapten for QM B cells, especially for V_HT/1 B cells (Figs. 2 and 7), pNP-CGG used is considered to have enough affinity for triggering QM B cells because both V_HT/1 and V_HT/2 IgM Abs were produced in the anti-pNP Ab response. The apparent absence of 1⁺ anti-pNP IgG may be the result of competition between the two B cell populations with differential affinity for pNP that occurred in the early phase of the immune response. Although the detailed mechanism remains to be elucidated, weak signals via V_HT/1 BCR are sufficient for inducing IgM Ab responses, but may not satisfy the requirements for the recruitment to affinity maturation pathway. By using NP analogs of varying affinity, the QM system will provide an excellent means to investigate how BCR signal intensity regulates B cell selection and the subsequent differentiation.

	Acknowledgments

 
We thank Dr. T. Imanishi-Kari (Tufts University, Boston, MA) and Dr. B. Diamond (Albert Einstein College of Medicine, New York, NY) for generously providing the anti-Id mAb, R2.438, and the myeloma cell line, NSO^bcl-2, respectively. Technical assistance of H. Egusa in generating CGG-specific Th2 clones is greatly acknowledged.

	Footnotes

 
¹ This work was supported by grants-in-aid from the Ministry of Education, Science, and Culture of Japan to H.O. (13037024 and 12450334) and N.K. (12750704). M.C. was supported by a grant from the National Institutes of Health (AI 48602).

² Current address: Institute for Liver Research, Kansai Medical University, Moriguchi 570-8506, Japan.

³ Address correspondence and reprint requests to Dr. Hitoshi Ohmori, Department of Biotechnology, Faculty of Engineering, Okayama University, Tsushima-Naka, Okayama, 700-8530, Japan. E-mail address: hit2224{at}biotech.okayama-u.ac.jp

⁴ Abbreviations used in this paper: GC, germinal center; BCR, B cell Ag receptor; -Gal, -galactosidase; CDR, complementarity-determining region; CGG, chicken -globulin; CHO, Chinese hamster ovary; LN, lymph node; NIP, 4-hydroxy-5-iodo-3-nitrophenylacetyl; NP, 4-hydroxy-3-nitrophenylacetyl; pNP, p-nitrophenylacetyl; QM, quasi-monoclonal; sIgM, surface IgM.

Received for publication July 11, 2002. Accepted for publication October 17, 2002.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Rajewsky, K.. 1996. Clonal selection and learning in the antibody system. Nature 381:751.[Medline]
2. Kelsoe, G.. 1996. Life and death in germinal centers (Redux). Immunity 4:107.[Medline]
3. Honjo, T., K. Kinoshita, M. Muramatsu. 2002. Molecular mechanism of class switch recombination: linkage with somatic hypermutation. Annu. Rev. Immunol. 20:165.[Medline]
4. Tarlinton, D. M., K. G. C. Smith. 2000. Dissecting affinity maturation: a model explaining selection of antibody-forming cells and memory B cells in the germinal center. Immunol. Today 21:436.[Medline]
5. Lindhout, E., G. Koopman, S. T. Pals, C. de Groot. 1997. Triple check for antigen specificity of B cells during germinal center reactions. Immunol. Today 18:573.[Medline]
6. Przylepa, J., C. Himes, G. Kelsoe. 1998. Lymphocyte development and selection in germinal center. Curr. Top. Microbiol. Immunol. 229:85.[Medline]
7. Wagner, S. D., M. S. Neuberger. 1996. Somatic hypermutation of immunoglobulin genes. Annu. Rev. Immunol. 14:441.[Medline]
8. Neuberger, M. S., C. Milstein. 1995. Somatic hypermutation. Curr. Opin. Immunol. 7:248.[Medline]
9. Wabl, M., M. Cascalho, C. Steinberg. 1999. Hypermutation in antibody affinity maturation. Curr. Opin. Immunol. 11:186.[Medline]
10. Banchereau, J., R. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245.[Medline]
11. Tew, J. G., J. Wu, M. Fakher, A. Szakal, D. Qin. 2001. Follicular dendritic cells: beyond the necessity of T cell help. Trends Immunol. 22:361.[Medline]
12. Fischer, M. B., S. Goerg, S. LiMing, A. P. Prodeus, C. C. Goodnow, G. Kelsoe, M. C. Carroll. 1998. Dependence of germinal center B cells on expression of CD21/CD35 for survival. Science 280:582.[Abstract/Free Full Text]
13. Chen, Z., S. B. Koralov, M. Gendelman, M. C. Carroll, G. Kelsoe. 2000. Humoral immune responses in Cr2^-/- mice: enhanced affinity maturation but impaired antibody persistence. J. Immunol. 164:4522.[Abstract/Free Full Text]
14. Kaartinen, M., G. M. Griffiths, A. F. Marrkham, C. Milstein. 1983. mRNA sequences define an unusually restricted IgG response to 2-phenyl-5-oxazolone and its early diversification. Nature 304:320.[Medline]
15. Griffiths, G. M., C. Berek, M. Kaartinen, C. Milstein. 1984. Somatic mutation and the maturation of immune response to 2-phenyl-5-oxazolone. Nature 312:271.[Medline]
16. Bothwell, A. L. M., M. Paskind, M. Reth, T. Imanishi-Kari, K. Rajewsky, D. Baltimore. 1981. Heavy chain variable region contribution to the NP^b family of antibodies: somatic mutation evident in a -2a variable region. Cell 24:625.[Medline]
17. Rajewsky, K., I. Förester, A. Cumano. 1987. Evolutionary and somatic selection of the antibody repertoire in the mouse. Science 238:1088.[Abstract/Free Full Text]
18. Jacobs, J., J. Przylepa, C. Miller, G. Kelsoe. 1993. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. III. The kinetics of V region mutation and selection in germinal center B cells. J. Exp. Med. 178:1293.[Abstract/Free Full Text]
19. Jacobs, J., G. Kelsoe. 1992. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. II. A common clonal origin for PALS-associated foci and germinal centers. J. Exp. Med. 176:697.
20. Furukawa, K., A. Akasako-Furukawa, H. Shirai, H. Nakamura, T. Azuma. 1999. Junctional amino acids determine the maturation pathway of an antibody. Immunity 11:329.[Medline]
21. White-Scharf, M. E., T. Imanishi-Kari. 1981. Characterization of the NP^a idiotype through the analysis of monoclonal BALB/c anti-(4-hydroxy-3-nitrophenyl)acetyl (NP) antibodies. Eur. J. Immunol. 11:897.[Medline]
22. Cascalho, M., A. Ma, S. Lee, L. Masat, M. Wabl. 1996. A quasi-monoclonal mouse. Science 272:1649.[Abstract]
23. Cascalho, M., J. Wong, C. Steinberg, M. Wabl. 1998. Mismatch repair co-opted by hypermutation. Science 279:1207.[Abstract/Free Full Text]
24. Taki, S., M. Meiering, K. Rajewsky. 1993. Targeted insertion of a variable region gene into the immunoglobulin heavy chain locus. Science 262:1268.[Abstract/Free Full Text]
25. Magari, M., T. Sawatari, Y. Kawano, M. Cascalho, M. Wabl, N. Kanayama, M. Hikida, H. Ohmori. 2002. Contribution of light chain rearrangement in peripheral B cells to the generation of high-affinity antibodies. Eur. J. Immunol. 32:957.[Medline]
26. Ohmori, H., M. Hikida, T. Takai. 1990. Prostaglandin E₂ as a selective stimulator of antigen-specific IgE response in murine lymphocytes. Eur. J. Immunol. 20:2499.[Medline]
27. Hikida, M., T. Takai, H. Ohmori. 1996. Requirements of a costimulus for IL-4-induced IgE class switching in murine B cells activated via antigen receptors: effectiveness of 8-mercaptoguanosine. J. Immunol. 156:2730.[Abstract]
28. Herzenberg, L. A., S. J. Black, T. Tokuhisa. 1980. Memory B cells at successive stages of differentiation: affinity maturation and the role of IgD receptors. J. Exp. Med. 151:1071.[Abstract/Free Full Text]
29. Gerdes, M., M. Meusel, F. Spener. 1997. Development of a displacement immunoassay by exploiting cross-reactivity of a monoclonal antibody. Anal. Biochem. 252:198.[Medline]
30. Ray, S., B. Diamond. 1994. Generation of a fusion partner to sample the repertoire of splenic B cells destined for apoptosis. Proc. Natl. Acad. Sci. USA 91:5548.[Abstract/Free Full Text]
31. Kanayama, N., C. Hukue, M. Magari, K. Ohtani, M. Hikida, M. Yamada, S. Matsuda, H. Ohmori. 2001. Use of secondarily revised V_H genes in IgE antibodies produced in mice infected with the nematode Nippostrongylus brasiliensis. Immunol Lett. 77:181.[Medline]
32. Nadel, B., A. M. Drapier, P. A. Cazenave, P. Sanchez. 1993. Available B cell repertoire in the mouse: evidence of positive selection by environmental factors. Eur. J. Immunol. 23:537.[Medline]
33. Johnson, G., T. T. Wu. 2001. Kabat database and its applications: future directions. Nucleic Acids Res. 29:205.[Abstract/Free Full Text]
34. De la Luna, S., I. Soria, D. Pulido, J. Ortin, A. Jimenez. 1988. Efficient transformation of mammalian cells with constructs containing a puromycin-resistance marker. Gene 62:121.[Medline]
35. Imanishi, T., O. Mäkelä. 1973. Strain differences in the fine specificity of mouse anti-hapten antibodies. Eur. J. Immunol. 3:323.[Medline]
36. Cascalho, M., J. Wong, M. Wabl. 1997. V_H gene replacement in hyperselected B cells of the quasimonoclonal mouse. J. Immunol. 159:5795.[Abstract]
37. Liu, Y. J., F. Malisan, O. de Bouteiller, C. Guret, S. Lebecque, J. Banchereau, F. C. Mills, E. E. Max, H. Martinez-Valdez. 1996. Within germinal centers, isotype switching of immunoglobulin genes occurs after the onset of somatic mutation. Immunity 4:241.[Medline]
38. Sohn, J., R. M. Gerstein, C. L. Hsieh, M. Lemer, E. Selsing. 1993. Somatic hypermutation of an immunoglobulin µ chain transgene. J. Exp. Med. 177:493.[Abstract/Free Full Text]
39. Muramatsu, M., K. Kinoshita, S. Fagarasan, S. Yamada, Y. Shinkai, T. Honjo. 2000. Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell 102:553.[Medline]
40. Yoshikawa, K., I. Okazaki, T. Eto, K. Kinoshita, M. Muramatsu, H. Nagaoka, T. Honjo. 2002. AID enzyme-induced hypermutation in an actively transcribed gene in fibroblasts. Science 296:2033.[Abstract/Free Full Text]
41. Matsumoto, M., S. F. Lo, C. J. Carruthers, J. Min, S. Mariathasan, G. Huang, D. R. Plas, S. M. Martin, R. S. Geha, M. H. Nahm, D. D. Chaplin. 1996. Affinity maturation without germinal centers in lymphotoxin--deficient mice. Nature 382:462.[Medline]
42. Bertrand, F. E., R. Golub, G. E. Wu. 1998. V_H gene replacement occurs in the spleen and bone marrow of non-autoimmune quasi-monoclonal mice. Eur. J. Immunol. 28:3362.[Medline]
43. Batista, F. D., M. S. Neuberger. 1998. Affinity dependence of the B cell response to antigen: a threshold, a ceiling, and the importance of off-rate. Immunity 8:751.[Medline]
44. Kouskoff, V., S. Famiglietti, G. Lacaud, P. Lang, J. E. Rider, B. K. Kay, J. C. Cambier, D. Nemazee. 1998. Antigen varying in affinity for the B cell receptor induces differential B lymphocyte responses. J. Exp. Med. 188:1453.[Abstract/Free Full Text]
45. Shih, T. Y., M. Roederer, M. Nussenzweig. 2002. Role of antigen receptor affinity in T cell-independent antibody responses in vivo. Nat. Immun. 3:399.
46. Shih, T.-A. Y., E. Meffre, M. Roederer, M. C. Nussenzweig. 2002. Role of BCR affinity in T cell-dependent Ab responses in vivo. Nat. Immun. 3:570.
47. Dal Porto, J. M., A. M. Harberman, G. Kelsoe, M. J. Shlomchik. 2002. Very low affinity B cells form germinal centers, become memory B cells, and participate in secondary immune responses when higher affinity competition is reduced. J. Exp. Med. 195:1215.[Abstract/Free Full Text]
48. Dal Porto, J. M., A. M. Harberman, M. J. Shlomchik, G. Kelsoe. 1998. Antigen drives very low affinity B cells to become plasmacytes and enter germinal centers. J. Immunol. 161:5373.[Abstract/Free Full Text]
49. Lopez-Macias, C., U. Kalinke, M. Cascalho, M. Wabl, H. Hengartner, R. M. Zinkernagel, A. Lamarre. 1999. Secondary rearrangements and hypermutation generate sufficient B cell diversity to mount protective antiviral immunoglobulin responses. J. Exp. Med. 189:1791.[Abstract/Free Full Text]
50. Madan, M. K., R. Golub, M. Wabl, G. E. Wu. 2000. Specific antibody production by V(H)-gene replacement. Eur. J. Immunol. 30:2404.[Medline]

This article has been cited by other articles:

				T. Onodera, J. C. Poe, T. F. Tedder, and T. Tsubata CD22 Regulates Time Course of Both B Cell Division and Antibody Response J. Immunol., January 15, 2008; 180(2): 907 - 913. [Abstract] [Full Text] [PDF]

				B. P. O'Connor, L. A. Vogel, W. Zhang, W. Loo, D. Shnider, E. F. Lind, M. Ratliff, R. J. Noelle, and L. D. Erickson Imprinting the Fate of Antigen-Reactive B Cells through the Affinity of the B Cell Receptor J. Immunol., December 1, 2006; 177(11): 7723 - 7732. [Abstract] [Full Text] [PDF]

				Y. Nishikawa, M. Hikida, M. Magari, N. Kanayama, M. Mori, H. Kitamura, T. Kurosaki, and H. Ohmori Establishment of Lymphotoxin beta Receptor Signaling-Dependent Cell Lines with Follicular Dendritic Cell Phenotypes from Mouse Lymph Nodes J. Immunol., October 15, 2006; 177(8): 5204 - 5214. [Abstract] [Full Text] [PDF]

				N. Kanayama, K. Todo, S. Takahashi, M. Magari, and H. Ohmori Genetic manipulation of an exogenous non-immunoglobulin protein by gene conversion machinery in a chicken B cell line Nucleic Acids Res., January 18, 2006; 34(2): e10 - e10. [Abstract] [Full Text] [PDF]

				N. Kanayama, M. Cascalho, and H. Ohmori Analysis of Marginal Zone B Cell Development in the Mouse with Limited B Cell Diversity: Role of the Antigen Receptor Signals in the Recruitment of B Cells to the Marginal Zone J. Immunol., February 1, 2005; 174(3): 1438 - 1445. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kanayama, N. Articles by Ohmori, H. Search for Related Content PubMed PubMed Citation Articles by Kanayama, N. Articles by Ohmori, H.